Starting /dee2/code/volunteer_pipeline.sh ERR1806556 current disk space = 1523057852416 free memory = 1604835768 ERR1806556 SRAfilesize a405a1ec04f5e85b59661f4bd8cebb0d ERR1806556.sra ERR1806556.sra file validated ERR1806556 is single end ERR1806556 is conventional basespace ERR1806556 read1 length is 8-228 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1806556_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 8-228 %GC 52 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.9915 24.0 20.0 26.0 17.0 27.0 2 23.3535 25.0 20.0 27.0 16.0 28.0 3 23.061 24.0 20.0 27.0 16.0 28.0 4 23.186 24.0 20.0 27.0 16.0 28.0 5 23.04775 24.0 20.0 26.0 16.0 28.0 6 22.91975 24.0 20.0 26.0 16.0 28.0 7 22.883 24.0 20.0 26.0 16.0 28.0 8 22.7875 24.0 20.0 26.0 15.0 28.0 9 22.798346693386772 24.0 20.0 26.0 16.0 28.0 10-14 22.771369180216997 24.0 20.0 26.0 15.8 27.8 15-19 22.97987224062721 24.0 20.0 26.0 16.0 27.8 20-24 23.22945970168775 24.4 21.0 26.0 17.0 28.0 25-29 23.206065150221495 24.2 20.8 26.0 16.8 28.0 30-34 23.06868221497111 24.0 20.0 26.0 16.0 27.8 35-39 23.137061751028266 24.0 20.8 26.0 17.0 27.4 40-44 23.086395295340992 24.0 20.4 26.0 17.0 27.0 45-49 23.07352675358305 24.0 20.4 26.0 16.6 27.0 50-54 23.027026458206656 24.0 20.0 26.0 17.0 27.0 55-59 23.037072263745237 24.0 20.0 26.0 16.8 27.2 60-64 22.928470169463786 24.0 20.0 26.0 16.4 27.0 65-69 22.951004560327455 24.0 20.0 26.0 16.6 27.0 70-74 22.85974017330205 24.0 20.0 26.0 16.0 27.0 75-79 22.821525587987118 24.0 20.0 26.0 16.2 27.0 80-84 22.782756316555563 24.0 20.0 26.0 16.0 27.0 85-89 22.810692165990993 24.0 20.0 26.0 16.4 27.0 90-94 22.81087175100199 24.0 20.0 26.0 16.6 27.0 95-99 22.672269667858565 23.8 20.0 26.0 16.0 27.0 100-104 22.651383836954334 24.0 20.0 26.0 16.0 27.0 105-109 22.514112253210932 24.0 20.0 26.0 16.0 27.0 110-114 22.499222053701555 23.4 20.0 26.0 16.0 27.0 115-119 22.48445759269461 23.0 20.0 26.0 16.0 27.0 120-124 22.199377817070268 23.2 19.6 26.0 15.2 27.0 125-129 22.133073290331005 23.0 19.6 25.4 16.0 27.0 130-134 22.09705586988082 23.0 19.4 25.0 15.6 27.0 135-139 21.773357954442723 22.4 19.0 25.0 14.6 26.8 140-144 21.543354755118383 22.4 19.0 25.0 14.6 26.4 145-149 21.338552205810338 22.0 19.0 25.0 14.0 26.2 150-154 20.959784960604207 21.2 18.4 25.0 13.8 26.0 155-159 21.01508232654905 21.8 18.2 24.8 14.0 26.0 160-164 20.613415748316108 21.2 17.8 24.0 13.4 25.8 165-169 19.969816057402873 20.4 16.8 23.6 12.6 25.2 170-174 20.116878543179144 20.6 17.4 23.0 14.0 25.0 175-179 19.955708393039547 20.0 17.333333333333332 23.333333333333332 13.333333333333334 25.0 180-184 18.891908327013457 NaN NaN NaN NaN NaN 185-189 18.618726290049818 NaN NaN NaN NaN NaN 190-194 19.100200846890154 NaN NaN NaN NaN NaN 195-199 18.289576719576722 NaN NaN NaN NaN NaN 200-204 19.052704831400483 NaN NaN NaN NaN NaN 205-209 18.67883286304339 NaN NaN NaN NaN NaN 210-214 17.967539682539684 NaN NaN NaN NaN NaN 215-219 14.3 NaN NaN NaN NaN NaN 220-224 16.9 NaN NaN NaN NaN NaN 225-228 16.5 NaN NaN NaN NaN NaN >>END_MODULE >>Per sequence quality scores warn #Quality Count 11 6.0 12 0.0 13 6.0 14 12.0 15 24.0 16 51.0 17 87.0 18 140.0 19 234.0 20 296.0 21 396.0 22 582.0 23 768.0 24 774.0 25 540.0 26 79.0 27 4.0 28 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.45 44.0 16.925 14.625 2 42.975 33.425 6.0249999999999995 17.575 3 31.324999999999996 32.625 18.625 17.424999999999997 4 37.65 27.0 15.45 19.900000000000002 5 28.225 26.424999999999997 17.65 27.700000000000003 6 27.275 27.575 19.400000000000002 25.75 7 23.674999999999997 29.95 23.375 23.0 8 24.65 24.2 23.9 27.250000000000004 9 25.726452905811627 22.11923847695391 23.246492985971944 28.907815631262523 10-14 26.6448527561037 24.012081550465645 23.720110747545935 25.622954945884725 15-19 27.783998371335507 24.262011400651463 22.32288273615635 25.631107491856675 20-24 27.702528711953445 23.963537106659114 22.423649379409795 25.91028480197765 25-29 27.17804509712024 23.720252043951465 23.319273030255687 25.782429828672605 30-34 27.524533080088638 23.345995568217788 23.03471562730822 26.094755724385355 35-39 27.735859153422165 24.161181570075456 22.373842778402096 25.729116498100286 40-44 26.996466431095406 23.674911660777383 23.0823593367763 26.246262571350908 45-49 28.05121383438643 23.08502383327791 22.85777629974504 26.005986032590624 50-54 27.687278056479343 23.56687898089172 22.5410067076264 26.204836255002533 55-59 26.316397228637413 23.99538106235566 23.02540415704388 26.662817551963048 60-64 27.085924083614614 23.66909456978741 23.213122520281875 26.0318588263161 65-69 27.174707602339183 23.739035087719298 22.934941520467834 26.151315789473685 70-74 27.089264250015816 23.717340418801797 23.48326690706649 25.710128424115897 75-79 27.20311571720906 24.24582480691795 23.19625057759588 25.354808898277113 80-84 26.58008056674538 23.697735796638423 23.642172523961662 26.08001111265453 85-89 26.64041019543732 23.66054841346511 24.06182655866835 25.637214832429216 90-94 26.875502008032125 24.29718875502008 23.333333333333332 25.49397590361446 95-99 26.548129981606376 23.736533239905405 23.806604186739072 25.908732591749146 100-104 27.087517934002868 23.940698230511718 23.825920612147296 25.145863223338118 105-109 27.027027027027028 23.93062353692275 23.88806128963609 25.15428814641413 110-114 25.463683139882733 24.219217422520043 24.11152327390212 26.205576163695106 115-119 26.083992364330516 24.352331606217618 24.638669211889827 24.92500681756204 120-124 25.63326429823164 24.0879400987733 24.119802453401306 26.158993149593755 125-129 26.44131455399061 24.112676056338028 23.173708920187792 26.272300469483568 130-134 26.491962122880423 24.22373926447919 23.9815018718344 25.302796740805988 135-139 27.001321003963014 23.32892998678996 25.204755614266844 24.464993394980187 140-144 25.426509186351705 25.492125984251967 24.93438320209974 24.146981627296586 145-149 26.400000000000002 24.54736842105263 23.53684210526316 25.515789473684208 150-154 27.006911217437533 22.647527910685806 25.890483785220624 24.455077086656036 155-159 27.030716723549485 22.252559726962456 25.73378839590444 24.982935153583618 160-164 25.820763087843833 24.489795918367346 24.489795918367346 25.199645075421472 165-169 27.324913892078072 25.83237657864523 24.339839265212397 22.502870264064295 170-174 25.796661608497722 25.644916540212442 23.21699544764795 25.341426403641883 175-179 26.22309197651663 23.09197651663405 28.37573385518591 22.309197651663403 180-184 26.82926829268293 21.951219512195124 23.848238482384822 27.371273712737125 185-189 25.847457627118644 24.152542372881356 23.728813559322035 26.27118644067797 190-194 20.114942528735632 29.310344827586203 25.862068965517242 24.71264367816092 195-199 24.113475177304963 24.822695035460992 25.53191489361702 25.53191489361702 200-204 28.57142857142857 28.57142857142857 23.214285714285715 19.642857142857142 205-209 19.480519480519483 28.57142857142857 23.376623376623375 28.57142857142857 210-214 25.71428571428571 25.71428571428571 22.857142857142858 25.71428571428571 215-219 8.333333333333332 33.33333333333333 25.0 33.33333333333333 220-224 25.0 37.5 12.5 25.0 225-228 25.0 25.0 0.0 50.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 1.0 2 1.0 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 1.0 12 1.0 13 1.0 14 1.5 15 3.5 16 5.0 17 5.5 18 5.5 19 5.5 20 6.0 21 5.5 22 6.5 23 7.5 24 7.0 25 8.5 26 9.0 27 9.0 28 10.5 29 12.5 30 16.5 31 17.5 32 16.5 33 19.5 34 22.0 35 24.0 36 30.5 37 40.0 38 56.83333333333333 39 79.16666666666667 40 95.83333333333334 41 102.16666666666666 42 116.33333333333331 43 154.50000000000003 44 188.0 45 205.83333333333334 46 210.83333333333334 47 205.5 48 196.16666666666666 49 206.16666666666666 50 226.0 51 218.16666666666666 52 213.0 53 219.66666666666666 54 218.50000000000003 55 199.50000000000003 56 182.83333333333334 57 179.33333333333331 58 179.33333333333331 59 170.5 60 158.0 61 168.5 62 158.5 63 127.66666666666667 64 121.33333333333333 65 123.5 66 122.5 67 116.5 68 96.0 69 78.0 70 65.0 71 58.0 72 46.5 73 30.5 74 25.0 75 18.5 76 12.5 77 9.5 78 8.0 79 6.0 80 4.0 81 3.0 82 1.0 83 1.5 84 3.0 85 3.0 86 2.5 87 2.0 88 1.5 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-159 0.0 160-164 0.0 165-169 0.0 170-174 0.0 175-179 0.0 180-184 0.0 185-189 0.0 190-194 0.0 195-199 0.0 200-204 0.0 205-209 0.0 210-214 0.0 215-219 0.0 220-224 0.0 225-228 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 5-9 12.0 10-14 39.0 15-19 50.0 20-24 37.0 25-29 52.0 30-34 50.0 35-39 56.0 40-44 68.0 45-49 62.0 50-54 72.0 55-59 86.0 60-64 96.0 65-69 102.0 70-74 138.0 75-79 135.0 80-84 174.0 85-89 194.0 90-94 215.0 95-99 188.0 100-104 218.0 105-109 199.0 110-114 210.0 115-119 206.0 120-124 206.0 125-129 161.0 130-134 157.0 135-139 154.0 140-144 136.0 145-149 123.0 150-154 74.0 155-159 83.0 160-164 51.0 165-169 50.0 170-174 32.0 175-179 27.0 180-184 33.0 185-189 16.0 190-194 8.0 195-199 4.0 200-204 7.0 205-209 10.0 210-214 5.0 215-219 2.0 220-224 1.0 225-229 1.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0379746835443 97.8 2 0.7848101265822786 1.55 3 0.1518987341772152 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025316455696202535 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACTCCAAGATCATCAACGACAGGGAGACTGGCCGTTCCCGCGGGTTCGGC 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.0 0.0 0.0 0.0 0.0 80-84 0.0 0.0 0.0 0.0 0.0 85-89 0.0 0.0 0.0 0.0 0.0 90-94 0.0 0.0 0.0 0.0 0.0 95-99 0.0 0.0 0.0 0.0 0.0 100-104 0.0 0.0 0.0 0.0 0.0 105-109 0.0 0.0 0.0 0.0 0.0 110-114 0.0 0.0 0.0 0.0 0.0 115-119 0.0 0.0 0.0 0.0 0.0 120-124 0.0 0.0 0.0 0.0 0.0 125-129 0.0 0.0 0.0 0.0 0.0 130-134 0.0 0.0 0.0 0.0 0.0 135-139 0.0 0.0 0.0 0.0 0.0 140-144 0.0 0.0 0.0 0.0 0.0 145-149 0.0 0.0 0.0 0.0 0.0 150-154 0.0 0.0 0.0 0.0 0.0 155-159 0.0 0.0 0.0 0.0 0.0 160-164 0.0 0.0 0.0 0.0 0.0 165-169 0.0 0.0 0.0 0.0 0.0 170-174 0.0 0.0 0.0 0.0 0.0 175-179 0.0 0.0 0.0 0.0 0.0 180-184 0.0 0.0 0.0 0.0 0.0 185-189 0.0 0.0 0.0 0.0 0.0 190-194 0.0 0.0 0.0 0.0 0.0 195-199 0.0 0.0 0.0 0.0 0.0 200-204 0.0 0.0 0.0 0.0 0.0 205-209 0.0 0.0 0.0 0.0 0.0 210-214 0.0 0.0 0.0 0.0 0.0 215-216 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTCCA 5 2.8757832E-4 3774.0 185-186 GGTTTCC 10 0.0011503133 1887.0 185-186 GGTTTGG 5 0.0028750212 1509.6001 180-184 TTGGTTT 5 0.0028750212 1509.6001 180-184 GGGTTTG 5 0.008047927 943.5 175-179 CTGGGTT 5 0.008047927 943.5 175-179 GACGCCA 10 0.0068994416 943.5 155-159 TGGGTTT 5 0.008047927 943.5 175-179 CCTGGGT 5 0.008047927 943.5 175-179 AAGTGAG 10 0.0042891614 167.73334 145-149 >>END_MODULE Read 309344 spots for ERR1806556.sra Written 309344 spots for ERR1806556.sra Read 309344 spots for ERR1806556.sra Written 309344 spots for ERR1806556.sra Read 309344 spots for ERR1806556.sra Written 309344 spots for ERR1806556.sra Read 309344 spots for ERR1806556.sra Written 309344 spots for ERR1806556.sra Read 309344 spots for ERR1806556.sra Written 309344 spots for ERR1806556.sra Read 309344 spots for ERR1806556.sra Written 309344 spots for ERR1806556.sra Read 309344 spots for ERR1806556.sra Written 309344 spots for ERR1806556.sra Read 309344 spots for ERR1806556.sra Written 309344 spots for ERR1806556.sra Read 309344 spots for ERR1806556.sra Written 309344 spots for ERR1806556.sra Read 309344 spots for ERR1806556.sra Written 309344 spots for ERR1806556.sra Read 309344 spots for ERR1806556.sra Written 309344 spots for ERR1806556.sra Read 309344 spots for ERR1806556.sra Written 309344 spots for ERR1806556.sra Read 309347 spots for ERR1806556.sra Written 309347 spots for ERR1806556.sra Read 309344 spots for ERR1806556.sra Written 309344 spots for ERR1806556.sra Read 309344 spots for ERR1806556.sra Written 309344 spots for ERR1806556.sra Read 309344 spots for ERR1806556.sra Written 309344 spots for ERR1806556.sra Read 309344 spots for ERR1806556.sra Written 309344 spots for ERR1806556.sra Read 309344 spots for ERR1806556.sra Written 309344 spots for ERR1806556.sra Read 309344 spots for ERR1806556.sra Written 309344 spots for ERR1806556.sra Read 309344 spots for ERR1806556.sra Written 309344 spots for ERR1806556.sra SRR ids: ['ERR1806556.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f_pwaj9i ERR1806556.sra spots: 6186883 blocks: [[1, 309344], [309345, 618688], [618689, 928032], [928033, 1237376], [1237377, 1546720], [1546721, 1856064], [1856065, 2165408], [2165409, 2474752], [2474753, 2784096], [2784097, 3093440], [3093441, 3402784], [3402785, 3712128], [3712129, 4021472], [4021473, 4330816], [4330817, 4640160], [4640161, 4949504], [4949505, 5258848], [5258849, 5568192], [5568193, 5877536], [5877537, 6186883]] ERR1806556 file size 1478639 ERR1806556 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1806556 ERR1806556_1.fastq Input file: ERR1806556_1.fastq trimmed: ERR1806556-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 16:19:13 2024 >> started Mon Dec 9 16:19:53 2024 >> done (40.281s) 6186883 reads processed; of these: 150705 ( 2.44%) short reads filtered out after trimming by size control 7 ( 0.00%) empty reads filtered out after trimming by size control 6036171 (97.56%) reads available; of these: 131050 ( 2.17%) trimmed reads available after processing 5905121 (97.83%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 14804 0.25% 19 14490 0.24% 20 13869 0.23% 21 14177 0.23% 22 13685 0.23% 23 13729 0.23% 24 14735 0.24% 25 13753 0.23% 26 13703 0.23% 27 13986 0.23% 28 14341 0.24% 29 14282 0.24% 30 14535 0.24% 31 14587 0.24% 32 14722 0.24% 33 15311 0.25% 34 15357 0.25% 35 15216 0.25% 36 16323 0.27% 37 15669 0.26% 38 16312 0.27% 39 16948 0.28% 40 16569 0.27% 41 16925 0.28% 42 19019 0.32% 43 17975 0.30% 44 18359 0.30% 45 19662 0.33% 46 19626 0.33% 47 19650 0.33% 48 21119 0.35% 49 21304 0.35% 50 21716 0.36% 51 23002 0.38% 52 23070 0.38% 53 23703 0.39% 54 25037 0.41% 55 25419 0.42% 56 25822 0.43% 57 27275 0.45% 58 27821 0.46% 59 28785 0.48% 60 30831 0.51% 61 31411 0.52% 62 31553 0.52% 63 33605 0.56% 64 33945 0.56% 65 34451 0.57% 66 35570 0.59% 67 36687 0.61% 68 37411 0.62% 69 39365 0.65% 70 39638 0.66% 71 40650 0.67% 72 43267 0.72% 73 42133 0.70% 74 44561 0.74% 75 45735 0.76% 76 47218 0.78% 77 52606 0.87% 78 55287 0.92% 79 50215 0.83% 80 50202 0.83% 81 52539 0.87% 82 54940 0.91% 83 54373 0.90% 84 55726 0.92% 85 55588 0.92% 86 55804 0.92% 87 58053 0.96% 88 57908 0.96% 89 58848 0.97% 90 63594 1.05% 91 60758 1.01% 92 61042 1.01% 93 65189 1.08% 94 63191 1.05% 95 62937 1.04% 96 64410 1.07% 97 62498 1.04% 98 62964 1.04% 99 65113 1.08% 100 65598 1.09% 101 66102 1.10% 102 65252 1.08% 103 65891 1.09% 104 65479 1.08% 105 65449 1.08% 106 63113 1.05% 107 64061 1.06% 108 64699 1.07% 109 64720 1.07% 110 63775 1.06% 111 66481 1.10% 112 64364 1.07% 113 62033 1.03% 114 62294 1.03% 115 61268 1.02% 116 60340 1.00% 117 60509 1.00% 118 58948 0.98% 119 58898 0.98% 120 58915 0.98% 121 57803 0.96% 122 55795 0.92% 123 55246 0.92% 124 54049 0.90% 125 53497 0.89% 126 54047 0.90% 127 51697 0.86% 128 49649 0.82% 129 50407 0.84% 130 49495 0.82% 131 47419 0.79% 132 47026 0.78% 133 45450 0.75% 134 45346 0.75% 135 44242 0.73% 136 42086 0.70% 137 41191 0.68% 138 41938 0.69% 139 40369 0.67% 140 39260 0.65% 141 37717 0.62% 142 36504 0.60% 143 35695 0.59% 144 35030 0.58% 145 34161 0.57% 146 32894 0.54% 147 32455 0.54% 148 31030 0.51% 149 29423 0.49% 150 29510 0.49% 151 28547 0.47% 152 27433 0.45% 153 26597 0.44% 154 25603 0.42% 155 25651 0.42% 156 23985 0.40% 157 23020 0.38% 158 21618 0.36% 159 21253 0.35% 160 20323 0.34% 161 19467 0.32% 162 19470 0.32% 163 18372 0.30% 164 17482 0.29% 165 17067 0.28% 166 16110 0.27% 167 15531 0.26% 168 15187 0.25% 169 14215 0.24% 170 13655 0.23% 171 13109 0.22% 172 12616 0.21% 173 12116 0.20% 174 11426 0.19% 175 10743 0.18% 176 10491 0.17% 177 10012 0.17% 178 9337 0.15% 179 9107 0.15% 180 8666 0.14% 181 8105 0.13% 182 7857 0.13% 183 7328 0.12% 184 6823 0.11% 185 6457 0.11% 186 6265 0.10% 187 5819 0.10% 188 5627 0.09% 189 5291 0.09% 190 5001 0.08% 191 4509 0.07% 192 4369 0.07% 193 4108 0.07% 194 3720 0.06% 195 3687 0.06% 196 3540 0.06% 197 3245 0.05% 198 2967 0.05% 199 2877 0.05% 200 2672 0.04% 201 2494 0.04% 202 2293 0.04% 203 2207 0.04% 204 2008 0.03% 205 1851 0.03% 206 1708 0.03% 207 1595 0.03% 208 1479 0.02% 209 1391 0.02% 210 1233 0.02% 211 1163 0.02% 212 1028 0.02% 213 946 0.02% 214 903 0.01% 215 828 0.01% 216 752 0.01% 217 701 0.01% 218 605 0.01% 219 553 0.01% 220 525 0.01% 221 484 0.01% 222 416 0.01% 223 370 0.01% 224 326 0.01% 225 310 0.01% 226 286 0.00% 227 263 0.00% 228 265 0.00% 229 215 0.00% 230 197 0.00% 231 165 0.00% 232 132 0.00% 233 155 0.00% 234 138 0.00% 235 106 0.00% 236 97 0.00% 237 87 0.00% 238 81 0.00% 239 74 0.00% 240 48 0.00% 241 44 0.00% 242 37 0.00% 243 33 0.00% 244 32 0.00% 245 34 0.00% 246 26 0.00% 247 23 0.00% 248 22 0.00% 249 18 0.00% 250 19 0.00% 251 10 0.00% 252 8 0.00% 253 8 0.00% 254 10 0.00% 255 8 0.00% 256 6 0.00% 257 7 0.00% 258 5 0.00% 259 7 0.00% 260 2 0.00% 261 5 0.00% 262 2 0.00% 263 5 0.00% 264 2 0.00% 265 1 0.00% 266 1 0.00% 267 0 0.00% 268 3 0.00% 269 0 0.00% 270 0 0.00% 271 0 0.00% 272 2 0.00% 273 0 0.00% 274 1 0.00% 275 0 0.00% 276 1 0.00% 277 2 0.00% 278 0 0.00% 279 0 0.00% 280 0 0.00% 281 0 0.00% 282 1 0.00% 283 0 0.00% 284 0 0.00% 285 0 0.00% 286 1 0.00% 287 2 0.00% 288 0 0.00% 289 0 0.00% 290 0 0.00% 291 0 0.00% 292 0 0.00% 293 0 0.00% 294 0 0.00% 295 0 0.00% 296 0 0.00% 297 0 0.00% 298 0 0.00% 299 0 0.00% 300 1 0.00% 6036171 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=35 prefix-density=0.28 prefix-fanout=2.6 sequence=CCGGACCAGCAGCG criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=122.89 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=12.2 sequence=GACAAGAAGAAAGCCTCTGTCTTCTTCAAGACTTCTGCTGATGGACACATCTCATGTGCTAAGGAGATGACAAAGGTCTCTGGTATCTCTGAAATCATCCCGGAGATGGAGGTCTGTGACTTCGACTTTGAGCCCTGCGGCTACTCCATGAACGCCATCCATGGATCTGCGTTCTCTACAATCCATGTGACCCCTGA Started job on | Dec 09 16:20:26 Started mapping on | Dec 09 16:20:26 Finished on | Dec 09 16:20:43 Mapping speed, Million of reads per hour | 1278.25 Number of input reads | 6036171 Average input read length | 103 UNIQUE READS: Uniquely mapped reads number | 4511721 Uniquely mapped reads % | 74.74% Average mapped length | 95.17 Number of splices: Total | 1421878 Number of splices: Annotated (sjdb) | 1329793 Number of splices: GT/AG | 1388060 Number of splices: GC/AG | 15788 Number of splices: AT/AC | 1261 Number of splices: Non-canonical | 16769 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.18% Deletion average length | 1.11 Insertion rate per base | 0.19% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 159774 % of reads mapped to multiple loci | 2.65% Number of reads mapped to too many loci | 105356 % of reads mapped to too many loci | 1.75% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 20.28% % of reads unmapped: other | 0.58% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1364676 1364676 1364676 N_multimapping 159774 159774 159774 N_noFeature 118424 157656 4415986 N_ambiguous 66481 10226 423 UnstrandedReadsAssigned:4326816 PositiveStrandReadsAssigned:4343839 NegativeStrandReadsAssigned:95312 Dataset is classified positive stranded MeadianReadLen=103 20thPercentileLength=71 echo kmer=67 ERR1806556 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR1806556-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,036,171 reads, 4,678,572 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 999 rounds 52973 ERR1806556.ke.tsv 35125 ERR1806556.se.tsv 88098 total ==> ERR1806556.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 152.227 57.1979 PNS24247 1044 945 0 0 PNS24249 1928 1829 73.1114 12.5715 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 31.6621 7.25773 PNS24243 293 194 0 0 KQK14069 1603 1504 878.744 183.751 KQK14071 474 375 168.132 141.005 ==> ERR1806556.se.tsv <== BRADI_1g14170v3 1050 BRADI_1g53295v3 21 BRADI_1g59795v3 42 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 498 BRADI_1g74790v3 109 BRADI_1g09890v3 0 BRADI_1g77505v3 116 BRADI_1g48960v3 0 ERR1806556 completed mapping pipeline successfully