Starting /dee2/code/volunteer_pipeline.sh ERR1806558 current disk space = 1523319721984 free memory = 1580602340 ERR1806558 SRAfilesize 668b01e3212fd30a1b2cbfbc6cf928ef ERR1806558.sra ERR1806558.sra file validated ERR1806558 is single end ERR1806558 is conventional basespace ERR1806558 read1 length is 8-242 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1806558_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 8-242 %GC 52 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.88625 25.0 21.0 27.0 18.0 28.0 2 23.7965 25.0 21.0 27.0 17.0 28.0 3 23.492 25.0 21.0 27.0 16.0 28.0 4 23.72175 25.0 21.0 27.0 17.0 28.0 5 23.57075 25.0 21.0 27.0 16.0 28.0 6 23.55525 25.0 21.0 27.0 16.0 29.0 7 23.5625 25.0 21.0 27.0 16.0 29.0 8 23.42375 25.0 20.0 27.0 16.0 29.0 9 23.618665328650277 25.0 21.0 27.0 16.0 29.0 10-14 23.62195356978153 25.0 21.0 27.0 16.4 28.0 15-19 23.75202384109482 25.0 21.0 27.0 17.4 28.0 20-24 23.859222064363234 25.0 21.0 27.0 18.0 28.0 25-29 23.8476044569641 25.0 21.0 27.0 18.0 28.0 30-34 23.774916928372107 25.0 21.0 27.0 18.0 28.0 35-39 23.806652819643762 25.0 21.0 27.0 18.0 28.0 40-44 23.83275183495822 25.0 21.0 27.0 18.0 28.0 45-49 23.813737413306324 25.0 21.0 27.0 18.0 28.0 50-54 23.812184831388297 25.0 21.0 27.0 18.0 28.0 55-59 23.92319033566225 25.0 21.2 27.0 18.2 28.0 60-64 23.934785691208038 25.0 21.2 27.0 18.0 28.0 65-69 23.964519614361443 25.0 21.2 27.0 18.0 28.0 70-74 23.917398369755766 25.0 21.2 27.0 18.0 28.0 75-79 23.82113225880148 25.0 21.0 27.0 18.0 28.0 80-84 23.759368103844444 25.0 21.0 27.0 18.0 28.0 85-89 23.691674131702264 25.0 21.0 27.0 17.6 28.0 90-94 23.639555338985154 25.0 21.0 26.8 18.0 28.0 95-99 23.593027849522578 25.0 21.0 26.6 17.6 27.8 100-104 23.489953064610475 25.0 21.0 26.0 17.8 27.2 105-109 23.536072595696616 25.0 21.0 26.0 18.0 27.0 110-114 23.4988368644119 25.0 21.0 26.0 17.6 27.2 115-119 23.428290081925542 24.8 21.0 26.0 17.6 27.0 120-124 23.385384971936467 25.0 20.8 26.0 17.4 27.0 125-129 23.117334799532273 24.2 20.8 26.0 16.8 27.0 130-134 22.926822212785375 24.0 20.2 26.0 16.6 27.0 135-139 22.80671303190029 24.0 20.4 26.0 16.2 27.0 140-144 22.750413366030426 23.8 20.0 26.0 16.8 27.0 145-149 22.549765592431566 23.8 20.0 26.0 15.8 27.0 150-154 22.3762506012271 23.6 19.8 26.0 15.4 27.0 155-159 22.199946794681306 23.2 19.6 25.8 15.0 27.0 160-164 21.887889094576835 22.6 19.6 25.2 14.2 26.6 165-169 21.706948718651255 22.6 19.0 25.0 14.6 26.2 170-174 20.86660232411553 21.5 18.0 24.5 13.5 25.5 175-179 20.695896376509427 NaN NaN NaN NaN NaN 180-184 19.809931049342815 NaN NaN NaN NaN NaN 185-189 20.31929559707042 NaN NaN NaN NaN NaN 190-194 19.94851489388075 NaN NaN NaN NaN NaN 195-199 19.350986616868973 NaN NaN NaN NaN NaN 200-204 18.26599096555618 NaN NaN NaN NaN NaN 205-209 17.75359477124183 NaN NaN NaN NaN NaN 210-214 19.34047619047619 NaN NaN NaN NaN NaN 215-219 19.457142857142856 NaN NaN NaN NaN NaN 220-224 17.314285714285713 NaN NaN NaN NaN NaN 225-229 18.857142857142858 NaN NaN NaN NaN NaN 230-234 18.1 NaN NaN NaN NaN NaN 235-239 18.4 NaN NaN NaN NaN NaN 240-242 21.0 NaN NaN NaN NaN NaN >>END_MODULE >>Per sequence quality scores warn #Quality Count 11 10.0 12 12.0 13 21.0 14 33.0 15 42.0 16 85.0 17 92.0 18 105.0 19 131.0 20 156.0 21 197.0 22 325.0 23 524.0 24 1019.0 25 1064.0 26 178.0 27 6.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.575 43.0 15.8 15.625 2 40.400000000000006 35.05 6.45 18.099999999999998 3 31.05 31.7 18.15 19.1 4 37.275000000000006 26.8 16.1 19.825 5 29.4 26.0 17.625 26.974999999999998 6 27.450000000000003 28.549999999999997 18.55 25.45 7 22.85 29.775000000000002 22.900000000000002 24.474999999999998 8 25.874999999999996 25.174999999999997 23.849999999999998 25.1 9 26.99448068238836 21.525338685398896 23.482187656798796 27.99799297541395 10-14 26.934402924451668 24.197806661251015 23.659626320064987 25.208164094232334 15-19 28.39640762082749 24.513315682915433 21.870944297357628 25.219332398899446 20-24 27.890471902971242 23.573963243472274 22.58354960012711 25.952015253429373 25-29 26.492416908680223 24.938152092072713 23.330106485963213 25.239324513283854 30-34 28.055707263790282 23.910431458219552 22.61605679956308 25.41780447842709 35-39 27.353105763850028 24.247341913822048 23.02182428651371 25.37772803581421 40-44 27.4197247706422 23.847477064220183 23.222477064220186 25.510321100917434 45-49 27.315773897602842 24.303048239124 23.1015093222847 25.27966854098846 50-54 27.75597792765175 23.543838136112814 23.1023911710607 25.597792765174738 55-59 27.06211812627291 23.66980651731161 23.53615071283096 25.73192464358452 60-64 27.33702542203243 23.974110896109963 23.106692466804564 25.582171215053044 65-69 27.175818781120697 23.914720527386212 22.820674661617225 26.088786029875866 70-74 27.025217585360412 23.261176820650153 23.61823997619579 26.095365617793647 75-79 26.049618320610683 24.29230279898219 23.735687022900763 25.922391857506362 80-84 26.97426019961478 24.382770092803362 23.095780073542286 25.547189634039576 85-89 25.612840466926066 24.552529182879375 24.173151750972764 25.661478599221788 90-94 27.262006861063465 23.11320754716981 24.22813036020583 25.396655231560892 95-99 26.34234234234234 24.73273273273273 23.53153153153153 25.393393393393392 100-104 25.568564123267397 24.00753599784686 25.245592786973493 25.17830709191226 105-109 26.139864448552064 23.890942698706098 24.568699938385706 25.400492914356132 110-114 25.451942008233395 24.252729550742796 24.735994272418115 25.55933416860569 115-119 25.27771955564871 22.888283378746593 24.334521064766296 27.499476000838396 120-124 25.65367538233843 25.777010360138135 23.11297483966453 25.456339417858903 125-129 25.313807531380757 25.014943215780033 24.02869097429767 25.642558278541543 130-134 27.100175746924428 25.62390158172232 22.74165202108963 24.534270650263622 135-139 24.703960800326662 24.989791751735403 22.988975091874234 27.3172723560637 140-144 25.951557093425603 23.826000988630746 25.40781018289669 24.81463173504696 145-149 25.212636695018226 22.904009720534628 25.03037667071689 26.852976913730252 150-154 25.039619651347067 24.247226624405705 24.960380348652933 25.752773375594295 155-159 25.456389452332655 22.210953346855984 24.746450304259636 27.586206896551722 160-164 25.56675062972292 25.06297229219144 23.047858942065492 26.322418136020154 165-169 26.802507836990596 22.727272727272727 23.510971786833856 26.959247648902824 170-174 24.550898203592812 23.353293413173652 23.75249500998004 28.343313373253494 175-179 27.722772277227726 21.534653465346533 26.732673267326735 24.00990099009901 180-184 27.10843373493976 24.397590361445783 22.89156626506024 25.602409638554217 185-189 25.67049808429119 28.35249042145594 22.22222222222222 23.754789272030653 190-194 25.125628140703515 24.120603015075375 29.64824120603015 21.105527638190953 195-199 27.2108843537415 21.08843537414966 25.170068027210885 26.53061224489796 200-204 30.555555555555557 19.444444444444446 28.703703703703702 21.296296296296298 205-209 15.11627906976744 26.744186046511626 29.069767441860467 29.069767441860467 210-214 25.454545454545453 32.72727272727273 20.0 21.818181818181817 215-219 25.71428571428571 17.142857142857142 20.0 37.142857142857146 220-224 34.285714285714285 31.428571428571427 25.71428571428571 8.571428571428571 225-229 35.714285714285715 25.0 17.857142857142858 21.428571428571427 230-234 36.36363636363637 18.181818181818183 27.27272727272727 18.181818181818183 235-239 44.44444444444444 11.11111111111111 11.11111111111111 33.33333333333333 240-242 33.33333333333333 33.33333333333333 33.33333333333333 0.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.5 19 3.0 20 3.5 21 4.0 22 4.0 23 5.5 24 6.5 25 6.0 26 6.5 27 8.0 28 10.5 29 14.5 30 17.5 31 21.0 32 26.5 33 28.0 34 33.0 35 43.5 36 49.0 37 55.0 38 68.5 39 93.0 40 116.5 41 134.0 42 152.33333333333331 43 177.33333333333331 44 204.33333333333331 45 219.66666666666666 46 234.33333333333334 47 256.6666666666667 48 255.16666666666666 49 237.33333333333334 50 246.0 51 243.5 52 246.33333333333331 53 245.0 54 227.5 55 240.83333333333334 56 243.83333333333334 57 222.83333333333334 58 202.5 59 184.0 60 173.83333333333331 61 174.33333333333331 62 178.5 63 170.5 64 158.0 65 146.0 66 136.33333333333331 67 126.83333333333333 68 120.0 69 114.0 70 97.0 71 86.0 72 77.0 73 63.0 74 51.5 75 41.0 76 29.5 77 21.0 78 16.0 79 14.0 80 12.5 81 11.0 82 10.5 83 11.5 84 11.0 85 7.5 86 3.0 87 1.0 88 1.0 89 1.0 90 1.0 91 1.0 92 1.0 93 1.0 94 1.0 95 1.5 96 1.5 97 1.0 98 1.0 99 1.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-159 0.0 160-164 0.0 165-169 0.0 170-174 0.0 175-179 0.0 180-184 0.0 185-189 0.0 190-194 0.0 195-199 0.0 200-204 0.0 205-209 0.0 210-214 0.0 215-219 0.0 220-224 0.0 225-229 0.0 230-234 0.0 235-239 0.0 240-242 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 5-9 28.0 10-14 81.0 15-19 86.0 20-24 66.0 25-29 51.0 30-34 76.0 35-39 84.0 40-44 102.0 45-49 123.0 50-54 104.0 55-59 135.0 60-64 153.0 65-69 155.0 70-74 163.0 75-79 209.0 80-84 251.0 85-89 188.0 90-94 214.0 95-99 160.0 100-104 200.0 105-109 179.0 110-114 179.0 115-119 142.0 120-124 144.0 125-129 129.0 130-134 76.0 135-139 82.0 140-144 80.0 145-149 77.0 150-154 71.0 155-159 35.0 160-164 40.0 165-169 29.0 170-174 19.0 175-179 21.0 180-184 9.0 185-189 14.0 190-194 11.0 195-199 11.0 200-204 5.0 205-209 4.0 210-214 7.0 215-219 0.0 220-224 0.0 225-229 4.0 230-234 1.0 235-239 1.0 240-243 1.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.18822932521563 97.75 2 0.5834601725012684 1.15 3 0.15220700152207 0.44999999999999996 4 0.025367833587011668 0.1 5 0.0 0.0 6 0.0 0.0 7 0.025367833587011668 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.025367833587011668 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACTCCAAGATCATCAACGACAGGGAGACTGGCCGTTCCCGCGGGTTCGGC 15 0.375 No Hit ATGGGGGCCGGCGATGCGTCCTGGCCGTATGCGGAACGGCTTTTGCTGGT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.025 0.0 0.0 45-49 0.0 0.0 0.025 0.0 0.0 50-54 0.0 0.0 0.025 0.0 0.0 55-59 0.0 0.0 0.025 0.0 0.0 60-64 0.0 0.0 0.025 0.0 0.0 65-69 0.0 0.0 0.025 0.0 0.0 70-74 0.0 0.0 0.025 0.0 0.0 75-79 0.0 0.0 0.025 0.0 0.0 80-84 0.0 0.0 0.025 0.0 0.0 85-89 0.0 0.0 0.025 0.0 0.0 90-94 0.0 0.0 0.025 0.0 0.0 95-99 0.0 0.0 0.025 0.0 0.0 100-104 0.0 0.0 0.025 0.0 0.0 105-109 0.0 0.0 0.025 0.0 0.0 110-114 0.0 0.0 0.025 0.0 0.0 115-119 0.0 0.0 0.025 0.0 0.0 120-124 0.0 0.0 0.025 0.0 0.0 125-129 0.0 0.0 0.025 0.0 0.0 130-134 0.0 0.0 0.025 0.0 0.0 135-139 0.0 0.0 0.025 0.0 0.0 140-144 0.0 0.0 0.025 0.0 0.0 145-149 0.0 0.0 0.025 0.0 0.0 150-154 0.0 0.0 0.025 0.0 0.0 155-159 0.0 0.0 0.025 0.0 0.0 160-164 0.0 0.0 0.025 0.0 0.0 165-169 0.0 0.0 0.025 0.0 0.0 170-174 0.0 0.0 0.025 0.0 0.0 175-179 0.0 0.0 0.025 0.0 0.0 180-184 0.0 0.0 0.025 0.0 0.0 185-189 0.0 0.0 0.025 0.0 0.0 190-194 0.0 0.0 0.025 0.0 0.0 195-199 0.0 0.0 0.025 0.0 0.0 200-204 0.0 0.0 0.025 0.0 0.0 205-209 0.0 0.0 0.025 0.0 0.0 210-214 0.0 0.0 0.025 0.0 0.0 215-219 0.0 0.0 0.025 0.0 0.0 220-224 0.0 0.0 0.025 0.0 0.0 225-229 0.0 0.0 0.025 0.0 0.0 230 0.0 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCCACT 5 0.0010041537 2332.0 180-182 ATGCCAC 5 0.0010041537 2332.0 180-182 GGAGGAT 10 0.0013389993 1749.0 175-179 GATGCCA 10 0.004016232 1166.0 180-182 ACTAATC 5 0.009367637 874.5 170-174 GATGTAC 10 0.008030933 874.5 165-169 CCATCTC 10 0.008030933 874.5 170-174 CTAATCG 5 0.009367637 874.5 170-174 GAGGATG 15 0.009035662 777.3334 175-179 >>END_MODULE Read 315827 spots for ERR1806558.sra Written 315827 spots for ERR1806558.sra Read 315827 spots for ERR1806558.sra Written 315827 spots for ERR1806558.sra Read 315827 spots for ERR1806558.sra Written 315827 spots for ERR1806558.sra Read 315827 spots for ERR1806558.sra Written 315827 spots for ERR1806558.sra Read 315827 spots for ERR1806558.sra Written 315827 spots for ERR1806558.sra Read 315827 spots for ERR1806558.sra Written 315827 spots for ERR1806558.sra Read 315841 spots for ERR1806558.sra Written 315841 spots for ERR1806558.sra Read 315827 spots for ERR1806558.sra Written 315827 spots for ERR1806558.sra Read 315827 spots for ERR1806558.sra Written 315827 spots for ERR1806558.sra Read 315827 spots for ERR1806558.sra Written 315827 spots for ERR1806558.sra Read 315827 spots for ERR1806558.sra Written 315827 spots for ERR1806558.sra Read 315827 spots for ERR1806558.sra Written 315827 spots for ERR1806558.sra Read 315827 spots for ERR1806558.sra Written 315827 spots for ERR1806558.sra Read 315827 spots for ERR1806558.sra Written 315827 spots for ERR1806558.sra Read 315827 spots for ERR1806558.sra Written 315827 spots for ERR1806558.sra Read 315827 spots for ERR1806558.sra Written 315827 spots for ERR1806558.sra Read 315827 spots for ERR1806558.sra Written 315827 spots for ERR1806558.sra Read 315827 spots for ERR1806558.sra Written 315827 spots for ERR1806558.sra Read 315827 spots for ERR1806558.sra Written 315827 spots for ERR1806558.sra Read 315827 spots for ERR1806558.sra Written 315827 spots for ERR1806558.sra SRR ids: ['ERR1806558.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_186bw5np ERR1806558.sra spots: 6316554 blocks: [[1, 315827], [315828, 631654], [631655, 947481], [947482, 1263308], [1263309, 1579135], [1579136, 1894962], [1894963, 2210789], [2210790, 2526616], [2526617, 2842443], [2842444, 3158270], [3158271, 3474097], [3474098, 3789924], [3789925, 4105751], [4105752, 4421578], [4421579, 4737405], [4737406, 5053232], [5053233, 5369059], [5369060, 5684886], [5684887, 6000713], [6000714, 6316554]] ERR1806558 file size 1346076 ERR1806558 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1806558 ERR1806558_1.fastq Input file: ERR1806558_1.fastq trimmed: ERR1806558-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 16:17:36 2024 >> started Mon Dec 9 16:17:39 2024 >> done (3.434s) 6316554 reads processed; of these: 364361 ( 5.77%) short reads filtered out after trimming by size control 78 ( 0.00%) empty reads filtered out after trimming by size control 5952115 (94.23%) reads available; of these: 108603 ( 1.82%) trimmed reads available after processing 5843512 (98.18%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 25061 0.42% 19 23461 0.39% 20 22259 0.37% 21 22418 0.38% 22 21615 0.36% 23 21134 0.36% 24 23180 0.39% 25 22064 0.37% 26 21911 0.37% 27 22381 0.38% 28 22278 0.37% 29 22339 0.38% 30 23737 0.40% 31 22827 0.38% 32 23584 0.40% 33 25047 0.42% 34 24893 0.42% 35 24481 0.41% 36 25650 0.43% 37 24794 0.42% 38 25690 0.43% 39 27795 0.47% 40 26615 0.45% 41 27185 0.46% 42 31573 0.53% 43 28841 0.48% 44 28723 0.48% 45 31701 0.53% 46 30517 0.51% 47 31208 0.52% 48 33682 0.57% 49 33887 0.57% 50 33979 0.57% 51 36118 0.61% 52 36120 0.61% 53 36290 0.61% 54 39130 0.66% 55 39680 0.67% 56 39292 0.66% 57 41310 0.69% 58 41178 0.69% 59 43132 0.72% 60 47456 0.80% 61 46703 0.78% 62 45937 0.77% 63 50308 0.85% 64 48786 0.82% 65 48432 0.81% 66 50561 0.85% 67 50550 0.85% 68 51280 0.86% 69 54471 0.92% 70 53286 0.90% 71 54081 0.91% 72 57596 0.97% 73 55183 0.93% 74 57773 0.97% 75 58651 0.99% 76 58861 0.99% 77 68322 1.15% 78 74060 1.24% 79 60568 1.02% 80 60097 1.01% 81 60978 1.02% 82 64807 1.09% 83 62680 1.05% 84 62356 1.05% 85 61890 1.04% 86 61010 1.03% 87 62485 1.05% 88 61786 1.04% 89 62798 1.06% 90 67751 1.14% 91 60836 1.02% 92 62186 1.04% 93 65966 1.11% 94 61105 1.03% 95 60727 1.02% 96 62144 1.04% 97 58871 0.99% 98 59032 0.99% 99 59187 0.99% 100 59573 1.00% 101 59063 0.99% 102 57601 0.97% 103 59614 1.00% 104 56230 0.94% 105 54845 0.92% 106 52774 0.89% 107 52796 0.89% 108 52869 0.89% 109 52471 0.88% 110 50921 0.86% 111 53841 0.90% 112 50642 0.85% 113 48171 0.81% 114 49263 0.83% 115 46640 0.78% 116 45729 0.77% 117 45420 0.76% 118 43937 0.74% 119 42942 0.72% 120 43060 0.72% 121 40622 0.68% 122 39631 0.67% 123 38799 0.65% 124 37792 0.63% 125 37322 0.63% 126 37303 0.63% 127 35406 0.59% 128 34179 0.57% 129 34051 0.57% 130 32529 0.55% 131 31343 0.53% 132 30433 0.51% 133 29557 0.50% 134 30058 0.50% 135 28868 0.49% 136 27176 0.46% 137 26559 0.45% 138 26971 0.45% 139 25812 0.43% 140 25451 0.43% 141 24403 0.41% 142 23089 0.39% 143 22364 0.38% 144 21459 0.36% 145 21507 0.36% 146 20411 0.34% 147 20164 0.34% 148 19170 0.32% 149 18384 0.31% 150 18193 0.31% 151 17634 0.30% 152 16690 0.28% 153 16755 0.28% 154 16169 0.27% 155 15918 0.27% 156 15215 0.26% 157 15320 0.26% 158 13779 0.23% 159 13268 0.22% 160 13195 0.22% 161 12623 0.21% 162 12173 0.20% 163 11973 0.20% 164 11529 0.19% 165 11101 0.19% 166 10524 0.18% 167 10175 0.17% 168 9940 0.17% 169 9528 0.16% 170 9257 0.16% 171 8977 0.15% 172 8739 0.15% 173 8273 0.14% 174 8178 0.14% 175 7717 0.13% 176 7602 0.13% 177 7281 0.12% 178 6935 0.12% 179 6552 0.11% 180 6406 0.11% 181 6165 0.10% 182 5855 0.10% 183 5560 0.09% 184 5482 0.09% 185 5132 0.09% 186 4993 0.08% 187 4806 0.08% 188 4692 0.08% 189 4521 0.08% 190 4374 0.07% 191 4166 0.07% 192 4088 0.07% 193 3810 0.06% 194 3602 0.06% 195 3466 0.06% 196 3338 0.06% 197 3261 0.05% 198 3118 0.05% 199 3068 0.05% 200 2799 0.05% 201 2690 0.05% 202 2532 0.04% 203 2532 0.04% 204 2331 0.04% 205 2259 0.04% 206 2129 0.04% 207 1990 0.03% 208 1905 0.03% 209 1908 0.03% 210 1781 0.03% 211 1567 0.03% 212 1532 0.03% 213 1536 0.03% 214 1445 0.02% 215 1318 0.02% 216 1283 0.02% 217 1246 0.02% 218 1190 0.02% 219 1119 0.02% 220 1005 0.02% 221 998 0.02% 222 886 0.01% 223 881 0.01% 224 864 0.01% 225 755 0.01% 226 752 0.01% 227 656 0.01% 228 612 0.01% 229 531 0.01% 230 509 0.01% 231 439 0.01% 232 457 0.01% 233 425 0.01% 234 369 0.01% 235 363 0.01% 236 342 0.01% 237 303 0.01% 238 299 0.01% 239 271 0.00% 240 257 0.00% 241 246 0.00% 242 211 0.00% 243 194 0.00% 244 179 0.00% 245 150 0.00% 246 136 0.00% 247 119 0.00% 248 120 0.00% 249 106 0.00% 250 104 0.00% 251 94 0.00% 252 66 0.00% 253 76 0.00% 254 44 0.00% 255 61 0.00% 256 43 0.00% 257 43 0.00% 258 39 0.00% 259 46 0.00% 260 41 0.00% 261 40 0.00% 262 37 0.00% 263 21 0.00% 264 20 0.00% 265 21 0.00% 266 26 0.00% 267 11 0.00% 268 17 0.00% 269 9 0.00% 270 14 0.00% 271 14 0.00% 272 7 0.00% 273 8 0.00% 274 11 0.00% 275 2 0.00% 276 5 0.00% 277 2 0.00% 278 3 0.00% 279 2 0.00% 280 0 0.00% 281 2 0.00% 282 1 0.00% 283 3 0.00% 284 1 0.00% 285 1 0.00% 286 1 0.00% 287 0 0.00% 288 0 0.00% 289 2 0.00% 290 0 0.00% 291 0 0.00% 292 1 0.00% 293 0 0.00% 294 0 0.00% 295 0 0.00% 296 0 0.00% 297 0 0.00% 298 0 0.00% 299 0 0.00% 300 0 0.00% 301 0 0.00% 302 0 0.00% 303 0 0.00% 304 0 0.00% 305 0 0.00% 306 0 0.00% 307 0 0.00% 308 0 0.00% 309 0 0.00% 310 0 0.00% 311 0 0.00% 312 0 0.00% 313 0 0.00% 314 0 0.00% 315 0 0.00% 316 0 0.00% 317 0 0.00% 318 0 0.00% 319 0 0.00% 320 0 0.00% 321 0 0.00% 322 0 0.00% 323 0 0.00% 324 0 0.00% 325 0 0.00% 326 0 0.00% 327 0 0.00% 328 0 0.00% 329 0 0.00% 330 0 0.00% 331 0 0.00% 332 0 0.00% 333 0 0.00% 334 0 0.00% 335 0 0.00% 336 0 0.00% 337 0 0.00% 338 0 0.00% 339 0 0.00% 340 0 0.00% 341 0 0.00% 342 1 0.00% 5952115 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.53 fanout-score-rank=29 prefix-density=0.24 prefix-fanout=2.4 sequence=CCGGACCAGCAGCG criterion=fanout-score sequence-density=0.04 sequence-density-rank=21 fanout-score=86.13 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=12.5 sequence=GACAAGAAGAAAGCCTCTGTCTTCTTCAAGACTTCTGCTGATGGACACATCTCATGTGCTAAGGAGATGACAAAGGTCTCTGGTATCTCTGAAATCATCCCGGAGATGGAGGTCTGTGACTTCGACTTTGAGCCCTGCGGCTACTCCATGAACGCCATCCATGGATCTGCGTTCTCTACAATCCATGTGACCCCTG Started job on | Dec 09 16:18:00 Started mapping on | Dec 09 16:18:00 Finished on | Dec 09 16:18:14 Mapping speed, Million of reads per hour | 1530.54 Number of input reads | 5952115 Average input read length | 92 UNIQUE READS: Uniquely mapped reads number | 4564304 Uniquely mapped reads % | 76.68% Average mapped length | 86.38 Number of splices: Total | 1307922 Number of splices: Annotated (sjdb) | 1224464 Number of splices: GT/AG | 1279479 Number of splices: GC/AG | 13811 Number of splices: AT/AC | 1017 Number of splices: Non-canonical | 13615 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.16% Deletion average length | 1.10 Insertion rate per base | 0.12% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 176328 % of reads mapped to multiple loci | 2.96% Number of reads mapped to too many loci | 159841 % of reads mapped to too many loci | 2.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 17.13% % of reads unmapped: other | 0.54% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1211483 1211483 1211483 N_multimapping 176328 176328 176328 N_noFeature 128892 174052 4462281 N_ambiguous 65943 9434 533 UnstrandedReadsAssigned:4369469 PositiveStrandReadsAssigned:4380818 NegativeStrandReadsAssigned:101490 Dataset is classified positive stranded MeadianReadLen=90 20thPercentileLength=59 echo kmer=55 ERR1806558 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR1806558-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,952,115 reads, 4,506,323 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,033 rounds 52973 ERR1806558.ke.tsv 35125 ERR1806558.se.tsv 88098 total ==> ERR1806558.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 81.0748 31.8944 PNS24247 1044 945 5.83333 2.03254 PNS24249 1928 1829 59.4375 10.7004 PNS24246 1044 945 5.83333 2.03254 PNS24248 1044 945 5.83333 2.03254 PNS24244 1471 1372 42.9877 10.3168 PNS24243 293 194 0 0 KQK14069 1603 1504 1110.21 243.059 KQK14071 474 375 142.587 125.199 ==> ERR1806558.se.tsv <== BRADI_1g14170v3 1292 BRADI_1g53295v3 30 BRADI_1g59795v3 56 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 511 BRADI_1g74790v3 96 BRADI_1g09890v3 0 BRADI_1g77505v3 116 BRADI_1g48960v3 0 ERR1806558 completed mapping pipeline successfully