Starting /dee2/code/volunteer_pipeline.sh ERR1806555 current disk space = 1523093454848 free memory = 1446706180 ERR1806555 SRAfilesize 44f6fd5f43cf5f92086e538fc469b31d ERR1806555.sra ERR1806555.sra file validated ERR1806555 is single end ERR1806555 is conventional basespace ERR1806555 read1 length is 8-222 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1806555_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 8-222 %GC 50 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.89925 24.0 21.0 26.0 17.0 27.0 2 22.67025 24.0 20.0 26.0 16.0 27.0 3 22.4315 23.0 20.0 26.0 14.0 28.0 4 22.72 24.0 20.0 26.0 14.0 28.0 5 22.4395 24.0 20.0 26.0 14.0 28.0 6 22.54375 24.0 20.0 26.0 14.0 28.0 7 22.57225 24.0 20.0 26.0 14.0 28.0 8 22.51225 24.0 20.0 26.0 14.0 28.0 9 22.46646571213263 24.0 20.0 26.0 14.0 28.0 10-14 22.716087521407708 24.0 20.0 26.0 15.6 28.0 15-19 23.069605258358028 24.0 20.2 26.0 16.2 28.0 20-24 23.41410591791901 25.0 21.0 26.8 17.2 28.0 25-29 23.404853108279 25.0 21.0 26.8 17.2 28.0 30-34 23.342031518498942 25.0 21.0 26.2 17.0 28.0 35-39 23.264526999366765 24.8 20.6 26.4 17.0 28.0 40-44 23.192146247888523 24.2 20.4 26.0 16.4 28.0 45-49 23.21863130444816 24.0 20.8 26.0 16.8 28.0 50-54 23.13063539294374 24.0 20.2 26.0 16.8 27.8 55-59 23.176447203950996 24.0 20.6 26.0 17.0 27.8 60-64 23.15920186199549 24.4 20.0 26.0 17.0 27.6 65-69 23.181810778221372 24.2 20.6 26.0 17.0 27.0 70-74 23.120159504869456 24.0 20.4 26.0 17.0 27.0 75-79 23.101175941309897 24.0 20.2 26.0 17.0 27.0 80-84 22.998444663584714 24.0 20.2 26.0 16.6 27.0 85-89 22.958286835648742 24.0 20.0 26.0 17.0 27.0 90-94 22.789921724147398 24.0 20.0 26.0 16.6 27.0 95-99 22.59838524946956 24.0 20.0 26.0 16.0 27.0 100-104 22.683580232761354 24.0 20.0 26.0 16.2 27.0 105-109 22.63352403190425 23.8 20.0 26.0 16.4 27.0 110-114 22.537380564099305 24.0 20.0 26.0 16.4 27.0 115-119 22.325754803037096 23.0 20.0 26.0 16.0 27.0 120-124 22.176141723689476 23.0 19.6 25.2 15.6 27.0 125-129 22.13278930469704 23.0 19.4 25.6 15.0 27.0 130-134 21.875815843202616 22.8 19.0 25.2 15.2 27.0 135-139 21.313843744050672 22.0 18.8 25.0 14.4 26.2 140-144 21.29502558645037 22.0 18.6 25.0 14.2 26.4 145-149 21.20663989545808 22.0 18.8 25.0 14.2 26.0 150-154 21.130138452338457 21.6 18.4 24.8 14.2 26.0 155-159 20.77042773771197 21.4 17.8 24.2 13.2 26.0 160-164 20.23733991332877 20.6 17.2 23.8 12.6 25.8 165-169 20.1014523044542 20.0 17.0 24.0 12.0 26.0 170-174 20.13491494421072 NaN NaN NaN NaN NaN 175-179 20.36134511353949 NaN NaN NaN NaN NaN 180-184 18.995985033903263 NaN NaN NaN NaN NaN 185-189 19.155714285714286 NaN NaN NaN NaN NaN 190-194 20.073076923076922 NaN NaN NaN NaN NaN 195-199 18.54676767676768 NaN NaN NaN NaN NaN 200-204 16.86952380952381 NaN NaN NaN NaN NaN 205-209 17.253333333333334 NaN NaN NaN NaN NaN 210-214 18.5 NaN NaN NaN NaN NaN 215-219 13.8 NaN NaN NaN NaN NaN 220-222 15.666666666666666 NaN NaN NaN NaN NaN >>END_MODULE >>Per sequence quality scores warn #Quality Count 10 2.0 11 2.0 12 8.0 13 23.0 14 24.0 15 37.0 16 68.0 17 102.0 18 151.0 19 190.0 20 266.0 21 342.0 22 478.0 23 689.0 24 839.0 25 630.0 26 142.0 27 7.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.625 44.9 18.4 14.075 2 42.9 34.449999999999996 6.25 16.400000000000002 3 31.525 31.775 20.200000000000003 16.5 4 35.55 28.000000000000004 17.599999999999998 18.85 5 29.2 27.200000000000003 17.325 26.275 6 26.05 27.55 20.8 25.6 7 23.474999999999998 29.475 23.775 23.275000000000002 8 24.3 26.85 24.625 24.224999999999998 9 24.993720170811354 23.9638281838734 24.4410952022105 26.601356443104745 10-14 26.434976442575614 24.727696438522724 24.975935964334568 23.8613911545671 15-19 26.918706745170955 25.612023551286022 23.42216713149468 24.047102572048342 20-24 27.331762241424457 24.776119402985074 23.325477873788948 24.566640481801517 25-29 26.823566912819423 24.7994474844605 24.193805450778303 24.183180151941773 30-34 26.364911523521794 24.30945187742771 24.53603798014674 24.789598618903756 35-39 26.319845857418112 24.849986237269476 23.7214423341591 25.108725571153318 40-44 26.960227272727273 25.392045454545453 23.857954545454547 23.789772727272727 45-49 26.085677297869836 24.802871601741792 24.897022478521833 24.214428621866542 50-54 26.607525237075556 24.79045579687978 23.84827164270419 24.753747323340473 55-59 25.881369016984046 24.311631497683994 24.633299022130725 25.173700463201236 60-64 26.581671122078276 24.703543765850984 24.580163136609777 24.134621975460963 65-69 25.944304547474452 23.61131684194934 24.7889201599763 25.65545845059991 70-74 25.995991983967937 25.01002004008016 24.897795591182366 24.096192384769537 75-79 26.077377280338414 24.640874239887196 25.354719309068475 23.927029170705914 80-84 24.980506822612085 25.00974658869396 25.087719298245613 24.92202729044834 85-89 25.59349593495935 24.791327913279133 25.810298102981026 23.804878048780488 90-94 26.945156956149997 25.125198485403686 24.20911200684011 23.720532551606205 95-99 25.351716375914464 25.140686550365785 24.36691052335397 25.140686550365785 100-104 25.820748522652657 25.279054497701903 25.0 23.900196979645436 105-109 26.04801829268293 24.847560975609756 24.63795731707317 24.466463414634145 110-114 25.175299705948877 25.446731508708435 25.559828093191584 23.818140692151097 115-119 26.25462229265716 24.484944532488115 25.647120972002114 23.613312202852615 120-124 25.047498416719442 24.825839138695375 24.79417352754908 25.332488917036102 125-129 25.339015885315767 24.87407981402557 24.44788841534289 25.339015885315767 130-134 24.43289224952741 26.03969754253308 25.756143667296787 23.77126654064272 135-139 25.15406162464986 24.705882352941178 23.809523809523807 26.330532212885156 140-144 27.37430167597765 23.952513966480446 25.837988826815643 22.835195530726256 145-149 25.107112253641816 22.536418166238217 26.735218508997427 25.621251071122536 150-154 22.186495176848876 24.866023579849948 26.152197213290464 26.79528403001072 155-159 25.0 24.324324324324326 21.62162162162162 29.054054054054053 160-164 24.66216216216216 24.155405405405407 26.52027027027027 24.66216216216216 165-169 20.96069868995633 30.567685589519648 21.83406113537118 26.637554585152838 170-174 24.0 26.0 22.0 28.000000000000004 175-179 25.793650793650798 23.809523809523807 26.190476190476193 24.206349206349206 180-184 28.49462365591398 23.655913978494624 23.118279569892472 24.731182795698924 185-189 22.88135593220339 18.64406779661017 30.508474576271187 27.966101694915253 190-194 12.121212121212121 24.242424242424242 22.727272727272727 40.909090909090914 195-199 36.734693877551024 18.367346938775512 28.57142857142857 16.3265306122449 200-204 20.0 30.0 26.666666666666668 23.333333333333332 205-209 10.0 35.0 25.0 30.0 210-214 50.0 30.0 0.0 20.0 215-219 40.0 50.0 0.0 10.0 220-222 80.0 0.0 20.0 0.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 1.0 9 1.0 10 1.0 11 1.0 12 1.0 13 1.0 14 1.0 15 1.5 16 2.0 17 2.5 18 3.0 19 4.5 20 5.5 21 5.5 22 6.0 23 6.5 24 7.5 25 9.0 26 10.5 27 12.0 28 14.5 29 16.0 30 16.5 31 24.0 32 36.0 33 47.0 34 55.5 35 64.5 36 86.0 37 108.0 38 121.0 39 136.5 40 150.0 41 165.0 42 193.0 43 214.83333333333334 44 236.33333333333331 45 268.33333333333337 46 258.33333333333337 47 245.0 48 253.5 49 254.83333333333334 50 257.83333333333337 51 249.0 52 234.5 53 230.33333333333334 54 225.33333333333334 55 209.33333333333334 56 195.83333333333334 57 185.5 58 182.5 59 173.5 60 175.83333333333331 61 183.83333333333331 62 164.0 63 138.5 64 114.0 65 108.0 66 112.5 67 108.0 68 90.0 69 68.5 70 63.0 71 59.5 72 48.0 73 34.5 74 31.5 75 28.0 76 20.5 77 15.0 78 9.5 79 6.0 80 5.0 81 4.5 82 4.5 83 4.5 84 3.5 85 3.5 86 4.0 87 3.5 88 2.5 89 2.0 90 2.0 91 2.0 92 2.0 93 2.0 94 1.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-159 0.0 160-164 0.0 165-169 0.0 170-174 0.0 175-179 0.0 180-184 0.0 185-189 0.0 190-194 0.0 195-199 0.0 200-204 0.0 205-209 0.0 210-214 0.0 215-219 0.0 220-222 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 5-9 25.0 10-14 78.0 15-19 59.0 20-24 51.0 25-29 49.0 30-34 74.0 35-39 98.0 40-44 123.0 45-49 116.0 50-54 150.0 55-59 172.0 60-64 219.0 65-69 205.0 70-74 218.0 75-79 228.0 80-84 201.0 85-89 219.0 90-94 202.0 95-99 223.0 100-104 167.0 105-109 177.0 110-114 137.0 115-119 131.0 120-124 113.0 125-129 115.0 130-134 68.0 135-139 66.0 140-144 66.0 145-149 43.0 150-154 44.0 155-159 34.0 160-164 28.0 165-169 24.0 170-174 22.0 175-179 12.0 180-184 13.0 185-189 15.0 190-194 4.0 195-199 4.0 200-204 2.0 205-209 3.0 210-214 0.0 215-219 0.0 220-223 2.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21598381385938 98.075 2 0.6828528072837633 1.35 3 0.0 0.0 4 0.0 0.0 5 0.05058168942842691 0.25 6 0.025290844714213456 0.15 7 0.025290844714213456 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGAAGAAGCTCACTGCCGAGGCTTATGACTGCAACAATACGGTTGAGC 7 0.17500000000000002 No Hit GGAGATGGAGGTCTGTGACTTCGACTTTGAGCCCTGCGGCTACTCCATGA 6 0.15 No Hit ACTCCAAGATCATCAACGACAGGGAGACTGGCCGTTCCCGCGGGTTCGGC 5 0.125 No Hit GAGACGCTGTCGATGCCGCTGCTGGTTAGCGGCAGCAACAACGACGTAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.0 0.0 0.0 0.0 0.0 80-84 0.0 0.0 0.0 0.0 0.0 85-89 0.0 0.0 0.0 0.0 0.0 90-94 0.0 0.0 0.0 0.0 0.0 95-99 0.0 0.0 0.0 0.0 0.0 100-104 0.0 0.0 0.0 0.0 0.0 105-109 0.0 0.0 0.0 0.0 0.0 110-114 0.0 0.0 0.0 0.0 0.0 115-119 0.0 0.0 0.0 0.0 0.0 120-124 0.0 0.0 0.0 0.0 0.0 125-129 0.0 0.0 0.0 0.0 0.0 130-134 0.0 0.0 0.0 0.0 0.0 135-139 0.0 0.0 0.0 0.0 0.0 140-144 0.0 0.0 0.0 0.0 0.0 145-149 0.0 0.0 0.0 0.0 0.0 150-154 0.0 0.0 0.0 0.0 0.0 155-159 0.0 0.0 0.0 0.0 0.0 160-164 0.0 0.0 0.0 0.0 0.0 165-169 0.0 0.0 0.0 0.0 0.0 170-174 0.0 0.0 0.0 0.0 0.0 175-179 0.0 0.0 0.0 0.0 0.0 180-184 0.0 0.0 0.0 0.0 0.0 185-189 0.0 0.0 0.0 0.0 0.0 190-194 0.0 0.0 0.0 0.0 0.0 195-199 0.0 0.0 0.0 0.0 0.0 200-204 0.0 0.0 0.0 0.0 0.0 205-209 0.0 0.0 0.0 0.0 0.0 210 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGCTGCT 5 0.0010925503 2235.6665 170-172 AAATTGA 10 0.008737796 838.37494 165-169 GTTCCCG 10 0.008737796 838.37494 165-169 GCTGCTG 20 0.0058275145 838.37494 170-172 CTGCTGG 15 0.009830996 745.2222 170-172 >>END_MODULE Read 311545 spots for ERR1806555.sra Written 311545 spots for ERR1806555.sra Read 311545 spots for ERR1806555.sra Written 311545 spots for ERR1806555.sra Read 311561 spots for ERR1806555.sra Written 311561 spots for ERR1806555.sra Read 311545 spots for ERR1806555.sra Written 311545 spots for ERR1806555.sra Read 311545 spots for ERR1806555.sra Written 311545 spots for ERR1806555.sra Read 311545 spots for ERR1806555.sra Written 311545 spots for ERR1806555.sra Read 311545 spots for ERR1806555.sra Written 311545 spots for ERR1806555.sra Read 311545 spots for ERR1806555.sra Written 311545 spots for ERR1806555.sra Read 311545 spots for ERR1806555.sra Written 311545 spots for ERR1806555.sra Read 311545 spots for ERR1806555.sra Written 311545 spots for ERR1806555.sra Read 311545 spots for ERR1806555.sra Written 311545 spots for ERR1806555.sra Read 311545 spots for ERR1806555.sra Written 311545 spots for ERR1806555.sra Read 311545 spots for ERR1806555.sra Written 311545 spots for ERR1806555.sra Read 311545 spots for ERR1806555.sra Written 311545 spots for ERR1806555.sra Read 311545 spots for ERR1806555.sra Written 311545 spots for ERR1806555.sra Read 311545 spots for ERR1806555.sra Written 311545 spots for ERR1806555.sra Read 311545 spots for ERR1806555.sra Written 311545 spots for ERR1806555.sra Read 311545 spots for ERR1806555.sra Written 311545 spots for ERR1806555.sra Read 311545 spots for ERR1806555.sra Written 311545 spots for ERR1806555.sra Read 311545 spots for ERR1806555.sra Written 311545 spots for ERR1806555.sra skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1806555 ERR1806555_1.fastq Input file: ERR1806555_1.fastq trimmed: ERR1806555-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 16:12:07 2024 >> started Mon Dec 9 16:12:13 2024 >> done (5.720s) 2133960 reads processed; of these: 70940 ( 3.32%) short reads filtered out after trimming by size control 3 ( 0.00%) empty reads filtered out after trimming by size control 2063017 (96.68%) reads available; of these: 34137 ( 1.65%) trimmed reads available after processing 2028880 (98.35%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6392 0.31% 19 6126 0.30% 20 5856 0.28% 21 6115 0.30% 22 5928 0.29% 23 5853 0.28% 24 6563 0.32% 25 6309 0.31% 26 6347 0.31% 27 6661 0.32% 28 6608 0.32% 29 6718 0.33% 30 7212 0.35% 31 7257 0.35% 32 7539 0.37% 33 7966 0.39% 34 8343 0.40% 35 8239 0.40% 36 8747 0.42% 37 8703 0.42% 38 8884 0.43% 39 10052 0.49% 40 9886 0.48% 41 10146 0.49% 42 11413 0.55% 43 11288 0.55% 44 11490 0.56% 45 12876 0.62% 46 12766 0.62% 47 12988 0.63% 48 14092 0.68% 49 14302 0.69% 50 14060 0.68% 51 15759 0.76% 52 15738 0.76% 53 15659 0.76% 54 16861 0.82% 55 16979 0.82% 56 17289 0.84% 57 18184 0.88% 58 17963 0.87% 59 19264 0.93% 60 20650 1.00% 61 21058 1.02% 62 20013 0.97% 63 22051 1.07% 64 21183 1.03% 65 21292 1.03% 66 21882 1.06% 67 21746 1.05% 68 22040 1.07% 69 22545 1.09% 70 22423 1.09% 71 22703 1.10% 72 23751 1.15% 73 22650 1.10% 74 23656 1.15% 75 23731 1.15% 76 23359 1.13% 77 24622 1.19% 78 25209 1.22% 79 23335 1.13% 80 23282 1.13% 81 23199 1.12% 82 25286 1.23% 83 25362 1.23% 84 24068 1.17% 85 23325 1.13% 86 22451 1.09% 87 22899 1.11% 88 22731 1.10% 89 22491 1.09% 90 22808 1.11% 91 21702 1.05% 92 21617 1.05% 93 23129 1.12% 94 21549 1.04% 95 21282 1.03% 96 21760 1.05% 97 20156 0.98% 98 20093 0.97% 99 20195 0.98% 100 20149 0.98% 101 20003 0.97% 102 19461 0.94% 103 19047 0.92% 104 18519 0.90% 105 18137 0.88% 106 17594 0.85% 107 17646 0.86% 108 17624 0.85% 109 17278 0.84% 110 16628 0.81% 111 16455 0.80% 112 16336 0.79% 113 15470 0.75% 114 15395 0.75% 115 14914 0.72% 116 14607 0.71% 117 14675 0.71% 118 13948 0.68% 119 13303 0.64% 120 13718 0.66% 121 13760 0.67% 122 12659 0.61% 123 12315 0.60% 124 11762 0.57% 125 11656 0.56% 126 11473 0.56% 127 11028 0.53% 128 10407 0.50% 129 10229 0.50% 130 10108 0.49% 131 9631 0.47% 132 9293 0.45% 133 9009 0.44% 134 8845 0.43% 135 8516 0.41% 136 8106 0.39% 137 7948 0.39% 138 7713 0.37% 139 7376 0.36% 140 7318 0.35% 141 7054 0.34% 142 6685 0.32% 143 6563 0.32% 144 6222 0.30% 145 6151 0.30% 146 5820 0.28% 147 5940 0.29% 148 5637 0.27% 149 5305 0.26% 150 5082 0.25% 151 5054 0.24% 152 4754 0.23% 153 4710 0.23% 154 4517 0.22% 155 4350 0.21% 156 4012 0.19% 157 3825 0.19% 158 3615 0.18% 159 3533 0.17% 160 3367 0.16% 161 3242 0.16% 162 3151 0.15% 163 2985 0.14% 164 2903 0.14% 165 2716 0.13% 166 2561 0.12% 167 2523 0.12% 168 2502 0.12% 169 2290 0.11% 170 2250 0.11% 171 2096 0.10% 172 2081 0.10% 173 1871 0.09% 174 1838 0.09% 175 1726 0.08% 176 1616 0.08% 177 1542 0.07% 178 1508 0.07% 179 1366 0.07% 180 1349 0.07% 181 1253 0.06% 182 1233 0.06% 183 1136 0.06% 184 1080 0.05% 185 994 0.05% 186 994 0.05% 187 901 0.04% 188 860 0.04% 189 763 0.04% 190 727 0.04% 191 710 0.03% 192 690 0.03% 193 627 0.03% 194 602 0.03% 195 621 0.03% 196 525 0.03% 197 488 0.02% 198 440 0.02% 199 420 0.02% 200 390 0.02% 201 352 0.02% 202 356 0.02% 203 316 0.02% 204 279 0.01% 205 269 0.01% 206 228 0.01% 207 229 0.01% 208 223 0.01% 209 197 0.01% 210 191 0.01% 211 161 0.01% 212 152 0.01% 213 156 0.01% 214 134 0.01% 215 125 0.01% 216 104 0.01% 217 100 0.00% 218 95 0.00% 219 98 0.00% 220 70 0.00% 221 68 0.00% 222 71 0.00% 223 54 0.00% 224 32 0.00% 225 57 0.00% 226 39 0.00% 227 37 0.00% 228 30 0.00% 229 22 0.00% 230 27 0.00% 231 28 0.00% 232 23 0.00% 233 25 0.00% 234 13 0.00% 235 10 0.00% 236 10 0.00% 237 18 0.00% 238 9 0.00% 239 12 0.00% 240 10 0.00% 241 7 0.00% 242 8 0.00% 243 4 0.00% 244 4 0.00% 245 2 0.00% 246 4 0.00% 247 2 0.00% 248 4 0.00% 249 2 0.00% 250 8 0.00% 251 1 0.00% 252 1 0.00% 253 0 0.00% 254 1 0.00% 255 0 0.00% 256 2 0.00% 257 0 0.00% 258 3 0.00% 259 0 0.00% 260 1 0.00% 261 0 0.00% 262 1 0.00% 263 0 0.00% 264 0 0.00% 265 0 0.00% 266 0 0.00% 267 0 0.00% 268 0 0.00% 269 0 0.00% 270 0 0.00% 271 1 0.00% 272 0 0.00% 273 0 0.00% 274 0 0.00% 275 0 0.00% 276 0 0.00% 277 0 0.00% 278 0 0.00% 279 0 0.00% 280 0 0.00% 281 0 0.00% 282 0 0.00% 283 0 0.00% 284 0 0.00% 285 1 0.00% 2063017 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=4.16 fanout-score-rank=23 prefix-density=0.24 prefix-fanout=3.3 sequence=AAGATCCAGGACAAGGAGGGCAT criterion=fanout-score sequence-density=0.06 sequence-density-rank=23 fanout-score=141.64 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=14.7 sequence=AGAAGAAGGACCCAACCGGCGCCAAGGTCACCAAGCGGCTGCCAAGA Started job on | Dec 09 16:14:19 Started mapping on | Dec 09 16:14:19 Finished on | Dec 09 16:14:51 Mapping speed, Million of reads per hour | 196.92 Number of input reads | 1750409 Average input read length | 88 UNIQUE READS: Uniquely mapped reads number | 1446001 Uniquely mapped reads % | 82.61% Average mapped length | 83.72 Number of splices: Total | 400333 Number of splices: Annotated (sjdb) | 377621 Number of splices: GT/AG | 392286 Number of splices: GC/AG | 4325 Number of splices: AT/AC | 346 Number of splices: Non-canonical | 3376 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.14% Deletion average length | 1.09 Insertion rate per base | 0.19% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 52803 % of reads mapped to multiple loci | 3.02% Number of reads mapped to too many loci | 16204 % of reads mapped to too many loci | 0.93% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.24% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 251605 251605 251605 N_multimapping 52803 52803 52803 N_noFeature 45332 57802 1414259 N_ambiguous 21992 2805 140 UnstrandedReadsAssigned:1378677 PositiveStrandReadsAssigned:1385394 NegativeStrandReadsAssigned:31602 Dataset is classified positive stranded MeadianReadLen=85 20thPercentileLength=58 echo kmer=53 ERR1806555 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR1806555-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 1,750,409 reads, 1,414,748 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 936 rounds 52973 ERR1806555.ke.tsv 35125 ERR1806555.se.tsv 88098 total ==> ERR1806555.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 22.2134 28.6907 PNS24247 1044 945 2.91667 3.33662 PNS24249 1928 1829 20.7828 12.2841 PNS24246 1044 945 2.91667 3.33662 PNS24248 1044 945 2.91667 3.33662 PNS24244 1471 1372 17.2538 13.5951 PNS24243 293 194 0 0 KQK14069 1603 1504 332.606 239.075 KQK14071 474 375 0 0 ==> ERR1806555.se.tsv <== BRADI_1g14170v3 333 BRADI_1g53295v3 13 BRADI_1g59795v3 25 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 179 BRADI_1g74790v3 18 BRADI_1g09890v3 0 BRADI_1g77505v3 23 BRADI_1g48960v3 0 ERR1806555 completed mapping pipeline successfully