Starting /dee2/code/volunteer_pipeline.sh ERR1806561 current disk space = 1523277819904 free memory = 1604793672 ERR1806561 SRAfilesize 4f88295be0160b45f1738ede7842352d ERR1806561.sra ERR1806561.sra file validated ERR1806561 is single end ERR1806561 is conventional basespace ERR1806561 read1 length is 8-225 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1806561_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 8-225 %GC 52 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.46025 26.0 22.0 27.0 20.0 28.0 2 24.13175 26.0 22.0 27.0 18.0 28.0 3 23.89325 25.0 21.0 27.0 18.0 28.0 4 24.02425 26.0 22.0 27.0 17.0 28.0 5 23.88225 25.0 21.0 27.0 17.0 28.0 6 23.81 25.0 21.0 27.0 17.0 28.0 7 23.905 25.0 21.0 27.0 17.0 29.0 8 23.74175 25.0 21.0 27.0 16.0 29.0 9 23.796291656226508 25.0 21.0 27.0 17.0 28.0 10-14 23.81828495088171 25.0 21.0 27.0 17.2 28.6 15-19 23.935777671401503 25.4 21.0 27.0 17.8 28.0 20-24 23.95477783841128 25.6 21.0 27.0 18.0 28.0 25-29 23.963489093388358 25.0 21.2 27.0 18.0 28.0 30-34 23.872553937166686 25.0 21.0 27.0 18.0 28.0 35-39 23.87970372801882 25.0 21.0 27.0 18.0 28.0 40-44 23.945867352860375 25.0 21.2 27.0 18.0 28.0 45-49 23.933963184593345 25.0 21.0 27.0 18.0 28.0 50-54 23.950265100191707 25.0 21.2 27.0 18.4 28.0 55-59 23.981518684362452 25.0 21.4 27.0 18.2 28.0 60-64 23.89883310631205 25.0 21.0 27.0 18.0 28.0 65-69 23.900478966949972 25.0 21.2 27.0 18.0 28.0 70-74 23.863936356378662 25.0 21.0 27.0 18.0 28.0 75-79 23.82639233942209 25.0 21.0 27.0 18.0 28.0 80-84 23.802096101663125 25.0 21.0 27.0 18.0 28.0 85-89 23.668386140270535 25.0 21.0 27.0 17.8 28.0 90-94 23.585755120773136 25.0 21.0 26.8 17.4 28.0 95-99 23.573873520706538 25.0 21.0 26.8 17.8 28.0 100-104 23.4178097422468 24.8 21.0 26.0 17.6 27.4 105-109 23.28589952210698 24.8 20.4 26.0 17.2 27.0 110-114 23.110257821528318 24.4 20.6 26.0 16.8 27.0 115-119 23.254032356986784 24.6 20.6 26.0 17.4 27.0 120-124 23.075406969949313 24.0 20.8 26.0 17.6 27.0 125-129 23.025753415367525 24.2 20.4 26.0 17.2 27.0 130-134 22.83959895306063 24.0 20.2 26.0 16.6 27.0 135-139 22.786052277528533 24.0 20.2 26.0 16.4 27.0 140-144 22.57602519384165 23.4 20.2 26.0 16.2 27.0 145-149 22.239128200342986 23.2 19.6 25.6 15.4 27.0 150-154 22.26326495175986 23.2 19.8 25.6 15.2 26.6 155-159 21.470648415453088 22.0 18.6 25.4 13.6 26.4 160-164 21.078588411129047 NaN NaN NaN NaN NaN 165-169 20.98912425383049 NaN NaN NaN NaN NaN 170-174 21.163382407601752 NaN NaN NaN NaN NaN 175-179 21.279081580793523 NaN NaN NaN NaN NaN 180-184 20.976098359005338 NaN NaN NaN NaN NaN 185-189 21.761232573877738 NaN NaN NaN NaN NaN 190-194 20.094736842105263 NaN NaN NaN NaN NaN 195-199 19.272649572649573 NaN NaN NaN NaN NaN 200-204 20.234102564102564 NaN NaN NaN NaN NaN 205-209 19.52777777777778 NaN NaN NaN NaN NaN 210-214 17.1 NaN NaN NaN NaN NaN 215-219 15.333333333333332 NaN NaN NaN NaN NaN 220-224 16.9 NaN NaN NaN NaN NaN 225 18.0 NaN NaN NaN NaN NaN >>END_MODULE >>Per sequence quality scores warn #Quality Count 11 3.0 12 4.0 13 8.0 14 23.0 15 22.0 16 39.0 17 77.0 18 100.0 19 125.0 20 148.0 21 207.0 22 307.0 23 487.0 24 1004.0 25 1161.0 26 277.0 27 8.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.374999999999996 41.725 17.2 15.7 2 42.425000000000004 35.225 5.6000000000000005 16.75 3 30.95 32.175 18.875 18.0 4 37.075 27.575 15.875 19.475 5 28.475 27.400000000000002 17.0 27.125 6 26.625 28.249999999999996 18.625 26.5 7 23.200000000000003 31.3 24.75 20.75 8 24.8 26.125 23.849999999999998 25.224999999999998 9 26.083688298672016 22.37534452518166 22.92658481583563 28.614382360310696 10-14 26.57201832552988 24.774706741177063 23.868499219654634 24.784775713638425 15-19 27.915752970574736 24.417359375796828 23.014942118415014 24.651945535213425 20-24 27.425007731161738 24.82218328007422 22.435831357592 25.316977631172044 25-29 26.84595300261097 25.09138381201044 23.174934725848566 24.887728459530027 30-34 28.243666684369856 23.745286526103353 22.959264963619948 25.051781825906843 35-39 27.633438417219264 24.2091531688227 22.785085335362538 25.3723230785955 40-44 26.468945487042 24.966487935656836 23.29088471849866 25.273681858802505 45-49 27.074892927422155 24.36045838638731 23.746961453871975 24.817687232318555 50-54 26.810673443456164 23.428329400375144 23.97894354692322 25.782053609245477 55-59 26.188958306770367 23.658039015682775 23.957669259212036 26.19533341833482 60-64 26.82177947598253 23.51937772925764 23.92194323144105 25.736899563318776 65-69 27.09166296460832 24.011550422034652 23.596919887457428 25.2998667258996 70-74 26.695292878554643 24.45920764805963 24.078425018228955 24.767074455156767 75-79 26.277505000909258 25.186397526823058 23.613384251682124 24.92271322058556 80-84 26.393476465730803 23.534269199009085 24.938067712634187 25.134186622625933 85-89 26.870102113512228 23.97292804559487 24.174780337212063 24.982189503680836 90-94 26.574394463667822 23.889273356401382 24.13840830449827 25.397923875432525 95-99 25.563300372831904 24.931107148646458 24.023342519046846 25.482249959474796 100-104 25.451688923802042 24.332285938727416 24.2930086410055 25.923016496465046 105-109 25.832349468713105 24.698937426210154 24.628099173553718 24.840613931523023 110-114 25.47410133031418 24.455137277101613 24.681573733371074 25.389187659213135 115-119 25.692253767963546 24.185068349106203 24.185068349106203 25.937609533824045 120-124 25.465313028764808 24.196277495769884 24.746192893401016 25.592216582064296 125-129 24.425574425574425 24.925074925074924 24.675324675324674 25.97402597402597 130-134 25.179425837320572 24.641148325358852 25.059808612440193 25.11961722488038 135-139 23.132704858593183 26.32342277012328 24.147933284989122 26.39593908629442 140-144 26.343154246100518 22.876949740034664 25.476603119584055 25.30329289428076 145-149 26.940133037694014 24.27937915742794 24.168514412416854 24.6119733924612 150-154 27.33612273361227 22.454672245467226 22.733612273361228 27.475592747559276 155-159 27.845884413309985 25.39404553415061 22.066549912434326 24.69352014010508 160-164 26.190476190476193 27.92207792207792 21.428571428571427 24.458874458874458 165-169 24.120603015075375 25.879396984924625 22.36180904522613 27.63819095477387 170-174 27.92207792207792 24.675324675324674 24.025974025974026 23.376623376623375 175-179 26.08695652173913 24.110671936758894 26.08695652173913 23.715415019762844 180-184 20.51282051282051 25.128205128205128 25.128205128205128 29.230769230769234 185-189 25.396825396825395 21.428571428571427 23.015873015873016 30.158730158730158 190-194 30.612244897959183 28.57142857142857 18.367346938775512 22.448979591836736 195-199 20.0 24.0 21.333333333333336 34.66666666666667 200-204 22.641509433962266 16.9811320754717 24.528301886792452 35.84905660377358 205-209 39.285714285714285 21.428571428571427 17.857142857142858 21.428571428571427 210-214 35.0 10.0 20.0 35.0 215-219 23.076923076923077 15.384615384615385 30.76923076923077 30.76923076923077 220-224 50.0 10.0 10.0 30.0 225 100.0 0.0 0.0 0.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 1.0 9 1.0 10 1.0 11 1.0 12 1.0 13 1.0 14 1.0 15 1.5 16 2.5 17 3.5 18 4.0 19 5.5 20 7.0 21 6.5 22 6.0 23 6.5 24 7.0 25 7.0 26 7.0 27 6.5 28 6.0 29 9.0 30 14.0 31 16.0 32 21.5 33 30.5 34 39.5 35 46.0 36 56.5 37 72.5 38 97.0 39 113.83333333333333 40 125.5 41 142.0 42 149.0 43 181.5 44 207.0 45 190.0 46 203.5 47 243.66666666666669 48 257.1666666666667 49 256.1666666666667 50 247.0 51 251.0 52 241.33333333333334 53 224.16666666666669 54 216.83333333333334 55 190.33333333333331 56 182.16666666666666 57 173.66666666666669 58 164.66666666666669 59 191.66666666666666 60 195.5 61 183.5 62 176.5 63 156.0 64 140.0 65 135.5 66 123.0 67 102.5 68 99.5 69 95.5 70 78.5 71 64.5 72 52.0 73 48.5 74 46.0 75 30.5 76 18.5 77 14.0 78 11.0 79 8.0 80 6.5 81 5.0 82 2.5 83 2.0 84 1.5 85 2.0 86 3.5 87 4.0 88 4.0 89 4.5 90 4.5 91 4.0 92 4.0 93 4.0 94 3.5 95 2.0 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-159 0.0 160-164 0.0 165-169 0.0 170-174 0.0 175-179 0.0 180-184 0.0 185-189 0.0 190-194 0.0 195-199 0.0 200-204 0.0 205-209 0.0 210-214 0.0 215-219 0.0 220-224 0.0 225 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 5-9 13.0 10-14 47.0 15-19 45.0 20-24 42.0 25-29 64.0 30-34 76.0 35-39 85.0 40-44 121.0 45-49 133.0 50-54 164.0 55-59 192.0 60-64 231.0 65-69 222.0 70-74 253.0 75-79 280.0 80-84 239.0 85-89 263.0 90-94 213.0 95-99 209.0 100-104 211.0 105-109 133.0 110-114 140.0 115-119 121.0 120-124 74.0 125-129 71.0 130-134 62.0 135-139 45.0 140-144 52.0 145-149 40.0 150-154 34.0 155-159 25.0 160-164 17.0 165-169 15.0 170-174 12.0 175-179 12.0 180-184 13.0 185-189 11.0 190-194 2.0 195-199 5.0 200-204 4.0 205-209 5.0 210-214 1.0 215-219 1.0 220-224 1.0 225-226 1.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.13617886178862 97.55 2 0.6859756097560976 1.35 3 0.07621951219512195 0.22499999999999998 4 0.025406504065040653 0.1 5 0.025406504065040653 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05081300813008131 0.65 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGATAATCATACCCCGTTCGAGGAGAGCAAGGCGATCGACATCAACCCGG 14 0.35000000000000003 No Hit ACTCCAAGATCATCAACGACAGGGAGACTGGCCGTTCCCGCGGGTTCGGC 12 0.3 No Hit ACCCAATCCTCTCGCCGACGCCGTAGCAACCTTTGAGAGAACGAGATCTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.0 0.0 0.0 0.0 0.0 80-84 0.0 0.0 0.0 0.0 0.0 85-89 0.0 0.0 0.0 0.0 0.0 90-94 0.0 0.0 0.0 0.0 0.0 95-99 0.0 0.0 0.0 0.0 0.0 100-104 0.0 0.0 0.0 0.0 0.0 105-109 0.0 0.0 0.0 0.0 0.0 110-114 0.0 0.0 0.0 0.0 0.0 115-119 0.0 0.0 0.0 0.0 0.0 120-124 0.0 0.0 0.0 0.0 0.0 125-129 0.0 0.0 0.0 0.0 0.0 130-134 0.0 0.0 0.0 0.0 0.0 135-139 0.0 0.0 0.0 0.0 0.0 140-144 0.0 0.0 0.0 0.0 0.0 145-149 0.0 0.0 0.0 0.0 0.0 150-154 0.0 0.0 0.0 0.0 0.0 155-159 0.0 0.0 0.0 0.0 0.0 160-164 0.0 0.0 0.0 0.0 0.0 165-169 0.0 0.0 0.0 0.0 0.0 170-174 0.0 0.0 0.0 0.0 0.0 175-179 0.0 0.0 0.0 0.0 0.0 180-184 0.0 0.0 0.0 0.0 0.0 185-189 0.0 0.0 0.0 0.0 0.0 190-194 0.0 0.0 0.0 0.0 0.0 195-199 0.0 0.0 0.0 0.0 0.0 200-204 0.0 0.0 0.0 0.0 0.0 205-209 0.0 0.0 0.0 0.0 0.0 210-213 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTGACC 5 0.0 6153.0 165 CGTCAGC 10 0.0017310361 1538.25 160-164 GAGATCA 10 0.0017310361 1538.25 160-164 AGATCAA 5 0.006488573 1025.5 160-164 >>END_MODULE Read 383438 spots for ERR1806561.sra Written 383438 spots for ERR1806561.sra Read 383438 spots for ERR1806561.sra Written 383438 spots for ERR1806561.sra Read 383438 spots for ERR1806561.sra Written 383438 spots for ERR1806561.sra Read 383438 spots for ERR1806561.sra Written 383438 spots for ERR1806561.sra Read 383438 spots for ERR1806561.sra Written 383438 spots for ERR1806561.sra Read 383438 spots for ERR1806561.sra Written 383438 spots for ERR1806561.sra Read 383438 spots for ERR1806561.sra Written 383438 spots for ERR1806561.sra Read 383438 spots for ERR1806561.sra Written 383438 spots for ERR1806561.sra Read 383438 spots for ERR1806561.sra Written 383438 spots for ERR1806561.sra Read 383438 spots for ERR1806561.sra Written 383438 spots for ERR1806561.sra Read 383438 spots for ERR1806561.sra Written 383438 spots for ERR1806561.sra Read 383438 spots for ERR1806561.sra Written 383438 spots for ERR1806561.sra Read 383438 spots for ERR1806561.sra Written 383438 spots for ERR1806561.sra Read 383438 spots for ERR1806561.sra Written 383438 spots for ERR1806561.sra Read 383456 spots for ERR1806561.sra Written 383456 spots for ERR1806561.sra Read 383438 spots for ERR1806561.sra Written 383438 spots for ERR1806561.sra Read 383438 spots for ERR1806561.sra Written 383438 spots for ERR1806561.sra Read 383438 spots for ERR1806561.sra Written 383438 spots for ERR1806561.sra Read 383438 spots for ERR1806561.sra Written 383438 spots for ERR1806561.sra Read 383438 spots for ERR1806561.sra Written 383438 spots for ERR1806561.sra SRR ids: ['ERR1806561.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v3bps2cr ERR1806561.sra spots: 7668778 blocks: [[1, 383438], [383439, 766876], [766877, 1150314], [1150315, 1533752], [1533753, 1917190], [1917191, 2300628], [2300629, 2684066], [2684067, 3067504], [3067505, 3450942], [3450943, 3834380], [3834381, 4217818], [4217819, 4601256], [4601257, 4984694], [4984695, 5368132], [5368133, 5751570], [5751571, 6135008], [6135009, 6518446], [6518447, 6901884], [6901885, 7285322], [7285323, 7668778]] ERR1806561 file size 1574733 ERR1806561 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1806561 ERR1806561_1.fastq Input file: ERR1806561_1.fastq trimmed: ERR1806561-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 16:41:05 2024 >> started Mon Dec 9 16:41:13 2024 >> done (8.092s) 7668778 reads processed; of these: 180274 ( 2.35%) short reads filtered out after trimming by size control 13 ( 0.00%) empty reads filtered out after trimming by size control 7488491 (97.65%) reads available; of these: 113702 ( 1.52%) trimmed reads available after processing 7374789 (98.48%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 18149 0.24% 19 17204 0.23% 20 17011 0.23% 21 17688 0.24% 22 17647 0.24% 23 17854 0.24% 24 19887 0.27% 25 19124 0.26% 26 20172 0.27% 27 21375 0.29% 28 21572 0.29% 29 22048 0.29% 30 24189 0.32% 31 23733 0.32% 32 24274 0.32% 33 26879 0.36% 34 27717 0.37% 35 28047 0.37% 36 30701 0.41% 37 29812 0.40% 38 31342 0.42% 39 36201 0.48% 40 34453 0.46% 41 36275 0.48% 42 45637 0.61% 43 40100 0.54% 44 41733 0.56% 45 46762 0.62% 46 46401 0.62% 47 47183 0.63% 48 52483 0.70% 49 53328 0.71% 50 54605 0.73% 51 59578 0.80% 52 60811 0.81% 53 61019 0.81% 54 66700 0.89% 55 68941 0.92% 56 69414 0.93% 57 72642 0.97% 58 73710 0.98% 59 77182 1.03% 60 83593 1.12% 61 85071 1.14% 62 83136 1.11% 63 90546 1.21% 64 88294 1.18% 65 87054 1.16% 66 91078 1.22% 67 90330 1.21% 68 91823 1.23% 69 96596 1.29% 70 94794 1.27% 71 94596 1.26% 72 99219 1.32% 73 94737 1.27% 74 96246 1.29% 75 97517 1.30% 76 96862 1.29% 77 104074 1.39% 78 106262 1.42% 79 96004 1.28% 80 94343 1.26% 81 94583 1.26% 82 99204 1.32% 83 94921 1.27% 84 93495 1.25% 85 90922 1.21% 86 88135 1.18% 87 88956 1.19% 88 88306 1.18% 89 88008 1.18% 90 90161 1.20% 91 83007 1.11% 92 82315 1.10% 93 87066 1.16% 94 80055 1.07% 95 78243 1.04% 96 79354 1.06% 97 74469 0.99% 98 73615 0.98% 99 73590 0.98% 100 72821 0.97% 101 70355 0.94% 102 69217 0.92% 103 78450 1.05% 104 65505 0.87% 105 63445 0.85% 106 59947 0.80% 107 58965 0.79% 108 58366 0.78% 109 58470 0.78% 110 55541 0.74% 111 55798 0.75% 112 54065 0.72% 113 50269 0.67% 114 50705 0.68% 115 47987 0.64% 116 46352 0.62% 117 45503 0.61% 118 43915 0.59% 119 42529 0.57% 120 41143 0.55% 121 39364 0.53% 122 37939 0.51% 123 36705 0.49% 124 35869 0.48% 125 34646 0.46% 126 33700 0.45% 127 32219 0.43% 128 30820 0.41% 129 30854 0.41% 130 28874 0.39% 131 27736 0.37% 132 27145 0.36% 133 26088 0.35% 134 25390 0.34% 135 24711 0.33% 136 23443 0.31% 137 22492 0.30% 138 22526 0.30% 139 21349 0.29% 140 20718 0.28% 141 19767 0.26% 142 18691 0.25% 143 17910 0.24% 144 17620 0.24% 145 17046 0.23% 146 16459 0.22% 147 15919 0.21% 148 15342 0.20% 149 14332 0.19% 150 14211 0.19% 151 13546 0.18% 152 13036 0.17% 153 12797 0.17% 154 12368 0.17% 155 11919 0.16% 156 11592 0.15% 157 11383 0.15% 158 10269 0.14% 159 10206 0.14% 160 9526 0.13% 161 9157 0.12% 162 9009 0.12% 163 8847 0.12% 164 8197 0.11% 165 7865 0.11% 166 7606 0.10% 167 7365 0.10% 168 6919 0.09% 169 6780 0.09% 170 6486 0.09% 171 6397 0.09% 172 6132 0.08% 173 5911 0.08% 174 5686 0.08% 175 5354 0.07% 176 5151 0.07% 177 4960 0.07% 178 4739 0.06% 179 4458 0.06% 180 4232 0.06% 181 4098 0.05% 182 4057 0.05% 183 3837 0.05% 184 3733 0.05% 185 3698 0.05% 186 3443 0.05% 187 3219 0.04% 188 3190 0.04% 189 2955 0.04% 190 2793 0.04% 191 2712 0.04% 192 2660 0.04% 193 2504 0.03% 194 2404 0.03% 195 2373 0.03% 196 2176 0.03% 197 2075 0.03% 198 2039 0.03% 199 1893 0.03% 200 1758 0.02% 201 1762 0.02% 202 1741 0.02% 203 1647 0.02% 204 1496 0.02% 205 1452 0.02% 206 1319 0.02% 207 1248 0.02% 208 1261 0.02% 209 1197 0.02% 210 1194 0.02% 211 1125 0.02% 212 1006 0.01% 213 964 0.01% 214 996 0.01% 215 896 0.01% 216 837 0.01% 217 773 0.01% 218 761 0.01% 219 707 0.01% 220 664 0.01% 221 610 0.01% 222 589 0.01% 223 525 0.01% 224 490 0.01% 225 472 0.01% 226 404 0.01% 227 423 0.01% 228 378 0.01% 229 357 0.00% 230 363 0.00% 231 320 0.00% 232 326 0.00% 233 268 0.00% 234 245 0.00% 235 237 0.00% 236 236 0.00% 237 208 0.00% 238 189 0.00% 239 144 0.00% 240 156 0.00% 241 134 0.00% 242 142 0.00% 243 133 0.00% 244 114 0.00% 245 123 0.00% 246 86 0.00% 247 89 0.00% 248 72 0.00% 249 61 0.00% 250 63 0.00% 251 64 0.00% 252 68 0.00% 253 54 0.00% 254 50 0.00% 255 47 0.00% 256 31 0.00% 257 23 0.00% 258 30 0.00% 259 20 0.00% 260 20 0.00% 261 16 0.00% 262 18 0.00% 263 17 0.00% 264 21 0.00% 265 14 0.00% 266 17 0.00% 267 11 0.00% 268 10 0.00% 269 5 0.00% 270 5 0.00% 271 4 0.00% 272 3 0.00% 273 7 0.00% 274 2 0.00% 275 2 0.00% 276 4 0.00% 277 1 0.00% 278 0 0.00% 279 4 0.00% 280 2 0.00% 281 1 0.00% 282 3 0.00% 283 2 0.00% 284 1 0.00% 285 1 0.00% 286 3 0.00% 287 0 0.00% 288 0 0.00% 289 0 0.00% 290 0 0.00% 291 0 0.00% 292 0 0.00% 293 0 0.00% 294 0 0.00% 295 0 0.00% 296 0 0.00% 297 0 0.00% 298 0 0.00% 299 0 0.00% 300 0 0.00% 301 1 0.00% 7488491 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=4.60 fanout-score-rank=23 prefix-density=0.27 prefix-fanout=3.8 sequence=GGCAAGACCATCACCCT criterion=fanout-score sequence-density=0.09 sequence-density-rank=7 fanout-score=50.78 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=12.3 sequence=GAGAAGAAGGAC Started job on | Dec 09 16:41:28 Started mapping on | Dec 09 16:41:28 Finished on | Dec 09 16:41:40 Mapping speed, Million of reads per hour | 2246.55 Number of input reads | 7488491 Average input read length | 85 UNIQUE READS: Uniquely mapped reads number | 5892833 Uniquely mapped reads % | 78.69% Average mapped length | 79.26 Number of splices: Total | 1536314 Number of splices: Annotated (sjdb) | 1445872 Number of splices: GT/AG | 1503481 Number of splices: GC/AG | 16950 Number of splices: AT/AC | 1236 Number of splices: Non-canonical | 14647 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.15% Deletion average length | 1.10 Insertion rate per base | 0.11% Insertion average length | 1.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 181707 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 185890 % of reads mapped to too many loci | 2.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 15.97% % of reads unmapped: other | 0.43% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1413951 1413951 1413951 N_multimapping 181707 181707 181707 N_noFeature 167789 217417 5761524 N_ambiguous 93387 12106 582 UnstrandedReadsAssigned:5631657 PositiveStrandReadsAssigned:5663310 NegativeStrandReadsAssigned:130727 Dataset is classified positive stranded MeadianReadLen=83 20thPercentileLength=58 echo kmer=53 ERR1806561 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR1806561-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,488,491 reads, 5,880,826 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 996 rounds 52973 ERR1806561.ke.tsv 35125 ERR1806561.se.tsv 88098 total ==> ERR1806561.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 100.942 30.417 PNS24247 1044 945 2.91667 0.778435 PNS24249 1928 1829 67.1644 9.26174 PNS24246 1044 945 2.91667 0.778435 PNS24248 1044 945 2.91667 0.778435 PNS24244 1471 1372 68.1432 12.5267 PNS24243 293 194 0 0 KQK14069 1603 1504 1068.86 179.242 KQK14071 474 375 146.066 98.2392 ==> ERR1806561.se.tsv <== BRADI_1g14170v3 1230 BRADI_1g53295v3 50 BRADI_1g59795v3 78 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 639 BRADI_1g74790v3 119 BRADI_1g09890v3 0 BRADI_1g77505v3 145 BRADI_1g48960v3 0 ERR1806561 completed mapping pipeline successfully