Starting /dee2/code/volunteer_pipeline.sh ERR1806560 current disk space = 1523350241280 free memory = 1580595680 ERR1806560 SRAfilesize 15c751e6a2747542a06dfedc395db9c3 ERR1806560.sra ERR1806560.sra file validated ERR1806560 is single end ERR1806560 is conventional basespace ERR1806560 read1 length is 8-249 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1806560_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 8-249 %GC 51 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.1285 24.0 21.0 26.0 18.0 27.0 2 22.89175 24.0 20.0 26.0 16.0 28.0 3 22.79275 24.0 20.0 26.0 16.0 28.0 4 23.0875 24.0 21.0 26.0 16.0 28.0 5 22.958 24.0 20.0 26.0 16.0 28.0 6 22.93175 24.0 20.0 26.0 16.0 28.0 7 22.735 24.0 20.0 26.0 16.0 28.0 8 22.73225 24.0 20.0 26.0 15.0 28.0 9 22.71821821821822 24.0 20.0 26.0 16.0 28.0 10-14 22.69164731274045 24.0 20.0 26.0 15.6 27.4 15-19 22.932861044404845 24.0 20.0 26.0 16.0 27.6 20-24 23.16793221948844 24.2 20.8 26.0 16.6 28.0 25-29 23.240341614386065 24.4 21.0 26.0 17.0 27.8 30-34 23.341154408533278 24.8 21.0 26.0 17.4 27.8 35-39 23.417101417141872 25.0 21.0 26.0 17.8 28.0 40-44 23.43105907359423 25.0 21.0 26.4 17.4 28.0 45-49 23.30356598254375 24.8 20.8 26.0 17.0 27.8 50-54 23.260977645316444 24.8 21.0 26.0 17.0 27.8 55-59 23.26206205599764 24.8 20.6 26.0 17.0 27.6 60-64 23.268953393241166 24.8 20.8 26.0 17.0 28.0 65-69 23.308587685295333 25.0 20.8 26.0 17.0 28.0 70-74 23.244964720097105 24.6 20.6 26.0 17.0 27.4 75-79 23.28069145994228 24.6 20.6 26.0 17.0 27.8 80-84 23.27058398677784 24.6 20.6 26.0 17.2 27.0 85-89 23.264482944612347 24.4 20.6 26.0 17.2 27.4 90-94 23.206658384771924 24.6 20.4 26.0 17.0 27.2 95-99 23.162083835058816 24.2 20.4 26.0 16.8 27.0 100-104 23.288967153797675 24.6 20.6 26.0 17.4 27.2 105-109 23.102187963826353 24.2 20.4 26.0 16.8 27.0 110-114 23.11743465752898 24.0 20.4 26.0 17.0 27.0 115-119 23.018200650781417 24.0 20.2 26.0 17.0 27.0 120-124 22.933432366148953 24.0 20.0 26.0 17.0 27.0 125-129 22.83462346519501 24.0 20.0 26.0 16.4 27.0 130-134 22.628773699681354 23.8 20.0 26.0 16.0 27.0 135-139 22.449153960911698 23.8 20.0 26.0 15.6 27.0 140-144 22.350274944533787 23.2 20.0 26.0 16.0 27.0 145-149 22.202496613541758 23.0 19.6 25.8 15.6 27.0 150-154 21.829646043234504 23.0 19.2 25.2 14.2 26.8 155-159 21.6973687440671 22.6 19.0 25.0 15.0 26.2 160-164 21.63258077818093 22.4 19.0 25.0 15.0 26.0 165-169 21.293010859767286 22.0 18.8 24.8 15.2 26.0 170-174 21.163082072692166 21.8 18.6 24.8 13.6 26.0 175-179 20.961265925781834 21.2 18.4 24.0 14.4 26.0 180-184 20.557017981303456 21.2 17.8 24.0 14.2 25.2 185-189 20.563172747907096 21.6 17.6 24.0 13.6 25.2 190-194 20.502786484374788 21.0 18.0 24.0 13.0 25.0 195-199 20.277820494503278 NaN NaN NaN NaN NaN 200-204 19.885436997340335 NaN NaN NaN NaN NaN 205-209 19.063949146514936 NaN NaN NaN NaN NaN 210-214 18.66720945083014 NaN NaN NaN NaN NaN 215-219 18.19160173160173 NaN NaN NaN NaN NaN 220-224 19.108974358974358 NaN NaN NaN NaN NaN 225-229 20.075757575757578 NaN NaN NaN NaN NaN 230-234 17.636904761904763 NaN NaN NaN NaN NaN 235-239 17.306666666666665 NaN NaN NaN NaN NaN 240-244 16.8 NaN NaN NaN NaN NaN 245-249 22.4 NaN NaN NaN NaN NaN >>END_MODULE >>Per sequence quality scores warn #Quality Count 12 2.0 13 6.0 14 6.0 15 25.0 16 46.0 17 86.0 18 132.0 19 174.0 20 240.0 21 321.0 22 532.0 23 762.0 24 989.0 25 602.0 26 76.0 27 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.3 47.349999999999994 15.325 13.025 2 42.55 37.075 5.3 15.075 3 32.15 33.324999999999996 17.5 17.025000000000002 4 35.925000000000004 28.9 15.425 19.75 5 28.375 27.35 17.2 27.075 6 25.650000000000002 27.875 20.25 26.224999999999998 7 21.575 31.1 25.25 22.075 8 24.825 27.700000000000003 23.825 23.65 9 24.474474474474476 23.44844844844845 24.924924924924923 27.152152152152155 10-14 26.173384870237438 25.4957080467848 23.90442246875157 24.426484614226194 15-19 27.917469329818513 25.499340971306907 22.716212105850147 23.866977593024437 20-24 27.782907561300913 25.18723709859444 22.84805581204473 24.181799528059916 25-29 26.605552102755336 25.072508804640563 23.782887922104827 24.539051170499274 30-34 27.657130925036544 24.81728962205053 23.35038630194195 24.175193150970976 35-39 26.681755974313088 24.807874513106643 23.102431834929995 25.407937677650278 40-44 27.111890341090213 24.636064180214643 23.281266602911487 24.970778875783658 45-49 27.333871401668013 24.665052461662633 23.78800107613667 24.213075060532688 50-54 26.279565193641773 24.509750368711423 23.908887310864696 25.301797126782105 55-59 26.203981759537314 24.813702591480368 24.30764097430764 24.674674674674673 60-64 26.34533597958605 24.763254890842077 24.014743407995464 24.876665721576412 65-69 26.434306994064936 24.26975445129757 23.658792040032584 25.637146514604908 70-74 26.274651274651273 24.33862433862434 24.26046176046176 25.126262626262623 75-79 26.726029974289833 24.73192449990594 24.042139587383208 24.49990593842102 80-84 26.336306574165842 24.82325735051206 24.4400396432111 24.400396432111002 85-89 26.3869431213225 24.740823760156907 24.08237601569067 24.789857102829924 90-94 25.907701483635282 25.005591590248265 23.99164989189592 25.09505703422053 95-99 26.343434343434343 24.395959595959596 24.064646464646465 25.195959595959593 100-104 26.304579339723112 24.76925807596734 24.76038338658147 24.165779197728078 105-109 25.998234082213283 25.01716864514863 24.987736682036694 23.996860590601393 110-114 26.053806774861126 24.8121119703736 24.245724866572267 24.88835638819301 115-119 25.955139265467093 25.067784076904115 24.710377125955137 24.26669953167365 120-124 25.90852563216803 24.319469393395053 25.272903136658837 24.499101837778085 125-129 25.165458556571068 25.27576426095178 26.17396785376615 23.384809328710997 130-134 25.77966414467614 25.447499538660267 24.561727255951283 24.211109060712307 135-139 25.015954052329292 25.97319719208679 24.33524781961285 24.67560093597107 140-144 26.369018253576716 25.03700049333991 24.32165762210163 24.272323630981745 145-149 25.41617122473246 24.732461355529132 25.02972651605232 24.821640903686088 150-154 25.114800423878485 23.949134581419994 27.234192864712114 23.701872129989404 155-159 24.915682967959526 23.39797639123103 25.674536256323776 26.011804384485664 160-164 23.158963941086846 27.37430167597765 24.327069578466226 25.139664804469277 165-169 25.17263025737602 27.432517263025737 22.347771500313872 25.04708097928437 170-174 25.437928408225435 24.828636709824828 26.275704493526277 23.45773038842346 175-179 24.85822306238185 26.559546313799622 23.534971644612476 25.04725897920605 180-184 25.41966426858513 25.77937649880096 25.179856115107913 23.621103117505996 185-189 22.748815165876778 26.066350710900476 26.698262243285942 24.486571879936808 190-194 25.55066079295154 24.229074889867842 31.497797356828194 18.722466960352424 195-199 25.730994152046783 25.146198830409354 24.853801169590643 24.269005847953213 200-204 23.828125 27.34375 26.5625 22.265625 205-209 21.73913043478261 22.282608695652172 28.26086956521739 27.717391304347828 210-214 28.346456692913385 25.984251968503933 25.984251968503933 19.68503937007874 215-219 21.34831460674157 32.58426966292135 25.842696629213485 20.224719101123593 220-224 26.984126984126984 23.809523809523807 20.634920634920633 28.57142857142857 225-229 17.543859649122805 26.31578947368421 33.33333333333333 22.807017543859647 230-234 17.94871794871795 33.33333333333333 35.8974358974359 12.82051282051282 235-239 42.10526315789473 21.052631578947366 21.052631578947366 15.789473684210526 240-244 12.5 25.0 50.0 12.5 245-249 40.0 20.0 0.0 40.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 1.0 2 1.0 3 1.0 4 1.0 5 1.0 6 1.0 7 1.0 8 1.0 9 1.0 10 1.0 11 1.5 12 1.5 13 1.5 14 1.5 15 1.5 16 2.0 17 2.0 18 2.5 19 3.0 20 2.5 21 3.5 22 5.0 23 8.0 24 10.0 25 9.5 26 9.5 27 9.0 28 11.0 29 16.0 30 22.0 31 23.5 32 22.5 33 24.0 34 30.333333333333332 35 39.16666666666667 36 46.333333333333336 37 57.833333333333336 38 69.16666666666666 39 89.5 40 104.83333333333333 41 117.66666666666666 42 136.5 43 156.66666666666666 44 169.16666666666669 45 192.00000000000003 46 207.1666666666667 47 212.83333333333337 48 214.50000000000003 49 207.66666666666666 50 213.5 51 205.5 52 219.5 53 233.16666666666666 54 210.83333333333331 55 182.66666666666666 56 168.0 57 161.66666666666669 58 154.33333333333334 59 148.66666666666669 60 139.83333333333334 61 133.5 62 122.83333333333333 63 103.33333333333333 64 89.0 65 87.5 66 85.5 67 80.83333333333334 68 72.5 69 57.5 70 44.5 71 36.0 72 26.0 73 19.5 74 16.5 75 11.5 76 8.0 77 7.5 78 5.5 79 3.5 80 3.0 81 2.5 82 2.0 83 2.5 84 2.5 85 2.0 86 2.0 87 1.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-159 0.0 160-164 0.0 165-169 0.0 170-174 0.0 175-179 0.0 180-184 0.0 185-189 0.0 190-194 0.0 195-199 0.0 200-204 0.0 205-209 0.0 210-214 0.0 215-219 0.0 220-224 0.0 225-229 0.0 230-234 0.0 235-239 0.0 240-244 0.0 245-249 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 5-9 5.0 10-14 33.0 15-19 44.0 20-24 44.0 25-29 33.0 30-34 29.0 35-39 32.0 40-44 42.0 45-49 53.0 50-54 65.0 55-59 59.0 60-64 89.0 65-69 93.0 70-74 127.0 75-79 161.0 80-84 165.0 85-89 162.0 90-94 207.0 95-99 216.0 100-104 226.0 105-109 196.0 110-114 220.0 115-119 177.0 120-124 189.0 125-129 186.0 130-134 151.0 135-139 130.0 140-144 136.0 145-149 117.0 150-154 105.0 155-159 86.0 160-164 77.0 165-169 63.0 170-174 50.0 175-179 49.0 180-184 40.0 185-189 41.0 190-194 27.0 195-199 16.0 200-204 15.0 205-209 15.0 210-214 7.0 215-219 9.0 220-224 1.0 225-229 3.0 230-234 4.0 235-239 3.0 240-244 1.0 245-249 1.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.03626680192747 97.625 2 0.7101191985797616 1.4000000000000001 3 0.12680699974638598 0.375 4 0.0760841998478316 0.3 5 0.025361399949277198 0.125 6 0.0 0.0 7 0.025361399949277198 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACTCCAAGATCATCAACGACAGGGAGACTGGCCGTTCCCGCGGGTTCGGC 7 0.17500000000000002 No Hit GAGACGCTGTCGATGCCGCTGCTGGTTAGCGGCAGCAACAACGACGTAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.0 0.0 0.0 0.0 0.0 80-84 0.0 0.0 0.0 0.0 0.0 85-89 0.0 0.0 0.0 0.0 0.0 90-94 0.0 0.0 0.0 0.0 0.0 95-99 0.0 0.0 0.0 0.0 0.0 100-104 0.0 0.0 0.0 0.0 0.0 105-109 0.0 0.0 0.0 0.0 0.0 110-114 0.0 0.0 0.0 0.0 0.0 115-119 0.0 0.0 0.0 0.0 0.0 120-124 0.0 0.0 0.0 0.0 0.0 125-129 0.0 0.0 0.0 0.0 0.0 130-134 0.0 0.0 0.0 0.0 0.0 135-139 0.0 0.0 0.0 0.0 0.0 140-144 0.0 0.0 0.0 0.0 0.0 145-149 0.0 0.0 0.0 0.0 0.0 150-154 0.0 0.0 0.0 0.0 0.0 155-159 0.0 0.0 0.0 0.0 0.0 160-164 0.0 0.0 0.0 0.0 0.0 165-169 0.0 0.0 0.0 0.0 0.0 170-174 0.0 0.0 0.0 0.0 0.0 175-179 0.0 0.0 0.0 0.0 0.0 180-184 0.0 0.0 0.0 0.0 0.0 185-189 0.0 0.0 0.0 0.0 0.0 190-194 0.0 0.0 0.0 0.0 0.0 195-199 0.0 0.0 0.0 0.0 0.0 200-204 0.0 0.0 0.0 0.0 0.0 205-209 0.0 0.0 0.0 0.0 0.0 210-214 0.0 0.0 0.0 0.0 0.0 215-219 0.0 0.0 0.0 0.0 0.0 220-224 0.0 0.0 0.0 0.0 0.0 225-229 0.0 0.0 0.0 0.0 0.0 230-234 0.0 0.0 0.0 0.0 0.0 235-237 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAACTAC 5 0.0016419168 1934.25 170-173 AACTACG 5 0.0016419168 1934.25 170-173 GATAATA 5 0.0027362923 1547.4 165-169 ATAATAA 5 0.0027362923 1547.4 165-169 TAATAAC 5 0.0027362923 1547.4 165-169 GACTTCC 5 0.0027362923 1547.4 150-154 CCAAATG 5 0.004104085 1289.5 160-164 AACCAAA 5 0.004104085 1289.5 160-164 CCTGATA 5 0.007659638 967.125 160-164 ACCAAAT 10 0.006566535 967.125 160-164 CTGATAA 5 0.007659638 967.125 160-164 TGATAAT 5 0.007659638 967.125 160-164 TGCCTTC 5 0.007659638 967.125 145-149 CTACGAC 10 0.006566535 967.125 170-173 TCCTGAT 5 0.007659638 967.125 160-164 ACTACGA 10 0.006566535 967.125 170-173 AGAACTA 5 0.009847257 859.6667 155-159 GAACTAG 5 0.009847257 859.6667 155-159 >>END_MODULE Read 363740 spots for ERR1806560.sra Written 363740 spots for ERR1806560.sra Read 363740 spots for ERR1806560.sra Written 363740 spots for ERR1806560.sra Read 363740 spots for ERR1806560.sra Written 363740 spots for ERR1806560.sra Read 363740 spots for ERR1806560.sra Written 363740 spots for ERR1806560.sra Read 363740 spots for ERR1806560.sra Written 363740 spots for ERR1806560.sra Read 363740 spots for ERR1806560.sra Written 363740 spots for ERR1806560.sra Read 363740 spots for ERR1806560.sra Written 363740 spots for ERR1806560.sra Read 363740 spots for ERR1806560.sra Written 363740 spots for ERR1806560.sra Read 363740 spots for ERR1806560.sra Written 363740 spots for ERR1806560.sra Read 363740 spots for ERR1806560.sra Written 363740 spots for ERR1806560.sra Read 363740 spots for ERR1806560.sra Written 363740 spots for ERR1806560.sra Read 363740 spots for ERR1806560.sra Written 363740 spots for ERR1806560.sra Read 363740 spots for ERR1806560.sra Written 363740 spots for ERR1806560.sra Read 363740 spots for ERR1806560.sra Written 363740 spots for ERR1806560.sra Read 363740 spots for ERR1806560.sra Written 363740 spots for ERR1806560.sra Read 363756 spots for ERR1806560.sra Written 363756 spots for ERR1806560.sra Read 363740 spots for ERR1806560.sra Written 363740 spots for ERR1806560.sra Read 363740 spots for ERR1806560.sra Written 363740 spots for ERR1806560.sra Read 363740 spots for ERR1806560.sra Written 363740 spots for ERR1806560.sra Read 363740 spots for ERR1806560.sra Written 363740 spots for ERR1806560.sra SRR ids: ['ERR1806560.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lxnum5ah ERR1806560.sra spots: 7274816 blocks: [[1, 363740], [363741, 727480], [727481, 1091220], [1091221, 1454960], [1454961, 1818700], [1818701, 2182440], [2182441, 2546180], [2546181, 2909920], [2909921, 3273660], [3273661, 3637400], [3637401, 4001140], [4001141, 4364880], [4364881, 4728620], [4728621, 5092360], [5092361, 5456100], [5456101, 5819840], [5819841, 6183580], [6183581, 6547320], [6547321, 6911060], [6911061, 7274816]] ERR1806560 file size 1827795 ERR1806560 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1806560 ERR1806560_1.fastq Input file: ERR1806560_1.fastq trimmed: ERR1806560-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 16:28:47 2024 >> started Mon Dec 9 16:28:51 2024 >> done (4.079s) 7274816 reads processed; of these: 129096 ( 1.77%) short reads filtered out after trimming by size control 5 ( 0.00%) empty reads filtered out after trimming by size control 7145715 (98.23%) reads available; of these: 128058 ( 1.79%) trimmed reads available after processing 7017657 (98.21%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 12554 0.18% 19 12154 0.17% 20 11815 0.17% 21 11792 0.17% 22 11675 0.16% 23 11523 0.16% 24 12991 0.18% 25 11755 0.16% 26 11666 0.16% 27 12087 0.17% 28 12134 0.17% 29 12075 0.17% 30 12733 0.18% 31 12631 0.18% 32 12867 0.18% 33 13420 0.19% 34 13436 0.19% 35 13434 0.19% 36 14093 0.20% 37 13739 0.19% 38 13922 0.19% 39 14566 0.20% 40 14846 0.21% 41 14983 0.21% 42 16432 0.23% 43 16276 0.23% 44 16511 0.23% 45 17578 0.25% 46 17807 0.25% 47 17991 0.25% 48 19457 0.27% 49 19892 0.28% 50 20445 0.29% 51 21870 0.31% 52 22331 0.31% 53 23115 0.32% 54 24731 0.35% 55 25547 0.36% 56 26528 0.37% 57 28501 0.40% 58 28976 0.41% 59 30716 0.43% 60 32821 0.46% 61 34134 0.48% 62 34242 0.48% 63 38472 0.54% 64 37442 0.52% 65 38764 0.54% 66 40521 0.57% 67 40983 0.57% 68 43163 0.60% 69 45205 0.63% 70 45945 0.64% 71 47356 0.66% 72 49510 0.69% 73 48512 0.68% 74 52001 0.73% 75 52208 0.73% 76 53346 0.75% 77 58630 0.82% 78 61082 0.85% 79 56731 0.79% 80 57146 0.80% 81 59150 0.83% 82 63444 0.89% 83 61351 0.86% 84 63418 0.89% 85 64179 0.90% 86 62546 0.88% 87 66267 0.93% 88 67203 0.94% 89 68193 0.95% 90 73545 1.03% 91 69104 0.97% 92 69266 0.97% 93 75233 1.05% 94 71311 1.00% 95 70854 0.99% 96 73315 1.03% 97 71536 1.00% 98 72747 1.02% 99 75002 1.05% 100 74420 1.04% 101 75623 1.06% 102 76086 1.06% 103 82854 1.16% 104 74305 1.04% 105 74544 1.04% 106 72509 1.01% 107 73780 1.03% 108 74639 1.04% 109 77561 1.09% 110 73507 1.03% 111 73625 1.03% 112 75779 1.06% 113 71074 0.99% 114 74481 1.04% 115 72434 1.01% 116 70732 0.99% 117 71160 1.00% 118 68736 0.96% 119 68011 0.95% 120 69613 0.97% 121 66139 0.93% 122 65677 0.92% 123 65242 0.91% 124 63336 0.89% 125 61584 0.86% 126 62505 0.87% 127 60931 0.85% 128 59523 0.83% 129 61393 0.86% 130 59155 0.83% 131 56579 0.79% 132 57111 0.80% 133 56368 0.79% 134 55724 0.78% 135 54225 0.76% 136 51185 0.72% 137 50230 0.70% 138 51493 0.72% 139 49428 0.69% 140 48103 0.67% 141 46688 0.65% 142 45379 0.64% 143 43833 0.61% 144 43905 0.61% 145 42164 0.59% 146 40962 0.57% 147 41922 0.59% 148 39618 0.55% 149 37661 0.53% 150 37900 0.53% 151 36151 0.51% 152 35177 0.49% 153 34757 0.49% 154 33831 0.47% 155 33007 0.46% 156 31780 0.44% 157 31178 0.44% 158 29114 0.41% 159 28863 0.40% 160 28267 0.40% 161 27559 0.39% 162 26786 0.37% 163 25942 0.36% 164 25182 0.35% 165 24286 0.34% 166 23190 0.32% 167 23200 0.32% 168 22239 0.31% 169 21503 0.30% 170 20683 0.29% 171 20008 0.28% 172 19645 0.27% 173 18721 0.26% 174 18161 0.25% 175 17349 0.24% 176 16957 0.24% 177 16249 0.23% 178 15635 0.22% 179 14773 0.21% 180 14454 0.20% 181 14055 0.20% 182 13539 0.19% 183 12896 0.18% 184 12583 0.18% 185 12014 0.17% 186 11530 0.16% 187 11168 0.16% 188 11122 0.16% 189 10627 0.15% 190 10257 0.14% 191 9735 0.14% 192 9385 0.13% 193 9030 0.13% 194 8679 0.12% 195 8204 0.11% 196 7856 0.11% 197 7708 0.11% 198 7306 0.10% 199 6930 0.10% 200 6721 0.09% 201 6466 0.09% 202 6158 0.09% 203 5804 0.08% 204 5520 0.08% 205 5455 0.08% 206 5278 0.07% 207 4962 0.07% 208 4593 0.06% 209 4556 0.06% 210 4353 0.06% 211 3900 0.05% 212 3887 0.05% 213 3603 0.05% 214 3422 0.05% 215 3281 0.05% 216 3044 0.04% 217 2899 0.04% 218 2759 0.04% 219 2673 0.04% 220 2469 0.03% 221 2386 0.03% 222 2310 0.03% 223 2052 0.03% 224 2027 0.03% 225 1834 0.03% 226 1768 0.02% 227 1625 0.02% 228 1513 0.02% 229 1412 0.02% 230 1359 0.02% 231 1168 0.02% 232 1087 0.02% 233 1075 0.02% 234 980 0.01% 235 894 0.01% 236 828 0.01% 237 755 0.01% 238 745 0.01% 239 671 0.01% 240 674 0.01% 241 580 0.01% 242 510 0.01% 243 522 0.01% 244 470 0.01% 245 474 0.01% 246 395 0.01% 247 331 0.00% 248 338 0.00% 249 274 0.00% 250 269 0.00% 251 227 0.00% 252 219 0.00% 253 228 0.00% 254 205 0.00% 255 167 0.00% 256 151 0.00% 257 120 0.00% 258 136 0.00% 259 109 0.00% 260 85 0.00% 261 99 0.00% 262 89 0.00% 263 63 0.00% 264 80 0.00% 265 29 0.00% 266 46 0.00% 267 58 0.00% 268 42 0.00% 269 33 0.00% 270 31 0.00% 271 22 0.00% 272 22 0.00% 273 29 0.00% 274 16 0.00% 275 15 0.00% 276 16 0.00% 277 13 0.00% 278 8 0.00% 279 6 0.00% 280 6 0.00% 281 6 0.00% 282 3 0.00% 283 8 0.00% 284 4 0.00% 285 6 0.00% 286 1 0.00% 287 0 0.00% 288 1 0.00% 289 2 0.00% 290 0 0.00% 291 2 0.00% 292 1 0.00% 293 0 0.00% 294 0 0.00% 295 0 0.00% 296 0 0.00% 297 0 0.00% 298 0 0.00% 299 0 0.00% 300 1 0.00% 301 0 0.00% 302 0 0.00% 303 0 0.00% 304 0 0.00% 305 0 0.00% 306 0 0.00% 307 0 0.00% 308 0 0.00% 309 0 0.00% 310 0 0.00% 311 0 0.00% 312 0 0.00% 313 0 0.00% 314 1 0.00% 7145715 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=5.96 fanout-score-rank=21 prefix-density=0.34 prefix-fanout=4.4 sequence=GGCAAGACCATCAC criterion=fanout-score sequence-density=0.05 sequence-density-rank=22 fanout-score=105.27 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=13.6 sequence=GACAAGAAGAAAGCCTCTGTCTTCTTCAAGACTTCTGCTGATGGACACATCTCATGTGCTAAGGAGATGACAAAGGTCTCTGGTATCTCTGAAATCATCCCGGAGATGGAGGTCTGTGACTTCGACTTTGAGCCCTGCGGCTACTCCATGAACGCCATCCATGGATCTGCGTTCTCTACAATCCATGTGACCCCTGAGGACGGCTTCAGCTATGCCAGCTACGAAGTCATGGGCATCGACGCTTCTGCCTTGCCTATGGCGACCTTGTCAAGAGGGTCCTCAGGTGCTTTGGCCCATCAGAGTTCTCTGTTGCTGTCACCATCTT Started job on | Dec 09 16:29:11 Started mapping on | Dec 09 16:29:11 Finished on | Dec 09 16:29:30 Mapping speed, Million of reads per hour | 1353.92 Number of input reads | 7145715 Average input read length | 109 UNIQUE READS: Uniquely mapped reads number | 5633084 Uniquely mapped reads % | 78.83% Average mapped length | 101.75 Number of splices: Total | 1953376 Number of splices: Annotated (sjdb) | 1837776 Number of splices: GT/AG | 1908427 Number of splices: GC/AG | 22662 Number of splices: AT/AC | 1570 Number of splices: Non-canonical | 20717 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.17% Deletion average length | 1.10 Insertion rate per base | 0.15% Insertion average length | 1.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 167389 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 105424 % of reads mapped to too many loci | 1.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 16.99% % of reads unmapped: other | 0.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1345242 1345242 1345242 N_multimapping 167389 167389 167389 N_noFeature 162438 208123 5505626 N_ambiguous 93724 12387 552 UnstrandedReadsAssigned:5376922 PositiveStrandReadsAssigned:5412574 NegativeStrandReadsAssigned:126906 Dataset is classified positive stranded MeadianReadLen=108 20thPercentileLength=77 echo kmer=73 ERR1806560 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR1806560-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,145,715 reads, 5,717,714 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,060 rounds 52973 ERR1806560.ke.tsv 35125 ERR1806560.se.tsv 88098 total ==> ERR1806560.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 108.347 34.0829 PNS24247 1044 945 17.5 4.87585 PNS24249 1928 1829 43.217 6.22136 PNS24246 1044 945 17.5 4.87585 PNS24248 1044 945 17.5 4.87585 PNS24244 1471 1372 80.9358 15.5321 PNS24243 293 194 0 0 KQK14069 1603 1504 851.479 149.063 KQK14071 474 375 40.572 28.4865 ==> ERR1806560.se.tsv <== BRADI_1g14170v3 920 BRADI_1g53295v3 62 BRADI_1g59795v3 87 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 591 BRADI_1g74790v3 130 BRADI_1g09890v3 0 BRADI_1g77505v3 148 BRADI_1g48960v3 0 ERR1806560 completed mapping pipeline successfully