Starting /dee2/code/volunteer_pipeline.sh ERR1806562 current disk space = 1523313225728 free memory = 1605466172 ERR1806562 SRAfilesize c7b5bf1729fac0f82affcb389272b49a ERR1806562.sra ERR1806562.sra file validated ERR1806562 is single end ERR1806562 is conventional basespace ERR1806562 read1 length is 8-230 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1806562_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 8-230 %GC 51 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.06775 24.0 21.0 26.0 18.0 27.0 2 22.99425 24.0 20.0 26.0 16.0 28.0 3 22.589 24.0 20.0 26.0 14.0 28.0 4 22.97225 24.0 20.0 27.0 16.0 28.0 5 22.73725 24.0 20.0 26.0 15.0 28.0 6 22.86475 24.0 20.0 27.0 15.0 28.0 7 22.72225 24.0 20.0 27.0 15.0 28.0 8 22.87175 24.0 20.0 27.0 15.0 28.0 9 22.946787148594378 24.0 20.0 27.0 15.0 28.0 10-14 23.065878507011117 24.2 20.0 27.0 15.8 28.0 15-19 23.377820393563333 25.0 21.0 27.0 16.4 28.0 20-24 23.592764673460415 25.0 21.0 27.0 17.4 28.0 25-29 23.582689816893527 25.0 21.0 27.0 17.0 28.0 30-34 23.609196594381338 25.0 21.0 27.0 17.4 28.0 35-39 23.72125432989269 25.0 21.0 27.0 18.0 28.0 40-44 23.72617550201674 25.0 21.0 27.0 18.0 28.0 45-49 23.63473537202016 25.0 21.0 27.0 17.4 28.0 50-54 23.652549493648934 25.0 21.0 27.0 18.0 28.0 55-59 23.78456179658066 25.0 21.0 27.0 18.0 28.0 60-64 23.766509807898956 25.0 21.0 27.0 17.8 28.0 65-69 23.797583190441117 25.0 21.0 27.0 18.0 28.0 70-74 23.826294722770747 25.0 21.0 27.0 18.0 28.0 75-79 23.761818737200144 25.0 21.0 27.0 18.0 28.0 80-84 23.71611927848352 25.0 21.0 27.0 18.0 28.0 85-89 23.696226925676164 25.0 21.0 27.0 18.0 28.0 90-94 23.55583898059561 25.0 21.0 27.0 17.6 27.8 95-99 23.64340229529954 25.0 21.0 26.6 17.8 27.6 100-104 23.541373267976468 25.0 21.0 26.2 18.0 27.6 105-109 23.299289267555817 25.0 21.0 26.0 17.0 27.0 110-114 23.131922297925303 24.2 20.6 26.0 16.8 27.0 115-119 23.1928158007379 24.6 20.4 26.0 16.8 27.0 120-124 23.045483347743215 24.0 20.4 26.0 16.8 27.0 125-129 23.044349744245146 24.0 20.4 26.0 17.0 27.0 130-134 23.024682669983132 24.2 20.0 26.0 16.8 27.0 135-139 22.695096662421935 24.0 20.0 26.0 16.8 27.0 140-144 22.816314544865826 24.2 20.2 26.0 16.4 27.0 145-149 22.55267661500995 23.6 20.2 25.6 16.4 27.0 150-154 22.44518326007062 23.6 19.8 25.6 16.4 26.6 155-159 22.30136203041026 23.4 19.8 25.8 16.2 26.8 160-164 22.02040631491642 22.5 19.5 25.0 15.5 27.0 165-169 21.6189391980253 NaN NaN NaN NaN NaN 170-174 21.417623813472183 NaN NaN NaN NaN NaN 175-179 21.637040334024384 NaN NaN NaN NaN NaN 180-184 21.680114149416475 NaN NaN NaN NaN NaN 185-189 21.162067173023054 NaN NaN NaN NaN NaN 190-194 20.979555444555444 NaN NaN NaN NaN NaN 195-199 20.879346405228755 NaN NaN NaN NaN NaN 200-204 20.18992673992674 NaN NaN NaN NaN NaN 205-209 19.64171717171717 NaN NaN NaN NaN NaN 210-214 18.831349206349206 NaN NaN NaN NaN NaN 215-219 21.85 NaN NaN NaN NaN NaN 220-224 20.25 NaN NaN NaN NaN NaN 225-229 21.7 NaN NaN NaN NaN NaN 230 20.0 NaN NaN NaN NaN NaN >>END_MODULE >>Per sequence quality scores warn #Quality Count 10 3.0 11 5.0 12 11.0 13 18.0 14 23.0 15 37.0 16 92.0 17 123.0 18 139.0 19 149.0 20 163.0 21 226.0 22 374.0 23 592.0 24 937.0 25 916.0 26 188.0 27 3.0 28 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.724999999999998 45.300000000000004 15.85 13.125 2 40.175 36.5 6.675000000000001 16.650000000000002 3 30.475 32.25 18.85 18.425 4 37.425000000000004 28.199999999999996 15.174999999999999 19.2 5 28.999999999999996 27.85 16.45 26.700000000000003 6 26.8 27.950000000000003 19.950000000000003 25.3 7 23.575 30.575000000000003 22.775000000000002 23.075000000000003 8 25.174999999999997 24.85 23.65 26.325 9 24.92469879518072 23.694779116465863 23.19277108433735 28.187751004016064 10-14 26.62935639786314 24.395828033579242 23.63266344441618 25.342152124141435 15-19 27.37601162066819 24.927370823822372 22.701805353807845 24.994812201701595 20-24 27.96936889358331 24.573541061526274 22.59836282017428 24.858727224716134 25-29 26.600429645542427 24.731471535982813 22.87325456498389 25.79484425349087 30-34 26.8716430998575 24.24092951879864 23.32566041872191 25.561766962621945 35-39 27.16701308915229 24.302005505308692 22.538059659569686 25.992921745969326 40-44 27.327466419638725 24.641037517369153 23.29203334877258 24.739462714219545 45-49 26.863784174394794 23.708298205467905 23.64807900758762 25.779838612549682 50-54 27.02310314354248 24.289862391112234 23.563943946471404 25.12309051887388 55-59 26.756393001345895 23.950201884253026 23.438761776581426 25.85464333781965 60-64 26.93974859124404 24.013870827915042 23.927178153446032 25.11920242739489 65-69 26.671413877680195 24.139568003797766 23.11100561753303 26.078012500989 70-74 26.18310482087572 24.16629809818664 24.847412649270233 24.803184431667404 75-79 25.69548309901286 24.648519294047265 24.2795891913451 25.376408415594774 80-84 26.589728793998844 24.004616272360067 24.431621465666474 24.97403346797461 85-89 24.912845266827567 24.336283185840706 24.912845266827567 25.838026280504156 90-94 25.687500000000004 23.546875 25.359375 25.406250000000004 95-99 25.317604355716878 23.97459165154265 24.773139745916513 25.934664246823957 100-104 25.60488112770882 24.763307384809593 23.585104144750684 26.046707342730908 105-109 26.555609995100443 24.865262126408624 24.35080842724155 24.228319451249387 110-114 26.007005253940456 24.25569176882662 25.68593111500292 24.051371862230006 115-119 26.682692307692307 24.244505494505493 24.862637362637365 24.210164835164836 120-124 25.413473174667207 23.88059701492537 24.48567970956031 26.220250100847114 125-129 26.338851022395325 23.904576436222005 24.09931840311587 25.657254138266794 130-134 25.758477096966093 24.09280190362879 25.342058298631763 24.806662700773348 135-139 26.656955571740713 22.505462490895848 25.41879096868172 25.41879096868172 140-144 26.21527777777778 22.135416666666664 26.649305555555557 25.0 145-149 27.754677754677754 23.284823284823286 24.94802494802495 24.012474012474012 150-154 27.29528535980149 24.68982630272953 24.441687344913152 23.573200992555833 155-159 28.46153846153846 26.30769230769231 21.53846153846154 23.692307692307693 160-164 26.33663366336634 25.14851485148515 26.13861386138614 22.37623762376238 165-169 25.176470588235293 25.41176470588235 23.294117647058822 26.11764705882353 170-174 27.61627906976744 26.16279069767442 22.96511627906977 23.25581395348837 175-179 25.37313432835821 27.611940298507463 21.641791044776117 25.37313432835821 180-184 27.450980392156865 23.52941176470588 28.431372549019606 20.588235294117645 185-189 24.0 24.666666666666668 28.000000000000004 23.333333333333332 190-194 28.31858407079646 28.31858407079646 23.008849557522122 20.353982300884958 195-199 24.175824175824175 25.274725274725274 16.483516483516482 34.065934065934066 200-204 32.35294117647059 25.0 20.588235294117645 22.058823529411764 205-209 28.30188679245283 16.9811320754717 26.41509433962264 28.30188679245283 210-214 24.324324324324326 21.62162162162162 32.432432432432435 21.62162162162162 215-219 35.0 25.0 20.0 20.0 220-224 53.84615384615385 7.6923076923076925 15.384615384615385 23.076923076923077 225-229 40.0 10.0 40.0 10.0 230 100.0 0.0 0.0 0.0 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 1.0 6 1.0 7 1.0 8 1.0 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 2.5 20 3.5 21 4.0 22 5.5 23 8.0 24 10.0 25 12.5 26 16.5 27 17.5 28 21.0 29 26.5 30 29.0 31 31.5 32 38.0 33 44.5 34 48.0 35 55.0 36 66.0 37 86.0 38 105.33333333333334 39 120.0 40 136.5 41 153.0 42 171.50000000000003 43 205.00000000000003 44 237.33333333333334 45 255.66666666666666 46 261.3333333333333 47 266.33333333333337 48 277.6666666666667 49 269.0 50 254.0 51 245.5 52 248.83333333333334 53 250.5 54 238.66666666666669 55 221.5 56 212.33333333333334 57 204.66666666666669 58 199.33333333333334 59 206.0 60 199.5 61 184.0 62 175.0 63 159.5 64 139.5 65 136.5 66 134.5 67 123.5 68 112.5 69 102.5 70 90.0 71 85.0 72 79.0 73 64.5 74 54.0 75 45.0 76 37.5 77 23.0 78 11.5 79 8.0 80 6.5 81 5.0 82 4.0 83 4.5 84 5.5 85 5.0 86 4.0 87 3.0 88 1.5 89 1.0 90 1.0 91 1.0 92 1.0 93 1.0 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-159 0.0 160-164 0.0 165-169 0.0 170-174 0.0 175-179 0.0 180-184 0.0 185-189 0.0 190-194 0.0 195-199 0.0 200-204 0.0 205-209 0.0 210-214 0.0 215-219 0.0 220-224 0.0 225-229 0.0 230 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 5-9 29.0 10-14 81.0 15-19 77.0 20-24 63.0 25-29 71.0 30-34 82.0 35-39 94.0 40-44 126.0 45-49 129.0 50-54 195.0 55-59 195.0 60-64 220.0 65-69 279.0 70-74 234.0 75-79 287.0 80-84 265.0 85-89 206.0 90-94 198.0 95-99 161.0 100-104 142.0 105-109 133.0 110-114 111.0 115-119 87.0 120-124 89.0 125-129 89.0 130-134 62.0 135-139 47.0 140-144 44.0 145-149 32.0 150-154 30.0 155-159 33.0 160-164 16.0 165-169 20.0 170-174 14.0 175-179 14.0 180-184 11.0 185-189 8.0 190-194 6.0 195-199 5.0 200-204 3.0 205-209 3.0 210-214 5.0 215-219 0.0 220-224 2.0 225-229 1.0 230-231 1.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.13639827279654 97.575 2 0.5842011684023368 1.15 3 0.0762001524003048 0.22499999999999998 4 0.10160020320040639 0.4 5 0.025400050800101596 0.125 6 0.025400050800101596 0.15 7 0.025400050800101596 0.17500000000000002 8 0.025400050800101596 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACTCCAAGATCATCAACGACAGGGAGACTGGCCGTTCCCGCGGGTTCGGC 8 0.2 No Hit GGATAATCATACCCCGTTCGAGGAGAGCAAGGCGATCGACATCAACCCGG 7 0.17500000000000002 No Hit ATGGGGGCCGGCGATGCGTCCTGGCCGTATGCGGAACGGCTTTTGCTGGT 6 0.15 No Hit GGAGATGGAGGTCTGTGACTTCGACTTTGAGCCCTGCGGCTACTCCATGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.0 0.0 0.0 0.0 0.0 80-84 0.0 0.0 0.0 0.0 0.0 85-89 0.0 0.0 0.0 0.0 0.0 90-94 0.0 0.0 0.0 0.0 0.0 95-99 0.0 0.0 0.0 0.0 0.0 100-104 0.0 0.0 0.0 0.0 0.0 105-109 0.0 0.0 0.0 0.0 0.0 110-114 0.0 0.0 0.0 0.0 0.0 115-119 0.0 0.0 0.0 0.0 0.0 120-124 0.0 0.0 0.0 0.0 0.0 125-129 0.0 0.0 0.0 0.0 0.0 130-134 0.0 0.0 0.0 0.0 0.0 135-139 0.0 0.0 0.0 0.0 0.0 140-144 0.0 0.0 0.0 0.0 0.0 145-149 0.0 0.0 0.0 0.0 0.0 150-154 0.0 0.0 0.0 0.0 0.0 155-159 0.0 0.0 0.0 0.0 0.0 160-164 0.0 0.0 0.0 0.0 0.0 165-169 0.0 0.0 0.0 0.0 0.0 170-174 0.0 0.0 0.0 0.0 0.0 175-179 0.0 0.0 0.0 0.0 0.0 180-184 0.0 0.0 0.0 0.0 0.0 185-189 0.0 0.0 0.0 0.0 0.0 190-194 0.0 0.0 0.0 0.0 0.0 195-199 0.0 0.0 0.0 0.0 0.0 200-204 0.0 0.0 0.0 0.0 0.0 205-209 0.0 0.0 0.0 0.0 0.0 210-214 0.0 0.0 0.0 0.0 0.0 215-218 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGAGAA 10 0.0 2965.5 195-199 TACAGCA 10 0.0 2965.5 140-144 CGCTCAG 10 0.0 2965.5 160-164 AGCACAT 15 0.0 1977.0 165-169 TTGGCAC 5 0.0013971291 1977.0 200-202 ATTCTGG 5 0.0013971291 1977.0 130-134 AATTGGC 5 0.0013971291 1977.0 200-202 ATCCCGC 10 0.0018630483 1482.75 155-159 TTCACGG 10 0.0018630483 1482.75 190-194 GTATGTA 5 0.0046560504 1186.2 145-149 GGAGAAT 5 0.0046560504 1186.2 195-199 CATTGTA 5 0.0046560504 1186.2 145-149 AATCCCG 5 0.0046560504 1186.2 155-159 CAGCATT 5 0.0046560504 1186.2 140-144 CAGCACA 5 0.0046560504 1186.2 160-164 TCTAGAG 5 0.0046560504 1186.2 180-184 TTGTATG 5 0.0046560504 1186.2 145-149 AGTAGTT 5 0.0046560504 1186.2 185-189 ACATGAC 5 0.0046560504 1186.2 165-169 ACGTTGG 5 0.0046560504 1186.2 170-174 >>END_MODULE Read 226258 spots for ERR1806562.sra Written 226258 spots for ERR1806562.sra Read 226258 spots for ERR1806562.sra Written 226258 spots for ERR1806562.sra Read 226258 spots for ERR1806562.sra Written 226258 spots for ERR1806562.sra Read 226258 spots for ERR1806562.sra Written 226258 spots for ERR1806562.sra Read 226258 spots for ERR1806562.sra Written 226258 spots for ERR1806562.sra Read 226258 spots for ERR1806562.sra Written 226258 spots for ERR1806562.sra Read 226258 spots for ERR1806562.sra Written 226258 spots for ERR1806562.sra Read 226258 spots for ERR1806562.sra Written 226258 spots for ERR1806562.sra Read 226258 spots for ERR1806562.sra Written 226258 spots for ERR1806562.sra Read 226258 spots for ERR1806562.sra Written 226258 spots for ERR1806562.sra Read 226258 spots for ERR1806562.sra Written 226258 spots for ERR1806562.sra Read 226258 spots for ERR1806562.sra Written 226258 spots for ERR1806562.sra Read 226258 spots for ERR1806562.sra Written 226258 spots for ERR1806562.sra Read 226258 spots for ERR1806562.sra Written 226258 spots for ERR1806562.sra Read 226266 spots for ERR1806562.sra Written 226266 spots for ERR1806562.sra Read 226258 spots for ERR1806562.sra Written 226258 spots for ERR1806562.sra Read 226258 spots for ERR1806562.sra Written 226258 spots for ERR1806562.sra Read 226258 spots for ERR1806562.sra Written 226258 spots for ERR1806562.sra Read 226258 spots for ERR1806562.sra Written 226258 spots for ERR1806562.sra Read 226258 spots for ERR1806562.sra Written 226258 spots for ERR1806562.sra SRR ids: ['ERR1806562.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u1eife45 ERR1806562.sra spots: 4525168 blocks: [[1, 226258], [226259, 452516], [452517, 678774], [678775, 905032], [905033, 1131290], [1131291, 1357548], [1357549, 1583806], [1583807, 1810064], [1810065, 2036322], [2036323, 2262580], [2262581, 2488838], [2488839, 2715096], [2715097, 2941354], [2941355, 3167612], [3167613, 3393870], [3393871, 3620128], [3620129, 3846386], [3846387, 4072644], [4072645, 4298902], [4298903, 4525168]] ERR1806562 file size 879998 ERR1806562 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1806562 ERR1806562_1.fastq Input file: ERR1806562_1.fastq trimmed: ERR1806562-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 16:39:34 2024 >> started Mon Dec 9 16:39:36 2024 >> done (2.510s) 4525168 reads processed; of these: 206391 ( 4.56%) short reads filtered out after trimming by size control 24 ( 0.00%) empty reads filtered out after trimming by size control 4318753 (95.44%) reads available; of these: 70579 ( 1.63%) trimmed reads available after processing 4248174 (98.37%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 15774 0.37% 19 15292 0.35% 20 14309 0.33% 21 14450 0.33% 22 13849 0.32% 23 14081 0.33% 24 14841 0.34% 25 14055 0.33% 26 14697 0.34% 27 15558 0.36% 28 15509 0.36% 29 15918 0.37% 30 17352 0.40% 31 17289 0.40% 32 17362 0.40% 33 19199 0.44% 34 19720 0.46% 35 19716 0.46% 36 21204 0.49% 37 20714 0.48% 38 21760 0.50% 39 25161 0.58% 40 24049 0.56% 41 24971 0.58% 42 30725 0.71% 43 27704 0.64% 44 29061 0.67% 45 31786 0.74% 46 31738 0.73% 47 32728 0.76% 48 35967 0.83% 49 36333 0.84% 50 37096 0.86% 51 40038 0.93% 52 40582 0.94% 53 40516 0.94% 54 44610 1.03% 55 44849 1.04% 56 45678 1.06% 57 48745 1.13% 58 48127 1.11% 59 50075 1.16% 60 54052 1.25% 61 53882 1.25% 62 52622 1.22% 63 57275 1.33% 64 55459 1.28% 65 54547 1.26% 66 55513 1.29% 67 55475 1.28% 68 56218 1.30% 69 57639 1.33% 70 57753 1.34% 71 56846 1.32% 72 58466 1.35% 73 56338 1.30% 74 57034 1.32% 75 57457 1.33% 76 57248 1.33% 77 62872 1.46% 78 61442 1.42% 79 54607 1.26% 80 53637 1.24% 81 53809 1.25% 82 56600 1.31% 83 53654 1.24% 84 52380 1.21% 85 52095 1.21% 86 48388 1.12% 87 48850 1.13% 88 48924 1.13% 89 46679 1.08% 90 48292 1.12% 91 44927 1.04% 92 43577 1.01% 93 46497 1.08% 94 42234 0.98% 95 41191 0.95% 96 41162 0.95% 97 38476 0.89% 98 37918 0.88% 99 37880 0.88% 100 36920 0.85% 101 35498 0.82% 102 35276 0.82% 103 40940 0.95% 104 32564 0.75% 105 31743 0.74% 106 29916 0.69% 107 29367 0.68% 108 28507 0.66% 109 29073 0.67% 110 27127 0.63% 111 26691 0.62% 112 26471 0.61% 113 24532 0.57% 114 24769 0.57% 115 23747 0.55% 116 22612 0.52% 117 22221 0.51% 118 20947 0.49% 119 20255 0.47% 120 20027 0.46% 121 18634 0.43% 122 18554 0.43% 123 17763 0.41% 124 17208 0.40% 125 16598 0.38% 126 16011 0.37% 127 15546 0.36% 128 14771 0.34% 129 14902 0.35% 130 13924 0.32% 131 13468 0.31% 132 13016 0.30% 133 12940 0.30% 134 12578 0.29% 135 12012 0.28% 136 11259 0.26% 137 10966 0.25% 138 10826 0.25% 139 10314 0.24% 140 10236 0.24% 141 9525 0.22% 142 9054 0.21% 143 8721 0.20% 144 8801 0.20% 145 8254 0.19% 146 8055 0.19% 147 8003 0.19% 148 7486 0.17% 149 7120 0.16% 150 6853 0.16% 151 6611 0.15% 152 6405 0.15% 153 6405 0.15% 154 6066 0.14% 155 5993 0.14% 156 5657 0.13% 157 5680 0.13% 158 5207 0.12% 159 5019 0.12% 160 4888 0.11% 161 4624 0.11% 162 4601 0.11% 163 4395 0.10% 164 4211 0.10% 165 4110 0.10% 166 3829 0.09% 167 3726 0.09% 168 3667 0.08% 169 3517 0.08% 170 3409 0.08% 171 3220 0.07% 172 3277 0.08% 173 2950 0.07% 174 2927 0.07% 175 2700 0.06% 176 2633 0.06% 177 2619 0.06% 178 2420 0.06% 179 2338 0.05% 180 2309 0.05% 181 2242 0.05% 182 2077 0.05% 183 1979 0.05% 184 1863 0.04% 185 1761 0.04% 186 1755 0.04% 187 1701 0.04% 188 1596 0.04% 189 1620 0.04% 190 1523 0.04% 191 1534 0.04% 192 1475 0.03% 193 1349 0.03% 194 1292 0.03% 195 1230 0.03% 196 1168 0.03% 197 1210 0.03% 198 1046 0.02% 199 1013 0.02% 200 959 0.02% 201 914 0.02% 202 941 0.02% 203 902 0.02% 204 842 0.02% 205 810 0.02% 206 721 0.02% 207 712 0.02% 208 693 0.02% 209 684 0.02% 210 618 0.01% 211 592 0.01% 212 592 0.01% 213 516 0.01% 214 516 0.01% 215 518 0.01% 216 454 0.01% 217 461 0.01% 218 389 0.01% 219 352 0.01% 220 360 0.01% 221 325 0.01% 222 322 0.01% 223 291 0.01% 224 299 0.01% 225 285 0.01% 226 234 0.01% 227 223 0.01% 228 228 0.01% 229 209 0.00% 230 170 0.00% 231 172 0.00% 232 163 0.00% 233 139 0.00% 234 129 0.00% 235 130 0.00% 236 131 0.00% 237 84 0.00% 238 99 0.00% 239 102 0.00% 240 89 0.00% 241 69 0.00% 242 75 0.00% 243 65 0.00% 244 58 0.00% 245 52 0.00% 246 38 0.00% 247 59 0.00% 248 42 0.00% 249 49 0.00% 250 29 0.00% 251 31 0.00% 252 23 0.00% 253 33 0.00% 254 24 0.00% 255 19 0.00% 256 26 0.00% 257 8 0.00% 258 17 0.00% 259 17 0.00% 260 17 0.00% 261 12 0.00% 262 10 0.00% 263 7 0.00% 264 8 0.00% 265 8 0.00% 266 4 0.00% 267 5 0.00% 268 2 0.00% 269 4 0.00% 270 1 0.00% 271 1 0.00% 272 3 0.00% 273 3 0.00% 274 3 0.00% 275 2 0.00% 276 1 0.00% 277 2 0.00% 278 1 0.00% 279 1 0.00% 280 0 0.00% 281 0 0.00% 282 0 0.00% 283 0 0.00% 284 1 0.00% 285 0 0.00% 286 1 0.00% 287 0 0.00% 288 0 0.00% 289 0 0.00% 290 0 0.00% 291 0 0.00% 292 0 0.00% 293 0 0.00% 294 1 0.00% 4318753 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=4.31 fanout-score-rank=20 prefix-density=0.26 prefix-fanout=3.7 sequence=GGCAAGACCATCACCCTTGAGGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=47.98 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=5.0 sequence=GCTGGCAAGCCCTTCGTTGATGTCCTCAAGGAGAACAATGTCCTCCCTGGGATCAAGGTTGACAAGGGTACCATTGAGATTGCTGGAACTGACAAGGAGACCACCACCCAGGGCCATGATGACCTTGGCAAGCGC Started job on | Dec 09 16:40:06 Started mapping on | Dec 09 16:40:06 Finished on | Dec 09 16:40:39 Mapping speed, Million of reads per hour | 471.14 Number of input reads | 4318753 Average input read length | 81 UNIQUE READS: Uniquely mapped reads number | 3539400 Uniquely mapped reads % | 81.95% Average mapped length | 78.01 Number of splices: Total | 888936 Number of splices: Annotated (sjdb) | 835072 Number of splices: GT/AG | 870924 Number of splices: GC/AG | 9547 Number of splices: AT/AC | 686 Number of splices: Non-canonical | 7779 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.13% Deletion average length | 1.09 Insertion rate per base | 0.13% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 126767 % of reads mapped to multiple loci | 2.94% Number of reads mapped to too many loci | 72402 % of reads mapped to too many loci | 1.68% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.17% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 652586 652586 652586 N_multimapping 126767 126767 126767 N_noFeature 107856 142966 3453521 N_ambiguous 57768 7310 388 UnstrandedReadsAssigned:3373776 PositiveStrandReadsAssigned:3389124 NegativeStrandReadsAssigned:85491 Dataset is classified positive stranded MeadianReadLen=78 20thPercentileLength=54 echo kmer=49 ERR1806562 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR1806562-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,318,753 reads, 3,420,350 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,015 rounds 52973 ERR1806562.ke.tsv 35125 ERR1806562.se.tsv 88098 total ==> ERR1806562.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 54.3209 28.2814 PNS24247 1044 945 5.83333 2.68995 PNS24249 1928 1829 34.4045 8.19711 PNS24246 1044 945 5.83333 2.68995 PNS24248 1044 945 5.83333 2.68995 PNS24244 1471 1372 36.7746 11.6803 PNS24243 293 194 0 0 KQK14069 1603 1504 1072.61 310.78 KQK14071 474 375 67.0239 77.8857 ==> ERR1806562.se.tsv <== BRADI_1g14170v3 1195 BRADI_1g53295v3 33 BRADI_1g59795v3 56 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 362 BRADI_1g74790v3 78 BRADI_1g09890v3 0 BRADI_1g77505v3 82 BRADI_1g48960v3 0 ERR1806562 completed mapping pipeline successfully