Starting /dee2/code/volunteer_pipeline.sh ERR1806563 current disk space = 1523318018048 free memory = 1411790688 ERR1806563 SRAfilesize 7d101ccb926504238afc0879c657ce12 ERR1806563.sra ERR1806563.sra file validated ERR1806563 is single end ERR1806563 is conventional basespace ERR1806563 read1 length is 8-224 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1806563_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 8-224 %GC 50 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.779 24.0 21.0 26.0 18.0 27.0 2 22.87175 24.0 20.0 26.0 16.0 27.0 3 22.64075 24.0 20.0 26.0 15.0 27.0 4 22.6895 24.0 20.0 26.0 16.0 27.0 5 22.5805 24.0 20.0 26.0 15.0 27.0 6 22.56975 24.0 20.0 26.0 14.0 28.0 7 22.599 24.0 20.0 26.0 14.0 28.0 8 22.61075 24.0 20.0 26.0 14.0 28.0 9 22.653884711779448 24.0 20.0 26.0 15.0 28.0 10-14 22.744628522463728 24.0 20.0 26.0 15.6 28.0 15-19 23.105253041551485 24.2 20.4 26.2 16.0 28.0 20-24 23.406715369369415 25.0 21.0 26.8 16.8 28.0 25-29 23.359665722679637 25.0 21.0 26.6 16.8 28.0 30-34 23.39769693869861 24.8 21.0 26.4 17.0 28.0 35-39 23.341782035042833 25.0 20.8 26.0 17.0 28.0 40-44 23.338616739652302 25.0 21.0 26.0 17.0 28.0 45-49 23.370751707482277 25.0 21.0 26.0 17.0 28.0 50-54 23.258224298780004 24.6 20.8 26.0 17.0 27.2 55-59 23.27086753150207 25.0 20.6 26.0 17.0 28.0 60-64 23.31086649841391 24.8 20.8 26.0 17.0 27.4 65-69 23.345516584610998 25.0 21.0 26.0 17.0 27.4 70-74 23.25320540688051 25.0 20.6 26.0 17.0 27.8 75-79 23.242961062092004 24.4 21.0 26.0 17.0 27.6 80-84 23.066396479964553 24.2 20.0 26.0 17.0 27.0 85-89 22.921835733071386 24.0 20.0 26.0 16.6 27.0 90-94 22.861685197200707 24.0 20.0 26.0 16.0 27.0 95-99 22.996863738351724 24.0 20.4 26.0 17.0 27.0 100-104 22.918681331127452 24.0 20.0 26.0 17.0 27.0 105-109 22.733331279498024 24.0 20.0 26.0 16.4 27.0 110-114 22.715505546706584 23.8 20.2 26.0 16.2 27.0 115-119 22.507185621371374 23.6 19.8 26.0 15.8 27.0 120-124 22.55193220118125 23.6 20.0 26.0 15.8 27.0 125-129 22.366277450214707 23.4 19.8 25.8 15.8 27.0 130-134 22.262153705402532 23.0 19.8 25.2 16.0 26.8 135-139 21.80707992351669 22.6 19.4 25.0 14.4 26.4 140-144 21.866465062970907 22.4 19.2 25.0 15.2 26.6 145-149 21.563433803390883 21.75 18.75 25.25 15.25 26.75 150-154 21.461289060647676 NaN NaN NaN NaN NaN 155-159 20.91443141184714 NaN NaN NaN NaN NaN 160-164 20.390523442075168 NaN NaN NaN NaN NaN 165-169 19.860624273861358 NaN NaN NaN NaN NaN 170-174 19.869865900383143 NaN NaN NaN NaN NaN 175-179 20.399124871907482 NaN NaN NaN NaN NaN 180-184 19.58203007518797 NaN NaN NaN NaN NaN 185-189 17.89641456582633 NaN NaN NaN NaN NaN 190-194 18.822222222222223 NaN NaN NaN NaN NaN 195-199 19.742857142857144 NaN NaN NaN NaN NaN 200-204 18.080000000000002 NaN NaN NaN NaN NaN 205-209 18.1 NaN NaN NaN NaN NaN 210-214 17.5 NaN NaN NaN NaN NaN 215-219 18.4 NaN NaN NaN NaN NaN 220-224 14.4 NaN NaN NaN NaN NaN >>END_MODULE >>Per sequence quality scores warn #Quality Count 9 1.0 10 0.0 11 5.0 12 13.0 13 16.0 14 26.0 15 36.0 16 84.0 17 115.0 18 164.0 19 157.0 20 185.0 21 299.0 22 468.0 23 636.0 24 890.0 25 750.0 26 149.0 27 6.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.875 42.35 18.725 14.05 2 41.825 35.425000000000004 6.175 16.575 3 31.35 31.95 19.8 16.900000000000002 4 37.2 27.775 16.5 18.525 5 28.9 26.424999999999997 18.5 26.174999999999997 6 27.175 28.675 19.1 25.05 7 21.85 31.825 24.575 21.75 8 24.05 27.224999999999998 24.175 24.55 9 25.664160401002505 23.533834586466167 24.636591478696744 26.165413533834585 10-14 26.516569693903364 24.938021755628636 24.21958006577283 24.32582848469517 15-19 27.559828397167518 25.507830671421928 23.22840750503954 23.703933426371012 20-24 26.542429985260053 25.205306380290587 23.257527900610654 24.994735733838702 25-29 26.93752683555174 24.635036496350367 24.382782310004295 24.044654358093602 30-34 26.70182956980386 24.817317729795064 24.256908961046097 24.22394373935498 35-39 26.94919090188978 25.30270453773905 23.678850288559467 24.0692542718117 40-44 26.090030638699034 25.494932830544425 23.933537591326893 24.48149893942965 45-49 26.375876403797232 24.185642489297017 24.5641248371285 24.874356269777252 50-54 26.375091672778183 24.508300553370223 24.334955663710915 24.781652110140676 55-59 25.603373073567898 24.78191334690317 24.251235824367548 25.363477755161384 60-64 26.41342043713203 24.106782805064924 24.84877812726833 24.631018630534722 65-69 27.138321995464853 23.79138321995465 24.471655328798185 24.598639455782312 70-74 25.670459162941896 24.20763917106867 25.203169443315726 24.918732222673707 75-79 25.5949603359776 24.9066728884741 24.416705552963137 25.08166122258516 80-84 25.956247483559252 24.94967118507583 24.78861897731848 24.305462354046437 85-89 26.034564769303948 24.353892500396384 24.591723481845566 25.0198192484541 90-94 25.67283832792518 25.329261309410196 24.642107272380226 24.355793090284404 95-99 24.935972060535505 25.07566938300349 25.518044237485448 24.470314318975554 100-104 26.04546730283469 25.091215268032556 24.221161942183553 24.6421554869492 105-109 25.016767270288398 26.559356136820927 24.413145539906104 24.010731052984575 110-114 27.543931344503473 23.661626481405804 24.397221087045363 24.397221087045363 115-119 25.65922920892495 25.760649087221093 24.087221095334684 24.492900608519268 120-124 25.29976019184652 25.29976019184652 25.179856115107913 24.22062350119904 125-129 26.3353115727003 24.70326409495549 22.181008902077153 26.780415430267063 130-134 25.16370439663237 25.724976613657624 22.5444340505145 26.56688493919551 135-139 22.65717674970344 25.741399762752078 24.31791221826809 27.283511269276396 140-144 29.178885630498534 24.780058651026394 23.020527859237536 23.020527859237536 145-149 29.013539651837522 28.433268858800776 22.823984526112184 19.729206963249517 150-154 26.044226044226043 28.00982800982801 22.604422604422606 23.34152334152334 155-159 26.282051282051285 24.679487179487182 25.320512820512818 23.717948717948715 160-164 22.021660649819495 26.714801444043324 25.27075812274368 25.992779783393498 165-169 26.976744186046513 23.72093023255814 23.72093023255814 25.581395348837212 170-174 25.806451612903224 23.870967741935484 22.58064516129032 27.741935483870968 175-179 25.6198347107438 16.528925619834713 31.40495867768595 26.446280991735538 180-184 32.29166666666667 18.75 25.0 23.958333333333336 185-189 30.0 21.428571428571427 22.857142857142858 25.71428571428571 190-194 30.23255813953488 30.23255813953488 13.953488372093023 25.581395348837212 195-199 23.333333333333332 20.0 26.666666666666668 30.0 200-204 16.666666666666664 20.833333333333336 29.166666666666668 33.33333333333333 205-209 20.0 20.0 10.0 50.0 210-214 20.0 40.0 10.0 30.0 215-219 40.0 0.0 20.0 40.0 220-224 33.33333333333333 0.0 16.666666666666664 50.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 1.0 5 2.0 6 3.0 7 2.5 8 2.0 9 2.0 10 2.0 11 2.0 12 2.5 13 3.0 14 3.0 15 1.5 16 0.0 17 0.5 18 1.0 19 3.0 20 4.5 21 4.5 22 5.5 23 6.5 24 8.0 25 10.5 26 13.0 27 14.5 28 16.5 29 18.5 30 21.5 31 26.0 32 35.0 33 43.5 34 49.0 35 62.0 36 77.5 37 98.0 38 123.5 39 146.0 40 167.83333333333331 41 186.5 42 189.0 43 210.5 44 243.5 45 270.5 46 292.3333333333333 47 286.66666666666663 48 288.8333333333333 49 294.0 50 280.0 51 272.5 52 267.5 53 264.5 54 269.0 55 257.8333333333333 56 223.33333333333331 57 207.0 58 219.5 59 215.0 60 193.0 61 170.83333333333334 62 150.0 63 138.0 64 133.0 65 124.5 66 122.0 67 108.5 68 93.0 69 91.0 70 85.5 71 76.5 72 59.5 73 44.0 74 35.0 75 27.0 76 23.5 77 19.0 78 12.0 79 7.5 80 4.5 81 3.5 82 2.0 83 0.0 84 0.0 85 0.5 86 1.0 87 1.0 88 1.0 89 1.0 90 1.0 91 1.0 92 1.0 93 0.5 94 0.5 95 1.0 96 1.0 97 1.0 98 1.0 99 1.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-159 0.0 160-164 0.0 165-169 0.0 170-174 0.0 175-179 0.0 180-184 0.0 185-189 0.0 190-194 0.0 195-199 0.0 200-204 0.0 205-209 0.0 210-214 0.0 215-219 0.0 220-224 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 5-9 17.0 10-14 83.0 15-19 76.0 20-24 69.0 25-29 76.0 30-34 104.0 35-39 120.0 40-44 159.0 45-49 197.0 50-54 236.0 55-59 273.0 60-64 284.0 65-69 252.0 70-74 233.0 75-79 236.0 80-84 241.0 85-89 209.0 90-94 211.0 95-99 156.0 100-104 130.0 105-109 103.0 110-114 110.0 115-119 72.0 120-124 61.0 125-129 53.0 130-134 62.0 135-139 28.0 140-144 34.0 145-149 28.0 150-154 20.0 155-159 9.0 160-164 9.0 165-169 13.0 170-174 9.0 175-179 6.0 180-184 4.0 185-189 8.0 190-194 2.0 195-199 2.0 200-204 3.0 205-209 0.0 210-214 0.0 215-219 0.0 220-224 2.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29275069461985 98.275 2 0.5304369790351099 1.05 3 0.07577671129072998 0.22499999999999998 4 0.050517807527153326 0.2 5 0.050517807527153326 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATGGGGGCCGGCGATGCGTCCTGGCCGTATGCGGAACGGCTTTTGCTGGT 5 0.125 No Hit ACTCCAAGATCATCAACGACAGGGAGACTGGCCGTTCCCGCGGGTTCGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.0 0.0 0.0 0.0 0.0 80-84 0.0 0.0 0.0 0.0 0.0 85-89 0.0 0.0 0.0 0.0 0.0 90-94 0.0 0.0 0.0 0.0 0.0 95-99 0.0 0.0 0.0 0.0 0.0 100-104 0.0 0.0 0.0 0.0 0.0 105-109 0.0 0.0 0.0 0.0 0.0 110-114 0.0 0.0 0.0 0.0 0.0 115-119 0.0 0.0 0.0 0.0 0.0 120-124 0.0 0.0 0.0 0.0 0.0 125-129 0.0 0.0 0.0 0.0 0.0 130-134 0.0 0.0 0.0 0.0 0.0 135-139 0.0 0.0 0.0 0.0 0.0 140-144 0.0 0.0 0.0 0.0 0.0 145-149 0.0 0.0 0.0 0.0 0.0 150-154 0.0 0.0 0.0 0.0 0.0 155-159 0.0 0.0 0.0 0.0 0.0 160-164 0.0 0.0 0.0 0.0 0.0 165-169 0.0 0.0 0.0 0.0 0.0 170-174 0.0 0.0 0.0 0.0 0.0 175-179 0.0 0.0 0.0 0.0 0.0 180-184 0.0 0.0 0.0 0.0 0.0 185-189 0.0 0.0 0.0 0.0 0.0 190-194 0.0 0.0 0.0 0.0 0.0 195-199 0.0 0.0 0.0 0.0 0.0 200-204 0.0 0.0 0.0 0.0 0.0 205-209 0.0 0.0 0.0 0.0 0.0 210-212 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAATGG 10 0.0 2598.5 145-148 TTGTTGT 15 0.0 1732.3334 130-134 ATGGTGG 5 0.0036387679 1299.25 115-119 GAGTGTT 5 0.006063835 1039.4 125-129 TTGTAGT 5 0.006063835 1039.4 130-134 TAGTCAG 5 0.006063835 1039.4 135-139 CAGAGGA 5 0.006063835 1039.4 140-144 AGTGTTG 5 0.006063835 1039.4 125-129 TCAGAGG 5 0.006063835 1039.4 135-139 TGTAGTC 5 0.006063835 1039.4 130-134 AGGTCAA 5 0.006063835 1039.4 110-114 GTCAGAG 5 0.006063835 1039.4 135-139 GTAGTCA 5 0.006063835 1039.4 135-139 GTTGTAG 5 0.006063835 1039.4 130-134 GAGGAAA 10 0.0072775357 866.1666 140-144 AATGGAC 10 0.0072775357 866.1666 145-148 AGTCAGA 10 0.0072775357 866.1666 135-139 AAATGGA 20 0.009705871 649.625 145-148 >>END_MODULE Read 325458 spots for ERR1806563.sra Written 325458 spots for ERR1806563.sra Read 325458 spots for ERR1806563.sra Written 325458 spots for ERR1806563.sra Read 325458 spots for ERR1806563.sra Written 325458 spots for ERR1806563.sra Read 325458 spots for ERR1806563.sra Written 325458 spots for ERR1806563.sra Read 325458 spots for ERR1806563.sra Written 325458 spots for ERR1806563.sra Read 325458 spots for ERR1806563.sra Written 325458 spots for ERR1806563.sra Read 325458 spots for ERR1806563.sra Written 325458 spots for ERR1806563.sra Read 325458 spots for ERR1806563.sra Written 325458 spots for ERR1806563.sra Read 325458 spots for ERR1806563.sra Written 325458 spots for ERR1806563.sra Read 325458 spots for ERR1806563.sra Written 325458 spots for ERR1806563.sra Read 325458 spots for ERR1806563.sra Written 325458 spots for ERR1806563.sra Read 325458 spots for ERR1806563.sra Written 325458 spots for ERR1806563.sra Read 325458 spots for ERR1806563.sra Written 325458 spots for ERR1806563.sra Read 325458 spots for ERR1806563.sra Written 325458 spots for ERR1806563.sra Read 325458 spots for ERR1806563.sra Written 325458 spots for ERR1806563.sra Read 325458 spots for ERR1806563.sra Written 325458 spots for ERR1806563.sra Read 325458 spots for ERR1806563.sra Written 325458 spots for ERR1806563.sra Read 325458 spots for ERR1806563.sra Written 325458 spots for ERR1806563.sra Read 325458 spots for ERR1806563.sra Written 325458 spots for ERR1806563.sra Read 325473 spots for ERR1806563.sra Written 325473 spots for ERR1806563.sra SRR ids: ['ERR1806563.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_on5eujb_ ERR1806563.sra spots: 6509175 blocks: [[1, 325458], [325459, 650916], [650917, 976374], [976375, 1301832], [1301833, 1627290], [1627291, 1952748], [1952749, 2278206], [2278207, 2603664], [2603665, 2929122], [2929123, 3254580], [3254581, 3580038], [3580039, 3905496], [3905497, 4230954], [4230955, 4556412], [4556413, 4881870], [4881871, 5207328], [5207329, 5532786], [5532787, 5858244], [5858245, 6183702], [6183703, 6509175]] ERR1806563 file size 1209301 ERR1806563 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1806563 ERR1806563_1.fastq Input file: ERR1806563_1.fastq trimmed: ERR1806563-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 16:39:39 2024 >> started Mon Dec 9 16:39:54 2024 >> done (15.200s) 6509175 reads processed; of these: 283668 ( 4.36%) short reads filtered out after trimming by size control 33 ( 0.00%) empty reads filtered out after trimming by size control 6225474 (95.64%) reads available; of these: 94187 ( 1.51%) trimmed reads available after processing 6131287 (98.49%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 22364 0.36% 19 21281 0.34% 20 20924 0.34% 21 20900 0.34% 22 20765 0.33% 23 20970 0.34% 24 22885 0.37% 25 22215 0.36% 26 23368 0.38% 27 24861 0.40% 28 25666 0.41% 29 25749 0.41% 30 28666 0.46% 31 28206 0.45% 32 29634 0.48% 33 32599 0.52% 34 33862 0.54% 35 34475 0.55% 36 36778 0.59% 37 36323 0.58% 38 38619 0.62% 39 45334 0.73% 40 42584 0.68% 41 44491 0.71% 42 53124 0.85% 43 49412 0.79% 44 51009 0.82% 45 56003 0.90% 46 56468 0.91% 47 57547 0.92% 48 62277 1.00% 49 63837 1.03% 50 65049 1.04% 51 69894 1.12% 52 70580 1.13% 53 70321 1.13% 54 74845 1.20% 55 76511 1.23% 56 76533 1.23% 57 80614 1.29% 58 80347 1.29% 59 82809 1.33% 60 88401 1.42% 61 87702 1.41% 62 84625 1.36% 63 90534 1.45% 64 86533 1.39% 65 85170 1.37% 66 86561 1.39% 67 86039 1.38% 68 86893 1.40% 69 88843 1.43% 70 88336 1.42% 71 86434 1.39% 72 88903 1.43% 73 84427 1.36% 74 83587 1.34% 75 83978 1.35% 76 82050 1.32% 77 87464 1.40% 78 86082 1.38% 79 79919 1.28% 80 78024 1.25% 81 77027 1.24% 82 80216 1.29% 83 76051 1.22% 84 72642 1.17% 85 72106 1.16% 86 68200 1.10% 87 67331 1.08% 88 65686 1.06% 89 64180 1.03% 90 65435 1.05% 91 60948 0.98% 92 60472 0.97% 93 62223 1.00% 94 57023 0.92% 95 54747 0.88% 96 55223 0.89% 97 50865 0.82% 98 50037 0.80% 99 49051 0.79% 100 47859 0.77% 101 46547 0.75% 102 45405 0.73% 103 45678 0.73% 104 41926 0.67% 105 40950 0.66% 106 38771 0.62% 107 37676 0.61% 108 36863 0.59% 109 36460 0.59% 110 34242 0.55% 111 33381 0.54% 112 32647 0.52% 113 30459 0.49% 114 30295 0.49% 115 29258 0.47% 116 27453 0.44% 117 27074 0.43% 118 25926 0.42% 119 24923 0.40% 120 24306 0.39% 121 23317 0.37% 122 22429 0.36% 123 21731 0.35% 124 20748 0.33% 125 20036 0.32% 126 19475 0.31% 127 18498 0.30% 128 17871 0.29% 129 17404 0.28% 130 16710 0.27% 131 15824 0.25% 132 16066 0.26% 133 15084 0.24% 134 14672 0.24% 135 13733 0.22% 136 12890 0.21% 137 12733 0.20% 138 12412 0.20% 139 11813 0.19% 140 11864 0.19% 141 10985 0.18% 142 10257 0.16% 143 9844 0.16% 144 9556 0.15% 145 9131 0.15% 146 8492 0.14% 147 8562 0.14% 148 8028 0.13% 149 7751 0.12% 150 7627 0.12% 151 7369 0.12% 152 6848 0.11% 153 6669 0.11% 154 6575 0.11% 155 6352 0.10% 156 5823 0.09% 157 5737 0.09% 158 5199 0.08% 159 5070 0.08% 160 4837 0.08% 161 4745 0.08% 162 4383 0.07% 163 4261 0.07% 164 4155 0.07% 165 4069 0.07% 166 3759 0.06% 167 3648 0.06% 168 3456 0.06% 169 3262 0.05% 170 3170 0.05% 171 2917 0.05% 172 2818 0.05% 173 2635 0.04% 174 2446 0.04% 175 2409 0.04% 176 2320 0.04% 177 2211 0.04% 178 2052 0.03% 179 1914 0.03% 180 1893 0.03% 181 1789 0.03% 182 1634 0.03% 183 1573 0.03% 184 1521 0.02% 185 1427 0.02% 186 1330 0.02% 187 1295 0.02% 188 1210 0.02% 189 1112 0.02% 190 1083 0.02% 191 993 0.02% 192 976 0.02% 193 880 0.01% 194 884 0.01% 195 740 0.01% 196 742 0.01% 197 657 0.01% 198 673 0.01% 199 586 0.01% 200 559 0.01% 201 554 0.01% 202 462 0.01% 203 445 0.01% 204 440 0.01% 205 384 0.01% 206 331 0.01% 207 322 0.01% 208 289 0.00% 209 289 0.00% 210 305 0.00% 211 241 0.00% 212 230 0.00% 213 208 0.00% 214 199 0.00% 215 162 0.00% 216 149 0.00% 217 142 0.00% 218 161 0.00% 219 116 0.00% 220 119 0.00% 221 97 0.00% 222 77 0.00% 223 70 0.00% 224 75 0.00% 225 60 0.00% 226 70 0.00% 227 45 0.00% 228 50 0.00% 229 52 0.00% 230 42 0.00% 231 29 0.00% 232 27 0.00% 233 40 0.00% 234 27 0.00% 235 22 0.00% 236 21 0.00% 237 18 0.00% 238 18 0.00% 239 11 0.00% 240 11 0.00% 241 20 0.00% 242 10 0.00% 243 9 0.00% 244 10 0.00% 245 7 0.00% 246 3 0.00% 247 3 0.00% 248 4 0.00% 249 3 0.00% 250 3 0.00% 251 3 0.00% 252 3 0.00% 253 1 0.00% 254 1 0.00% 255 0 0.00% 256 0 0.00% 257 0 0.00% 258 0 0.00% 259 3 0.00% 260 1 0.00% 261 0 0.00% 262 1 0.00% 263 0 0.00% 264 0 0.00% 265 0 0.00% 266 0 0.00% 267 1 0.00% 268 0 0.00% 269 1 0.00% 270 1 0.00% 271 0 0.00% 272 1 0.00% 6225474 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=4.32 fanout-score-rank=23 prefix-density=0.20 prefix-fanout=3.7 sequence=GGCAAGACCATCAC criterion=fanout-score sequence-density=0.05 sequence-density-rank=26 fanout-score=117.70 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=11.9 sequence=AGAAGAAGGACCCAACCGGCGCCAAGGTCACCAAGC Started job on | Dec 09 16:41:48 Started mapping on | Dec 09 16:41:48 Finished on | Dec 09 16:42:49 Mapping speed, Million of reads per hour | 367.41 Number of input reads | 6225474 Average input read length | 76 UNIQUE READS: Uniquely mapped reads number | 5035386 Uniquely mapped reads % | 80.88% Average mapped length | 72.51 Number of splices: Total | 1188072 Number of splices: Annotated (sjdb) | 1119708 Number of splices: GT/AG | 1164267 Number of splices: GC/AG | 13096 Number of splices: AT/AC | 931 Number of splices: Non-canonical | 9778 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.13% Deletion average length | 1.08 Insertion rate per base | 0.17% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 199112 % of reads mapped to multiple loci | 3.20% Number of reads mapped to too many loci | 93772 % of reads mapped to too many loci | 1.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 14.16% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 990976 990976 990976 N_multimapping 199112 199112 199112 N_noFeature 167820 210981 4926238 N_ambiguous 75107 9437 543 UnstrandedReadsAssigned:4792459 PositiveStrandReadsAssigned:4814968 NegativeStrandReadsAssigned:108605 Dataset is classified positive stranded MeadianReadLen=73 20thPercentileLength=51 echo kmer=47 ERR1806563 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR1806563-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,225,474 reads, 4,890,256 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,003 rounds 52973 ERR1806563.ke.tsv 35125 ERR1806563.se.tsv 88098 total ==> ERR1806563.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 117.251 45.1443 PNS24247 1044 945 8.75 2.98393 PNS24249 1928 1829 16.0088 2.82069 PNS24246 1044 945 8.75 2.98393 PNS24248 1044 945 8.75 2.98393 PNS24244 1471 1372 67.4903 15.8525 PNS24243 293 194 0 0 KQK14069 1603 1504 1216.94 260.755 KQK14071 474 375 62.1794 53.4351 ==> ERR1806563.se.tsv <== BRADI_1g14170v3 1324 BRADI_1g53295v3 49 BRADI_1g59795v3 95 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 484 BRADI_1g74790v3 81 BRADI_1g09890v3 0 BRADI_1g77505v3 88 BRADI_1g48960v3 0 ERR1806563 completed mapping pipeline successfully