Starting /dee2/code/volunteer_pipeline.sh ERR1806557 current disk space = 1523055939584 free memory = 1604832960 ERR1806557 SRAfilesize 8e052d2a4886c13d8f67a305802d653a ERR1806557.sra ERR1806557.sra file validated ERR1806557 is single end ERR1806557 is conventional basespace ERR1806557 read1 length is 8-223 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1806557_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 8-223 %GC 50 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.81025 25.0 21.0 27.0 19.0 28.0 2 23.76925 25.0 21.0 27.0 17.0 29.0 3 23.58975 25.0 21.0 27.0 16.0 29.0 4 23.7225 25.0 21.0 27.0 17.0 29.0 5 23.6035 25.0 21.0 27.0 17.0 28.0 6 23.4845 25.0 21.0 27.0 17.0 28.0 7 23.3735 25.0 21.0 27.0 16.0 28.0 8 23.3065 25.0 21.0 27.0 16.0 28.0 9 23.356678339169584 25.0 21.0 27.0 16.0 28.0 10-14 23.30285516558527 25.0 20.6 27.0 16.4 28.0 15-19 23.58625404593934 25.0 21.0 27.0 17.0 28.0 20-24 23.669096389349676 25.0 21.0 27.0 17.4 28.0 25-29 23.69427336073681 25.0 21.0 27.0 18.0 28.0 30-34 23.624709020455363 25.0 21.0 27.0 17.6 28.0 35-39 23.638765870536464 25.0 21.0 27.0 17.8 28.0 40-44 23.61727794133432 25.0 21.0 27.0 17.8 28.0 45-49 23.55196392977552 25.0 21.0 26.8 17.4 28.0 50-54 23.507128818418085 25.0 21.0 26.4 17.0 28.0 55-59 23.48867044571698 25.0 21.0 26.0 17.2 28.0 60-64 23.434452665472413 25.0 21.0 26.2 17.0 27.4 65-69 23.433222511997833 25.0 21.0 26.2 17.0 28.0 70-74 23.436688829486144 25.0 21.0 26.0 17.4 27.8 75-79 23.37148951362316 25.0 21.0 26.0 17.0 27.8 80-84 23.267563854502786 24.8 20.4 26.0 17.4 27.0 85-89 23.14281339658254 24.2 20.4 26.0 17.0 27.0 90-94 22.930287107988505 24.0 20.0 26.0 16.4 27.0 95-99 22.858379201737897 24.0 20.0 26.0 16.6 27.0 100-104 22.662861238921842 24.0 20.0 26.0 16.4 27.0 105-109 22.78256483783929 24.0 20.0 26.0 17.0 27.0 110-114 22.616922300740846 23.8 20.0 26.0 16.4 27.0 115-119 22.305785329526078 23.4 19.8 26.0 15.8 27.0 120-124 22.198129389606386 23.2 20.0 26.0 14.4 27.0 125-129 21.94731065734441 22.6 19.0 25.0 15.8 26.6 130-134 21.66209645561849 22.4 19.2 25.0 14.2 26.6 135-139 21.69325703211329 22.6 18.8 25.0 15.2 26.4 140-144 21.179207328758142 22.0 17.8 25.2 14.0 26.4 145-149 21.209994118196757 22.2 18.2 24.8 14.4 26.2 150-154 21.469850069232084 22.0 18.5 25.0 14.5 26.0 155-159 21.133997279693077 NaN NaN NaN NaN NaN 160-164 20.608648187438465 NaN NaN NaN NaN NaN 165-169 20.072056712908143 NaN NaN NaN NaN NaN 170-174 19.926760655151973 NaN NaN NaN NaN NaN 175-179 19.864483404207544 NaN NaN NaN NaN NaN 180-184 19.77229336846728 NaN NaN NaN NaN NaN 185-189 19.040441176470587 NaN NaN NaN NaN NaN 190-194 17.86 NaN NaN NaN NaN NaN 195-199 17.72 NaN NaN NaN NaN NaN 200-204 17.8 NaN NaN NaN NaN NaN 205-209 20.0 NaN NaN NaN NaN NaN 210-214 19.6 NaN NaN NaN NaN NaN 215-219 21.2 NaN NaN NaN NaN NaN 220-223 20.25 NaN NaN NaN NaN NaN >>END_MODULE >>Per sequence quality scores warn #Quality Count 10 1.0 11 3.0 12 5.0 13 13.0 14 13.0 15 20.0 16 43.0 17 82.0 18 115.0 19 154.0 20 206.0 21 302.0 22 385.0 23 602.0 24 980.0 25 869.0 26 200.0 27 7.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.1 44.75 18.475 13.675 2 41.725 35.3 6.775 16.2 3 31.95 30.599999999999998 20.625 16.825000000000003 4 37.375 27.650000000000002 17.5 17.474999999999998 5 29.675 25.45 18.175 26.700000000000003 6 26.400000000000002 29.375 20.7 23.525 7 23.025000000000002 31.874999999999996 24.425 20.674999999999997 8 25.575 27.175 24.425 22.825 9 26.43821910955478 24.187093546773387 24.562281140570285 24.81240620310155 10-14 26.206549118387912 25.3904282115869 24.816120906801007 23.58690176322418 15-19 27.371107708014293 25.57427258805513 23.149566105155692 23.905053598774888 20-24 27.143521629024757 24.874670525608558 23.592950540079592 24.388857305287097 25-29 26.099706744868033 25.434645999162125 24.293045664013405 24.17260159195643 30-34 26.828878713662018 24.917474177403896 23.88989457991694 24.363752529017145 35-39 26.868588177821202 25.120772946859905 23.476089670520544 24.53454920479835 40-44 26.430639055889554 25.128033845468718 24.60476508572701 23.83656201291472 45-49 26.71821801604247 24.577298170696523 24.6465462519476 24.057937561313405 50-54 26.02172477945148 25.001500330072616 24.22132869231231 24.755446198163597 55-59 25.51951343132286 25.164723770907248 24.54384186517993 24.771920932589964 60-64 26.133732806754733 25.51409505651641 25.071496663489036 23.28067547323982 65-69 26.419311578006262 25.108031589926988 24.616301594397257 23.856355237669497 70-74 25.814223994682617 24.77567298105683 25.689597873047525 23.72050515121303 75-79 25.652337150366062 25.28627745447719 24.91083161253989 24.150553782616857 80-84 24.951602495160248 24.973112497311252 26.27446762744676 23.80081738008174 85-89 25.14064258032254 25.103137892236532 25.87823477934742 23.87798474809351 90-94 24.555523171087145 26.5083066161469 25.28417371028854 23.651996502477413 95-99 25.021918288620025 25.284937752060323 25.898649833421004 23.794494125898648 100-104 25.412960609911057 24.81999152901313 25.90004235493435 23.867005506141464 105-109 25.334342669694678 24.022205399949534 27.681049709815795 22.962402220539996 110-114 25.20074119827054 25.169857936998145 26.714021000617667 22.91537986411365 115-119 25.294788893115257 26.85431723088627 25.370863446177257 22.480030429821223 120-124 25.807984790874528 27.376425855513308 25.570342205323193 21.245247148288975 125-129 24.651972157772622 25.116009280742457 27.494199535962878 22.73781902552204 130-134 24.50532724505327 26.027397260273972 25.34246575342466 24.124809741248097 135-139 24.897119341563787 26.64609053497942 25.411522633744855 23.045267489711936 140-144 26.509186351706038 26.64041994750656 25.72178477690289 21.128608923884514 145-149 27.30210016155089 25.525040387722132 24.878836833602584 22.294022617124394 150-154 24.95201535508637 27.2552783109405 22.84069097888676 24.95201535508637 155-159 27.386934673366838 24.623115577889447 20.85427135678392 27.1356783919598 160-164 23.762376237623762 26.732673267326735 24.422442244224424 25.082508250825082 165-169 26.778242677824267 24.686192468619247 26.778242677824267 21.75732217573222 170-174 25.139664804469277 22.905027932960895 25.69832402234637 26.256983240223462 175-179 27.40740740740741 20.0 26.666666666666668 25.925925925925924 180-184 23.893805309734514 18.58407079646018 27.43362831858407 30.08849557522124 185-189 26.5625 21.875 25.0 26.5625 190-194 25.0 28.57142857142857 14.285714285714285 32.142857142857146 195-199 30.434782608695656 4.3478260869565215 30.434782608695656 34.78260869565217 200-204 25.0 25.0 8.333333333333332 41.66666666666667 205-209 40.0 0.0 10.0 50.0 210-214 20.0 10.0 40.0 30.0 215-219 22.22222222222222 22.22222222222222 22.22222222222222 33.33333333333333 220-223 50.0 0.0 25.0 25.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.5 10 2.0 11 2.0 12 2.0 13 2.0 14 2.0 15 2.5 16 3.0 17 3.5 18 3.5 19 3.0 20 4.0 21 4.0 22 3.5 23 4.0 24 4.5 25 5.5 26 6.0 27 8.0 28 12.0 29 16.0 30 23.0 31 27.0 32 30.0 33 40.0 34 54.0 35 70.5 36 82.0 37 91.5 38 103.5 39 129.0 40 160.5 41 183.5 42 200.5 43 225.0 44 237.5 45 244.0 46 268.5 47 272.83333333333337 48 260.0 49 252.33333333333331 50 238.83333333333331 51 221.83333333333331 52 225.5 53 222.5 54 200.5 55 188.0 56 182.5 57 180.0 58 156.5 59 138.5 60 144.5 61 155.0 62 161.0 63 138.0 64 108.5 65 96.0 66 91.5 67 79.5 68 71.0 69 74.0 70 73.0 71 63.5 72 48.5 73 39.0 74 32.5 75 24.5 76 19.0 77 16.0 78 15.0 79 12.5 80 6.5 81 3.0 82 3.5 83 4.0 84 4.5 85 4.0 86 2.5 87 1.5 88 0.5 89 0.5 90 1.0 91 1.0 92 1.0 93 1.0 94 1.0 95 1.0 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-159 0.0 160-164 0.0 165-169 0.0 170-174 0.0 175-179 0.0 180-184 0.0 185-189 0.0 190-194 0.0 195-199 0.0 200-204 0.0 205-209 0.0 210-214 0.0 215-219 0.0 220-223 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 5-9 5.0 10-14 61.0 15-19 43.0 20-24 52.0 25-29 56.0 30-34 70.0 35-39 79.0 40-44 115.0 45-49 122.0 50-54 169.0 55-59 192.0 60-64 243.0 65-69 279.0 70-74 269.0 75-79 288.0 80-84 260.0 85-89 231.0 90-94 233.0 95-99 220.0 100-104 160.0 105-109 146.0 110-114 135.0 115-119 114.0 120-124 79.0 125-129 85.0 130-134 74.0 135-139 56.0 140-144 29.0 145-149 24.0 150-154 18.0 155-159 27.0 160-164 13.0 165-169 12.0 170-174 12.0 175-179 4.0 180-184 8.0 185-189 11.0 190-194 1.0 195-199 2.0 200-204 1.0 205-209 0.0 210-214 0.0 215-219 1.0 220-224 1.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.36740890688259 98.175 2 0.4807692307692308 0.95 3 0.05060728744939271 0.15 4 0.05060728744939271 0.2 5 0.025303643724696356 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025303643724696356 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACTCCAAGATCATCAACGACAGGGAGACTGGCCGTTCCCGCGGGTTCGGC 16 0.4 No Hit ATGGGGGCCGGCGATGCGTCCTGGCCGTATGCGGAACGGCTTTTGCTGGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.0 0.0 0.0 0.0 0.0 80-84 0.0 0.0 0.0 0.0 0.0 85-89 0.0 0.0 0.0 0.0 0.0 90-94 0.0 0.0 0.0 0.0 0.0 95-99 0.0 0.0 0.0 0.0 0.0 100-104 0.0 0.0 0.0 0.0 0.0 105-109 0.0 0.0 0.0 0.0 0.0 110-114 0.0 0.0 0.0 0.0 0.0 115-119 0.0 0.0 0.0 0.0 0.0 120-124 0.0 0.0 0.0 0.0 0.0 125-129 0.0 0.0 0.0 0.0 0.0 130-134 0.0 0.0 0.0 0.0 0.0 135-139 0.0 0.0 0.0 0.0 0.0 140-144 0.0 0.0 0.0 0.0 0.0 145-149 0.0 0.0 0.0 0.0 0.0 150-154 0.0 0.0 0.0 0.0 0.0 155-159 0.0 0.0 0.0 0.0 0.0 160-164 0.0 0.0 0.0 0.0 0.0 165-169 0.0 0.0 0.0 0.0 0.0 170-174 0.0 0.0 0.0 0.0 0.0 175-179 0.0 0.0 0.0 0.0 0.0 180-184 0.0 0.0 0.0 0.0 0.0 185-189 0.0 0.0 0.0 0.0 0.0 190-194 0.0 0.0 0.0 0.0 0.0 195-199 0.0 0.0 0.0 0.0 0.0 200-204 0.0 0.0 0.0 0.0 0.0 205-209 0.0 0.0 0.0 0.0 0.0 210-211 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAGACG 5 0.0 6379.0 180 GGCATGG 10 0.0 3189.5 160-164 AGTACAT 10 0.0016105518 1594.75 150-154 ATGCCAA 10 0.0016105518 1594.75 155-159 TGCACGG 5 0.004025117 1275.8 170-174 TTGCACG 5 0.004025117 1275.8 170-174 GGCGTTG 5 0.004025117 1275.8 165-169 GCTGGCG 5 0.004025117 1275.8 165-169 GGCTGGC 5 0.004025117 1275.8 165-169 CTGGCGT 5 0.004025117 1275.8 165-169 GCACGGG 5 0.004025117 1275.8 175-179 CGGGAGA 5 0.004025117 1275.8 175-179 GCATGGC 5 0.004025117 1275.8 160-164 ACGGGAG 5 0.004025117 1275.8 175-179 GCGTTGC 5 0.004025117 1275.8 170-174 TGGCGTT 5 0.004025117 1275.8 165-169 CGTTGCA 5 0.004025117 1275.8 170-174 TGGCTGG 5 0.004025117 1275.8 160-164 CACGGGA 5 0.004025117 1275.8 175-179 TCTAGGA 10 0.0048306454 1063.1667 140-144 >>END_MODULE Read 333939 spots for ERR1806557.sra Written 333939 spots for ERR1806557.sra Read 333958 spots for ERR1806557.sra Written 333958 spots for ERR1806557.sra Read 333939 spots for ERR1806557.sra Written 333939 spots for ERR1806557.sra Read 333939 spots for ERR1806557.sra Written 333939 spots for ERR1806557.sra Read 333939 spots for ERR1806557.sra Written 333939 spots for ERR1806557.sra Read 333939 spots for ERR1806557.sra Written 333939 spots for ERR1806557.sra Read 333939 spots for ERR1806557.sra Written 333939 spots for ERR1806557.sra Read 333939 spots for ERR1806557.sra Written 333939 spots for ERR1806557.sra Read 333939 spots for ERR1806557.sra Written 333939 spots for ERR1806557.sra Read 333939 spots for ERR1806557.sra Written 333939 spots for ERR1806557.sra Read 333939 spots for ERR1806557.sra Written 333939 spots for ERR1806557.sra Read 333939 spots for ERR1806557.sra Written 333939 spots for ERR1806557.sra Read 333939 spots for ERR1806557.sra Written 333939 spots for ERR1806557.sra Read 333939 spots for ERR1806557.sra Written 333939 spots for ERR1806557.sra Read 333939 spots for ERR1806557.sra Written 333939 spots for ERR1806557.sra Read 333939 spots for ERR1806557.sra Written 333939 spots for ERR1806557.sra Read 333939 spots for ERR1806557.sra Written 333939 spots for ERR1806557.sra Read 333939 spots for ERR1806557.sra Written 333939 spots for ERR1806557.sra Read 333939 spots for ERR1806557.sra Written 333939 spots for ERR1806557.sra Read 333939 spots for ERR1806557.sra Written 333939 spots for ERR1806557.sra SRR ids: ['ERR1806557.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5ycm0wqd ERR1806557.sra spots: 6678799 blocks: [[1, 333939], [333940, 667878], [667879, 1001817], [1001818, 1335756], [1335757, 1669695], [1669696, 2003634], [2003635, 2337573], [2337574, 2671512], [2671513, 3005451], [3005452, 3339390], [3339391, 3673329], [3673330, 4007268], [4007269, 4341207], [4341208, 4675146], [4675147, 5009085], [5009086, 5343024], [5343025, 5676963], [5676964, 6010902], [6010903, 6344841], [6344842, 6678799]] ERR1806557 file size 1311995 ERR1806557 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1806557 ERR1806557_1.fastq Input file: ERR1806557_1.fastq trimmed: ERR1806557-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 16:15:21 2024 >> started Mon Dec 9 16:15:26 2024 >> done (5.005s) 6678799 reads processed; of these: 205008 ( 3.07%) short reads filtered out after trimming by size control 31 ( 0.00%) empty reads filtered out after trimming by size control 6473760 (96.93%) reads available; of these: 93423 ( 1.44%) trimmed reads available after processing 6380337 (98.56%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 18659 0.29% 19 18342 0.28% 20 17869 0.28% 21 18139 0.28% 22 18082 0.28% 23 17798 0.27% 24 19120 0.30% 25 18456 0.29% 26 18954 0.29% 27 20266 0.31% 28 20331 0.31% 29 20753 0.32% 30 22528 0.35% 31 22405 0.35% 32 23369 0.36% 33 25788 0.40% 34 26455 0.41% 35 26270 0.41% 36 28599 0.44% 37 27929 0.43% 38 29750 0.46% 39 32610 0.50% 40 32588 0.50% 41 34661 0.54% 42 39559 0.61% 43 38009 0.59% 44 40395 0.62% 45 43789 0.68% 46 44751 0.69% 47 46519 0.72% 48 50896 0.79% 49 51640 0.80% 50 53322 0.82% 51 58307 0.90% 52 58432 0.90% 53 60307 0.93% 54 65265 1.01% 55 65919 1.02% 56 67444 1.04% 57 72199 1.12% 58 72005 1.11% 59 76310 1.18% 60 82185 1.27% 61 80383 1.24% 62 79913 1.23% 63 86817 1.34% 64 84202 1.30% 65 84150 1.30% 66 85462 1.32% 67 85326 1.32% 68 87820 1.36% 69 89767 1.39% 70 89686 1.39% 71 88566 1.37% 72 91432 1.41% 73 87512 1.35% 74 89173 1.38% 75 89427 1.38% 76 90476 1.40% 77 100393 1.55% 78 101666 1.57% 79 88203 1.36% 80 86542 1.34% 81 84683 1.31% 82 89141 1.38% 83 84534 1.31% 84 82731 1.28% 85 82273 1.27% 86 78524 1.21% 87 78460 1.21% 88 76863 1.19% 89 75348 1.16% 90 76923 1.19% 91 71658 1.11% 92 71005 1.10% 93 72202 1.12% 94 67561 1.04% 95 65636 1.01% 96 65360 1.01% 97 61202 0.95% 98 60863 0.94% 99 59633 0.92% 100 58328 0.90% 101 56780 0.88% 102 55195 0.85% 103 55865 0.86% 104 52107 0.80% 105 50048 0.77% 106 48189 0.74% 107 46778 0.72% 108 46220 0.71% 109 44754 0.69% 110 42589 0.66% 111 41463 0.64% 112 40974 0.63% 113 38325 0.59% 114 38200 0.59% 115 36786 0.57% 116 34966 0.54% 117 34185 0.53% 118 33015 0.51% 119 31799 0.49% 120 31421 0.49% 121 29623 0.46% 122 28460 0.44% 123 28166 0.44% 124 26837 0.41% 125 25584 0.40% 126 24788 0.38% 127 23959 0.37% 128 22773 0.35% 129 22450 0.35% 130 21047 0.33% 131 20440 0.32% 132 19997 0.31% 133 19153 0.30% 134 19075 0.29% 135 17970 0.28% 136 17046 0.26% 137 16347 0.25% 138 16139 0.25% 139 15439 0.24% 140 14528 0.22% 141 13848 0.21% 142 13124 0.20% 143 12625 0.20% 144 12470 0.19% 145 11916 0.18% 146 11402 0.18% 147 11177 0.17% 148 10588 0.16% 149 10027 0.15% 150 9660 0.15% 151 9180 0.14% 152 8954 0.14% 153 8558 0.13% 154 8254 0.13% 155 7997 0.12% 156 7521 0.12% 157 7260 0.11% 158 6752 0.10% 159 6587 0.10% 160 6243 0.10% 161 5918 0.09% 162 5711 0.09% 163 5501 0.08% 164 5384 0.08% 165 5018 0.08% 166 4863 0.08% 167 4536 0.07% 168 4265 0.07% 169 4058 0.06% 170 3944 0.06% 171 3725 0.06% 172 3583 0.06% 173 3330 0.05% 174 3211 0.05% 175 3078 0.05% 176 2924 0.05% 177 2804 0.04% 178 2537 0.04% 179 2458 0.04% 180 2353 0.04% 181 2272 0.04% 182 2053 0.03% 183 1911 0.03% 184 1905 0.03% 185 1734 0.03% 186 1730 0.03% 187 1575 0.02% 188 1440 0.02% 189 1395 0.02% 190 1307 0.02% 191 1206 0.02% 192 1118 0.02% 193 1085 0.02% 194 954 0.01% 195 908 0.01% 196 922 0.01% 197 876 0.01% 198 791 0.01% 199 726 0.01% 200 699 0.01% 201 657 0.01% 202 551 0.01% 203 561 0.01% 204 520 0.01% 205 478 0.01% 206 410 0.01% 207 390 0.01% 208 370 0.01% 209 341 0.01% 210 278 0.00% 211 283 0.00% 212 275 0.00% 213 227 0.00% 214 217 0.00% 215 176 0.00% 216 182 0.00% 217 147 0.00% 218 129 0.00% 219 125 0.00% 220 122 0.00% 221 94 0.00% 222 99 0.00% 223 101 0.00% 224 83 0.00% 225 66 0.00% 226 68 0.00% 227 62 0.00% 228 64 0.00% 229 58 0.00% 230 36 0.00% 231 43 0.00% 232 27 0.00% 233 35 0.00% 234 32 0.00% 235 31 0.00% 236 10 0.00% 237 25 0.00% 238 20 0.00% 239 14 0.00% 240 14 0.00% 241 14 0.00% 242 5 0.00% 243 6 0.00% 244 11 0.00% 245 7 0.00% 246 6 0.00% 247 4 0.00% 248 7 0.00% 249 3 0.00% 250 5 0.00% 251 4 0.00% 252 1 0.00% 253 1 0.00% 254 0 0.00% 255 2 0.00% 256 1 0.00% 257 2 0.00% 258 0 0.00% 259 2 0.00% 260 1 0.00% 261 0 0.00% 262 0 0.00% 263 0 0.00% 264 1 0.00% 265 0 0.00% 266 0 0.00% 267 1 0.00% 268 1 0.00% 269 0 0.00% 270 0 0.00% 271 2 0.00% 272 0 0.00% 273 0 0.00% 274 0 0.00% 275 1 0.00% 276 1 0.00% 277 0 0.00% 278 0 0.00% 279 0 0.00% 280 0 0.00% 281 0 0.00% 282 0 0.00% 283 0 0.00% 284 0 0.00% 285 0 0.00% 286 0 0.00% 287 0 0.00% 288 0 0.00% 289 0 0.00% 290 0 0.00% 291 0 0.00% 292 0 0.00% 293 0 0.00% 294 0 0.00% 295 0 0.00% 296 0 0.00% 297 0 0.00% 298 0 0.00% 299 0 0.00% 300 0 0.00% 301 0 0.00% 302 0 0.00% 303 0 0.00% 304 0 0.00% 305 0 0.00% 306 0 0.00% 307 0 0.00% 308 0 0.00% 309 0 0.00% 310 0 0.00% 311 1 0.00% 6473760 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.99 fanout-score-rank=23 prefix-density=0.21 prefix-fanout=3.2 sequence=AAGATCCAGGACAAGGAGGGCAT criterion=fanout-score sequence-density=0.05 sequence-density-rank=22 fanout-score=131.42 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=12.7 sequence=AGAAGAAGGACTCCCTGTGCTTCATTGAGGTGATCGCGCACAAGGATGACACGAGCAAAGAGC Started job on | Dec 09 16:17:02 Started mapping on | Dec 09 16:17:02 Finished on | Dec 09 16:17:56 Mapping speed, Million of reads per hour | 431.58 Number of input reads | 6473760 Average input read length | 81 UNIQUE READS: Uniquely mapped reads number | 5333993 Uniquely mapped reads % | 82.39% Average mapped length | 77.43 Number of splices: Total | 1294297 Number of splices: Annotated (sjdb) | 1216139 Number of splices: GT/AG | 1266634 Number of splices: GC/AG | 14685 Number of splices: AT/AC | 1204 Number of splices: Non-canonical | 11774 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.13% Deletion average length | 1.09 Insertion rate per base | 0.17% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 192733 % of reads mapped to multiple loci | 2.98% Number of reads mapped to too many loci | 75565 % of reads mapped to too many loci | 1.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.26% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 947034 947034 947034 N_multimapping 192733 192733 192733 N_noFeature 189322 240917 5203173 N_ambiguous 90076 11218 511 UnstrandedReadsAssigned:5054595 PositiveStrandReadsAssigned:5081858 NegativeStrandReadsAssigned:130309 Dataset is classified positive stranded MeadianReadLen=78 20thPercentileLength=56 echo kmer=51 ERR1806557 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR1806557-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,473,760 reads, 5,201,384 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52973 ERR1806557.ke.tsv 35125 ERR1806557.se.tsv 88098 total ==> ERR1806557.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 50.8383 17.8053 PNS24247 1044 945 32.0897 9.95445 PNS24249 1928 1829 38.958 6.24405 PNS24246 1044 945 32.0897 9.95445 PNS24248 1044 945 32.0897 9.95445 PNS24244 1471 1372 109.935 23.4889 PNS24243 293 194 0 0 KQK14069 1603 1504 1634.21 318.525 KQK14071 474 375 87.8115 68.6441 ==> ERR1806557.se.tsv <== BRADI_1g14170v3 1781 BRADI_1g53295v3 63 BRADI_1g59795v3 150 BRADI_1g07683v3 1 BRADI_1g00485v3 11 BRADI_1g20270v3 451 BRADI_1g74790v3 112 BRADI_1g09890v3 0 BRADI_1g77505v3 113 BRADI_1g48960v3 0 ERR1806557 completed mapping pipeline successfully