Starting /dee2/code/volunteer_pipeline.sh ERR1806559 current disk space = 1523335991296 free memory = 1335587748 ERR1806559 SRAfilesize 5f5e7ed57f08213a18b848cc7e551905 ERR1806559.sra ERR1806559.sra file validated ERR1806559 is single end ERR1806559 is conventional basespace ERR1806559 read1 length is 8-228 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1806559_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 8-228 %GC 52 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.1665 25.0 22.0 27.0 19.0 28.0 2 23.8725 25.0 21.0 27.0 17.0 28.0 3 23.67875 25.0 21.0 27.0 17.0 28.0 4 23.7835 25.0 21.0 27.0 17.0 28.0 5 23.781 25.0 21.0 27.0 17.0 28.0 6 23.623 25.0 21.0 27.0 17.0 28.0 7 23.52125 25.0 21.0 27.0 17.0 28.0 8 23.55275 25.0 21.0 27.0 17.0 28.0 9 23.615018773466833 25.0 21.0 27.0 17.0 28.0 10-14 23.669638489847685 25.0 21.0 27.0 17.4 28.0 15-19 23.852609508045155 25.0 21.0 27.0 17.8 28.0 20-24 23.949820198109883 25.0 21.0 27.0 18.0 28.0 25-29 23.903560395686764 25.0 21.0 27.0 18.0 28.0 30-34 23.910776284635325 25.0 21.0 27.0 18.0 28.0 35-39 24.081673019423356 25.0 21.8 27.0 18.2 28.0 40-44 23.94832715159047 25.0 21.4 27.0 18.0 28.0 45-49 23.871317375342223 25.0 21.0 27.0 18.0 28.0 50-54 23.797314278506285 25.0 21.0 27.0 18.0 28.0 55-59 23.79292131117195 25.0 21.0 27.0 18.0 28.0 60-64 23.81067731266024 25.0 21.0 27.0 18.0 28.0 65-69 23.781545687640012 25.0 21.0 27.0 18.0 28.0 70-74 23.722792538764587 25.0 21.0 27.0 18.0 28.0 75-79 23.592811497347423 25.0 21.0 27.0 17.6 28.0 80-84 23.56505615929533 25.0 21.0 26.6 17.8 27.8 85-89 23.546868109387947 25.0 21.0 26.4 17.6 27.8 90-94 23.42537660172015 25.0 21.0 26.2 17.4 27.6 95-99 23.591334016810855 25.0 20.8 26.6 17.8 27.8 100-104 23.538214168956596 25.0 21.0 26.0 17.8 28.0 105-109 23.36982648165901 25.0 21.0 26.0 17.4 27.2 110-114 23.322297223079097 24.8 21.0 26.0 17.4 27.4 115-119 23.26522740103469 24.8 20.8 26.0 17.4 27.0 120-124 23.013000078284893 24.2 20.4 26.0 16.8 27.0 125-129 22.64544320858715 23.8 20.0 26.0 16.0 27.0 130-134 23.016401203870817 23.8 20.2 26.0 17.2 27.0 135-139 22.831306619741117 23.8 20.2 26.0 17.0 27.0 140-144 22.31870928195148 23.6 19.6 26.0 14.6 27.0 145-149 22.29657794554136 23.4 19.8 25.6 14.8 27.0 150-154 22.200182194616975 24.0 20.0 25.0 17.0 27.0 155-159 21.799413512835564 NaN NaN NaN NaN NaN 160-164 22.299465363764646 NaN NaN NaN NaN NaN 165-169 22.211253835041283 NaN NaN NaN NaN NaN 170-174 21.173481376219495 NaN NaN NaN NaN NaN 175-179 21.290789170506912 NaN NaN NaN NaN NaN 180-184 20.400446939868523 NaN NaN NaN NaN NaN 185-189 19.27341614906832 NaN NaN NaN NaN NaN 190-194 18.613342670401494 NaN NaN NaN NaN NaN 195-199 18.931385281385282 NaN NaN NaN NaN NaN 200-204 17.62222222222222 NaN NaN NaN NaN NaN 205-209 18.94 NaN NaN NaN NaN NaN 210-214 17.3 NaN NaN NaN NaN NaN 215-219 20.233333333333334 NaN NaN NaN NaN NaN 220-224 21.0 NaN NaN NaN NaN NaN 225-228 20.5 NaN NaN NaN NaN NaN >>END_MODULE >>Per sequence quality scores warn #Quality Count 11 4.0 12 2.0 13 2.0 14 7.0 15 13.0 16 36.0 17 65.0 18 104.0 19 137.0 20 153.0 21 204.0 22 345.0 23 550.0 24 966.0 25 1101.0 26 298.0 27 13.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.275 42.325 18.375 15.024999999999999 2 42.425000000000004 35.225 6.0 16.35 3 31.05 31.374999999999996 18.5 19.075 4 36.0 27.750000000000004 16.45 19.8 5 28.775000000000002 27.85 17.025000000000002 26.35 6 27.375 28.025 18.95 25.650000000000002 7 23.35 30.475 23.525 22.650000000000002 8 26.25 24.8 23.95 25.0 9 24.98122653316646 22.803504380475594 24.130162703379224 28.085106382978726 10-14 27.07537688442211 25.467336683417084 22.72361809045226 24.733668341708544 15-19 28.007748776508972 24.449429037520392 22.28792822185971 25.25489396411093 20-24 27.88681204569055 24.241952232606437 21.739356178608517 26.131879543094495 25-29 27.52153008929043 24.826966767052358 22.729434141702328 24.92206900195488 30-34 27.62320716057371 24.253208238973365 22.371400841151733 25.752183759301197 35-39 27.9160403095596 24.096653861143587 22.55442347308056 25.432882356216247 40-44 27.8186771781346 24.23627615790389 22.72332038722393 25.221726276737584 45-49 26.86924493554328 24.917127071823206 22.47391037446286 25.739717618170655 50-54 28.332352748905016 24.2727332156632 22.004314571484603 25.39059946394718 55-59 27.089398565646523 24.58993112263012 23.13427536746432 25.18639494425904 60-64 27.342286071205496 24.851655215490318 23.040287320424735 24.76577139287945 65-69 27.475117862755372 24.00907979745067 22.551073860660033 25.964728479133925 70-74 27.44748315497424 24.276654776060248 23.275862068965516 25.0 75-79 26.87471422039323 24.622770919067214 23.319615912208505 25.182898948331044 80-84 27.33734281027884 24.27556041552761 23.154729360306177 25.232367413887367 85-89 26.78513731825525 24.58804523424879 23.586429725363487 25.040387722132472 90-94 27.01192250372578 23.21162444113264 23.043964232488822 26.732488822652755 95-99 27.264633874916537 24.348987313598933 23.347429334520363 25.038949476964167 100-104 26.845459373340415 25.7036643653744 22.54381306425916 24.907063197026023 105-109 26.16243025418475 24.20954742715437 24.58152510849349 25.04649721016739 110-114 26.53817642698295 24.981467753891774 22.646404744255 25.833951074870278 115-119 26.29955947136564 23.788546255506606 23.65638766519824 26.25550660792951 120-124 26.780931976432782 24.15640064274237 23.460096411355117 25.60257096946974 125-129 26.370757180156655 24.869451697127936 23.890339425587467 24.869451697127936 130-134 25.525040387722132 24.31340872374798 25.121163166397416 25.040387722132472 135-139 27.48171368861024 25.287356321839084 22.361546499477534 24.869383490073147 140-144 26.28032345013477 23.58490566037736 24.528301886792452 25.60646900269542 145-149 24.283305227655987 27.48735244519393 21.41652613827993 26.812816188870155 150-154 25.918367346938776 24.897959183673468 23.06122448979592 26.122448979591837 155-159 27.790973871733964 28.028503562945367 22.090261282660332 22.090261282660332 160-164 29.014084507042252 22.253521126760564 25.070422535211268 23.661971830985916 165-169 25.675675675675674 28.37837837837838 25.33783783783784 20.60810810810811 170-174 26.339285714285715 26.339285714285715 24.553571428571427 22.767857142857142 175-179 31.70731707317073 20.121951219512198 24.390243902439025 23.78048780487805 180-184 30.344827586206897 17.93103448275862 31.03448275862069 20.689655172413794 185-189 29.464285714285715 21.428571428571427 29.464285714285715 19.642857142857142 190-194 17.647058823529413 23.52941176470588 30.58823529411765 28.235294117647058 195-199 26.984126984126984 25.396825396825395 17.46031746031746 30.158730158730158 200-204 20.454545454545457 22.727272727272727 34.090909090909086 22.727272727272727 205-209 29.166666666666668 16.666666666666664 25.0 29.166666666666668 210-214 20.0 35.0 25.0 20.0 215-219 37.5 43.75 6.25 12.5 220-224 28.57142857142857 0.0 14.285714285714285 57.14285714285714 225-228 50.0 0.0 50.0 0.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 1.5 19 3.0 20 4.0 21 4.0 22 4.5 23 5.0 24 5.0 25 5.5 26 6.5 27 7.0 28 8.5 29 12.0 30 14.5 31 17.0 32 20.5 33 27.5 34 43.0 35 56.333333333333336 36 64.33333333333334 37 78.0 38 97.0 39 119.0 40 143.5 41 162.0 42 168.5 43 182.5 44 213.5 45 222.5 46 214.16666666666666 47 232.83333333333331 48 253.33333333333331 49 245.66666666666666 50 228.83333333333334 51 237.0 52 258.0 53 256.5 54 234.33333333333334 55 222.66666666666666 56 224.16666666666666 57 216.16666666666666 58 192.33333333333331 59 180.5 60 187.5 61 189.5 62 185.5 63 174.5 64 162.5 65 156.83333333333334 66 144.5 67 129.0 68 123.5 69 111.0 70 92.5 71 81.5 72 71.5 73 66.0 74 62.0 75 49.0 76 37.0 77 28.0 78 20.0 79 12.5 80 9.0 81 9.0 82 8.5 83 5.5 84 2.5 85 1.5 86 0.5 87 0.0 88 1.5 89 3.0 90 3.0 91 2.0 92 1.0 93 0.5 94 0.0 95 0.0 96 0.5 97 1.0 98 1.0 99 1.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-159 0.0 160-164 0.0 165-169 0.0 170-174 0.0 175-179 0.0 180-184 0.0 185-189 0.0 190-194 0.0 195-199 0.0 200-204 0.0 205-209 0.0 210-214 0.0 215-219 0.0 220-224 0.0 225-228 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 5-9 7.0 10-14 45.0 15-19 71.0 20-24 60.0 25-29 74.0 30-34 98.0 35-39 134.0 40-44 161.0 45-49 215.0 50-54 224.0 55-59 253.0 60-64 257.0 65-69 281.0 70-74 259.0 75-79 290.0 80-84 257.0 85-89 165.0 90-94 185.0 95-99 153.0 100-104 125.0 105-109 104.0 110-114 94.0 115-119 82.0 120-124 74.0 125-129 56.0 130-134 61.0 135-139 53.0 140-144 32.0 145-149 26.0 150-154 15.0 155-159 14.0 160-164 10.0 165-169 15.0 170-174 15.0 175-179 4.0 180-184 6.0 185-189 5.0 190-194 6.0 195-199 4.0 200-204 5.0 205-209 1.0 210-214 0.0 215-219 2.0 220-224 1.0 225-229 1.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.23973644196656 97.89999999999999 2 0.481500253421186 0.95 3 0.15205271160669032 0.44999999999999996 4 0.05068423720223011 0.2 5 0.05068423720223011 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025342118601115054 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGATAATCATACCCCGTTCGAGGAGAGCAAGGCGATCGACATCAACCCGG 10 0.25 No Hit GGGAAGAAGCTCACTGCCGAGGCTTATGACTGCAACAATACGGTTGAGCA 5 0.125 No Hit GAGCAGAACGGCAAGGGCTACTTCGAGGACCGCCGGCCGGCGTCCAACAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.0 0.0 0.0 0.0 0.0 80-84 0.0 0.0 0.0 0.0 0.0 85-89 0.0 0.0 0.0 0.0 0.0 90-94 0.0 0.0 0.0 0.0 0.0 95-99 0.0 0.0 0.0 0.0 0.0 100-104 0.0 0.0 0.0 0.0 0.0 105-109 0.0 0.0 0.0 0.0 0.0 110-114 0.0 0.0 0.0 0.0 0.0 115-119 0.0 0.0 0.0 0.0 0.0 120-124 0.0 0.0 0.0 0.0 0.0 125-129 0.0 0.0 0.0 0.0 0.0 130-134 0.0 0.0 0.0 0.0 0.0 135-139 0.0 0.0 0.0 0.0 0.0 140-144 0.0 0.0 0.0 0.0 0.0 145-149 0.0 0.0 0.0 0.0 0.0 150-154 0.0 0.0 0.0 0.0 0.0 155-159 0.0 0.0 0.0 0.0 0.0 160-164 0.0 0.0 0.0 0.0 0.0 165-169 0.0 0.0 0.0 0.0 0.0 170-174 0.0 0.0 0.0 0.0 0.0 175-179 0.0 0.0 0.0 0.0 0.0 180-184 0.0 0.0 0.0 0.0 0.0 185-189 0.0 0.0 0.0 0.0 0.0 190-194 0.0 0.0 0.0 0.0 0.0 195-199 0.0 0.0 0.0 0.0 0.0 200-204 0.0 0.0 0.0 0.0 0.0 205-209 0.0 0.0 0.0 0.0 0.0 210-214 0.0 0.0 0.0 0.0 0.0 215-216 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTTCCC 5 5.9239805E-4 2629.5 130-134 CGGGCCC 5 0.0035534874 1314.75 125-129 ACAAATA 5 0.005921728 1051.7999 140-144 CAAGACA 5 0.005921728 1051.7999 140-144 CACGCCA 5 0.005921728 1051.7999 135-139 AAGACAA 5 0.005921728 1051.7999 140-144 GACAAAT 5 0.005921728 1051.7999 140-144 AGACAAA 5 0.005921728 1051.7999 140-144 CATCACG 5 0.008881466 876.49994 130-134 ACATCAC 5 0.008881466 876.49994 130-134 TCACGCC 5 0.008881466 876.49994 130-134 ATCACGC 5 0.008881466 876.49994 130-134 >>END_MODULE Read 349828 spots for ERR1806559.sra Written 349828 spots for ERR1806559.sra Read 349828 spots for ERR1806559.sra Written 349828 spots for ERR1806559.sra Read 349828 spots for ERR1806559.sra Written 349828 spots for ERR1806559.sra Read 349828 spots for ERR1806559.sra Written 349828 spots for ERR1806559.sra Read 349828 spots for ERR1806559.sra Written 349828 spots for ERR1806559.sra Read 349828 spots for ERR1806559.sra Written 349828 spots for ERR1806559.sra Read 349828 spots for ERR1806559.sra Written 349828 spots for ERR1806559.sra Read 349828 spots for ERR1806559.sra Written 349828 spots for ERR1806559.sra Read 349829 spots for ERR1806559.sra Written 349829 spots for ERR1806559.sra Read 349828 spots for ERR1806559.sra Written 349828 spots for ERR1806559.sra Read 349828 spots for ERR1806559.sra Written 349828 spots for ERR1806559.sra Read 349828 spots for ERR1806559.sra Written 349828 spots for ERR1806559.sra Read 349828 spots for ERR1806559.sra Written 349828 spots for ERR1806559.sra Read 349828 spots for ERR1806559.sra Written 349828 spots for ERR1806559.sra Read 349828 spots for ERR1806559.sra Written 349828 spots for ERR1806559.sra Read 349828 spots for ERR1806559.sra Written 349828 spots for ERR1806559.sra Read 349828 spots for ERR1806559.sra Written 349828 spots for ERR1806559.sra Read 349828 spots for ERR1806559.sra Written 349828 spots for ERR1806559.sra Read 349828 spots for ERR1806559.sra Written 349828 spots for ERR1806559.sra Read 349828 spots for ERR1806559.sra Written 349828 spots for ERR1806559.sra SRR ids: ['ERR1806559.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nvo5lj2k ERR1806559.sra spots: 6996561 blocks: [[1, 349828], [349829, 699656], [699657, 1049484], [1049485, 1399312], [1399313, 1749140], [1749141, 2098968], [2098969, 2448796], [2448797, 2798624], [2798625, 3148452], [3148453, 3498280], [3498281, 3848108], [3848109, 4197936], [4197937, 4547764], [4547765, 4897592], [4897593, 5247420], [5247421, 5597248], [5597249, 5947076], [5947077, 6296904], [6296905, 6646732], [6646733, 6996561]] ERR1806559 file size 1311861 ERR1806559 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1806559 ERR1806559_1.fastq Input file: ERR1806559_1.fastq trimmed: ERR1806559-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 16:25:50 2024 >> started Mon Dec 9 16:26:06 2024 >> done (16.012s) 6996561 reads processed; of these: 177879 ( 2.54%) short reads filtered out after trimming by size control 7 ( 0.00%) empty reads filtered out after trimming by size control 6818675 (97.46%) reads available; of these: 99154 ( 1.45%) trimmed reads available after processing 6719521 (98.55%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 21730 0.32% 19 20630 0.30% 20 20758 0.30% 21 21659 0.32% 22 21505 0.32% 23 21833 0.32% 24 24682 0.36% 25 24367 0.36% 26 26077 0.38% 27 28004 0.41% 28 28998 0.43% 29 29169 0.43% 30 33161 0.49% 31 32412 0.48% 32 33776 0.50% 33 37355 0.55% 34 38907 0.57% 35 39409 0.58% 36 43109 0.63% 37 43153 0.63% 38 45160 0.66% 39 53379 0.78% 40 50630 0.74% 41 52204 0.77% 42 62232 0.91% 43 57953 0.85% 44 60396 0.89% 45 68529 1.01% 46 67167 0.99% 47 66871 0.98% 48 75486 1.11% 49 75455 1.11% 50 75120 1.10% 51 81927 1.20% 52 82463 1.21% 53 81281 1.19% 54 87663 1.29% 55 88432 1.30% 56 87853 1.29% 57 94188 1.38% 58 91685 1.34% 59 93332 1.37% 60 99068 1.45% 61 97448 1.43% 62 97457 1.43% 63 103235 1.51% 64 97352 1.43% 65 96361 1.41% 66 98965 1.45% 67 97056 1.42% 68 96300 1.41% 69 98197 1.44% 70 98864 1.45% 71 94481 1.39% 72 96862 1.42% 73 90789 1.33% 74 92338 1.35% 75 89945 1.32% 76 86886 1.27% 77 87838 1.29% 78 86124 1.26% 79 82375 1.21% 80 81123 1.19% 81 80974 1.19% 82 80192 1.18% 83 75648 1.11% 84 74571 1.09% 85 73766 1.08% 86 69392 1.02% 87 68186 1.00% 88 67516 0.99% 89 64917 0.95% 90 64483 0.95% 91 61441 0.90% 92 59720 0.88% 93 62486 0.92% 94 56997 0.84% 95 55603 0.82% 96 55589 0.82% 97 51458 0.75% 98 51009 0.75% 99 51007 0.75% 100 49239 0.72% 101 46800 0.69% 102 46621 0.68% 103 53198 0.78% 104 42820 0.63% 105 41778 0.61% 106 39390 0.58% 107 39425 0.58% 108 37878 0.56% 109 38597 0.57% 110 35793 0.52% 111 35593 0.52% 112 35480 0.52% 113 32396 0.48% 114 34085 0.50% 115 30897 0.45% 116 29820 0.44% 117 28681 0.42% 118 27608 0.40% 119 26437 0.39% 120 25739 0.38% 121 24406 0.36% 122 23913 0.35% 123 22869 0.34% 124 21950 0.32% 125 21141 0.31% 126 20241 0.30% 127 19901 0.29% 128 18857 0.28% 129 18642 0.27% 130 17965 0.26% 131 17355 0.25% 132 17268 0.25% 133 16474 0.24% 134 15474 0.23% 135 15036 0.22% 136 14089 0.21% 137 13643 0.20% 138 13639 0.20% 139 13148 0.19% 140 12754 0.19% 141 11847 0.17% 142 11156 0.16% 143 10612 0.16% 144 10733 0.16% 145 10021 0.15% 146 9782 0.14% 147 9953 0.15% 148 8976 0.13% 149 8547 0.13% 150 8605 0.13% 151 8094 0.12% 152 7776 0.11% 153 7662 0.11% 154 7577 0.11% 155 7274 0.11% 156 6719 0.10% 157 6725 0.10% 158 6203 0.09% 159 6113 0.09% 160 5684 0.08% 161 5360 0.08% 162 5228 0.08% 163 5240 0.08% 164 4928 0.07% 165 4866 0.07% 166 4552 0.07% 167 4428 0.06% 168 4190 0.06% 169 4020 0.06% 170 3753 0.06% 171 3780 0.06% 172 3593 0.05% 173 3385 0.05% 174 3316 0.05% 175 3172 0.05% 176 3091 0.05% 177 2910 0.04% 178 2719 0.04% 179 2669 0.04% 180 2560 0.04% 181 2418 0.04% 182 2223 0.03% 183 2293 0.03% 184 2078 0.03% 185 2024 0.03% 186 1991 0.03% 187 1920 0.03% 188 1842 0.03% 189 1737 0.03% 190 1630 0.02% 191 1614 0.02% 192 1466 0.02% 193 1397 0.02% 194 1393 0.02% 195 1227 0.02% 196 1314 0.02% 197 1207 0.02% 198 1045 0.02% 199 1093 0.02% 200 1012 0.01% 201 960 0.01% 202 939 0.01% 203 836 0.01% 204 838 0.01% 205 813 0.01% 206 786 0.01% 207 689 0.01% 208 671 0.01% 209 686 0.01% 210 583 0.01% 211 579 0.01% 212 542 0.01% 213 548 0.01% 214 477 0.01% 215 478 0.01% 216 449 0.01% 217 402 0.01% 218 391 0.01% 219 371 0.01% 220 333 0.00% 221 333 0.00% 222 332 0.00% 223 273 0.00% 224 245 0.00% 225 234 0.00% 226 242 0.00% 227 224 0.00% 228 214 0.00% 229 186 0.00% 230 190 0.00% 231 153 0.00% 232 169 0.00% 233 124 0.00% 234 150 0.00% 235 117 0.00% 236 99 0.00% 237 120 0.00% 238 89 0.00% 239 98 0.00% 240 77 0.00% 241 64 0.00% 242 74 0.00% 243 54 0.00% 244 40 0.00% 245 50 0.00% 246 47 0.00% 247 44 0.00% 248 36 0.00% 249 43 0.00% 250 32 0.00% 251 33 0.00% 252 26 0.00% 253 17 0.00% 254 16 0.00% 255 14 0.00% 256 15 0.00% 257 25 0.00% 258 12 0.00% 259 9 0.00% 260 15 0.00% 261 4 0.00% 262 5 0.00% 263 4 0.00% 264 8 0.00% 265 8 0.00% 266 7 0.00% 267 3 0.00% 268 9 0.00% 269 5 0.00% 270 4 0.00% 271 0 0.00% 272 1 0.00% 273 0 0.00% 274 3 0.00% 275 1 0.00% 276 1 0.00% 277 0 0.00% 278 3 0.00% 279 1 0.00% 6818675 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=26.45 fanout-score-rank=5 prefix-density=0.66 prefix-fanout=14.1 sequence=ATCACCGACTGCCCATAGAGAGGCTGAGACTGCCAAGGCACACAGGGGATAGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=68.23 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.6 sequence=AGAAGATTGTGATCAAGACCTGTGGGACTACCATGCTCCTGCTCACCATTCCAAGGATTCTTGAGCTTGCTGAAGAGCTGTGCATGCCGCTTGCTGCTGTGAAGTACTCTCGAGGGATGTTCATCTTCCCTGGCGCACAGCCAGCTCCCCACAGGAGCTTCTCTGAGGAGGTTGATGTCCTTAACCGCTACTTTGGTGGCCTGAAATCTGGTGGCAATGCTTATGTGATTGGAGATCCAGCCAAGCCAGGCCAGAAGTGGCACATCTATTATGCCACTGAGCAACCTGAGAAACCTATGGTCACACTGGAGATGTGCATGACTGGGCTGGACAAGAAGAAAGCCTCTGTCTTCTTCAAGACTTCTGCTGATGGACACATCTCATGTGCTAAGGAGATGACAAAGGTCTCTGGTATCTCTGAAATCATCCCGGAGATGGAGGTCTGTGACTTCGACTTTGAGCCCTGCGGCTACTCCATGAACGCCATCCATGGATCTGCGTTCTCTACAAT Started job on | Dec 09 16:27:11 Started mapping on | Dec 09 16:27:11 Finished on | Dec 09 16:28:03 Mapping speed, Million of reads per hour | 472.06 Number of input reads | 6818675 Average input read length | 76 UNIQUE READS: Uniquely mapped reads number | 5884800 Uniquely mapped reads % | 86.30% Average mapped length | 73.85 Number of splices: Total | 1365464 Number of splices: Annotated (sjdb) | 1283081 Number of splices: GT/AG | 1337932 Number of splices: GC/AG | 14972 Number of splices: AT/AC | 1249 Number of splices: Non-canonical | 11311 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.13% Deletion average length | 1.10 Insertion rate per base | 0.12% Insertion average length | 1.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 190047 % of reads mapped to multiple loci | 2.79% Number of reads mapped to too many loci | 122051 % of reads mapped to too many loci | 1.79% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.89% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 743828 743828 743828 N_multimapping 190047 190047 190047 N_noFeature 166411 220499 5751203 N_ambiguous 89753 10809 513 UnstrandedReadsAssigned:5628636 PositiveStrandReadsAssigned:5653492 NegativeStrandReadsAssigned:133084 Dataset is classified positive stranded MeadianReadLen=72 20thPercentileLength=50 echo kmer=45 ERR1806559 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR1806559-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,818,675 reads, 5,604,095 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 985 rounds 52973 ERR1806559.ke.tsv 35125 ERR1806559.se.tsv 88098 total ==> ERR1806559.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 83.0327 26.816 PNS24247 1044 945 17.5 5.00583 PNS24249 1928 1829 104.014 15.3726 PNS24246 1044 945 17.5 5.00583 PNS24248 1044 945 17.5 5.00583 PNS24244 1471 1372 19.4536 3.83281 PNS24243 293 194 0 0 KQK14069 1603 1504 1575 283.077 KQK14071 474 375 71.3843 51.4566 ==> ERR1806559.se.tsv <== BRADI_1g14170v3 1700 BRADI_1g53295v3 56 BRADI_1g59795v3 84 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 573 BRADI_1g74790v3 85 BRADI_1g09890v3 0 BRADI_1g77505v3 128 BRADI_1g48960v3 0 ERR1806559 completed mapping pipeline successfully