Starting /dee2/code/volunteer_pipeline.sh ERR1806564 current disk space = 1523309002752 free memory = 1581173316 ERR1806564 SRAfilesize 7c634948cc6677b475e8b0d9cfe303b2 ERR1806564.sra ERR1806564.sra file validated ERR1806564 is single end ERR1806564 is conventional basespace ERR1806564 read1 length is 8-233 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1806564_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 8-233 %GC 51 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.14475 24.0 21.0 26.0 18.0 27.0 2 23.16575 25.0 21.0 26.0 16.0 28.0 3 22.82175 24.0 20.0 26.0 16.0 27.0 4 23.0725 25.0 20.0 26.0 16.0 28.0 5 23.03 24.0 20.0 27.0 16.0 28.0 6 23.0475 25.0 20.0 27.0 16.0 28.0 7 22.96825 24.0 20.0 27.0 15.0 28.0 8 23.08325 25.0 20.0 27.0 16.0 28.0 9 23.146616541353385 25.0 20.0 27.0 16.0 28.0 10-14 23.19661607020367 25.0 20.0 27.0 16.0 28.0 15-19 23.329404180323202 25.0 20.6 27.0 16.4 28.0 20-24 23.55017545766792 25.0 21.0 27.0 17.0 28.0 25-29 23.614952916443038 25.0 21.0 27.0 17.2 28.0 30-34 23.59374163322322 25.0 21.0 27.0 17.0 28.0 35-39 23.615897517577896 25.0 21.0 27.0 17.2 28.0 40-44 23.684814363967895 25.0 21.0 27.0 17.4 28.0 45-49 23.67903079042713 25.0 21.0 27.0 17.6 28.0 50-54 23.708955588364315 25.0 21.0 27.0 17.8 28.0 55-59 23.723091668264587 25.0 21.0 27.0 18.0 28.0 60-64 23.687462942274458 25.0 21.0 27.0 18.0 28.0 65-69 23.74218139591867 25.0 21.0 27.0 18.0 28.0 70-74 23.771711666382565 25.0 21.0 27.0 18.0 28.0 75-79 23.732921164379977 25.0 21.0 27.0 18.0 28.0 80-84 23.749448968767364 25.0 21.0 27.0 18.0 28.0 85-89 23.735189318306922 25.0 21.0 27.0 18.2 28.0 90-94 23.579680254969258 25.0 21.0 27.0 17.0 28.0 95-99 23.598125005757737 25.0 21.0 26.2 18.0 27.8 100-104 23.57331781078981 25.0 21.0 26.2 18.0 27.2 105-109 23.274773994369117 25.0 20.4 26.0 17.0 27.4 110-114 23.417813655226176 25.0 21.0 26.0 17.6 27.0 115-119 23.469803840034288 25.0 21.0 26.0 17.6 27.4 120-124 23.481295360038423 25.0 20.8 26.0 17.6 27.2 125-129 23.33654927587013 25.0 21.0 26.0 16.8 27.0 130-134 23.04644507473697 24.2 20.2 26.0 16.8 27.0 135-139 22.872808238490485 23.8 20.2 26.0 16.4 27.2 140-144 22.60612739645857 24.0 20.0 26.0 16.4 27.0 145-149 22.645065005371666 23.6 20.0 25.6 16.8 27.0 150-154 22.35382962184989 23.0 20.0 25.6 16.8 27.0 155-159 21.758320369432006 22.6 19.2 25.0 14.6 26.0 160-164 21.57870240431188 22.4 19.2 24.8 14.6 26.2 165-169 21.760690359450876 NaN NaN NaN NaN NaN 170-174 21.87370009548137 NaN NaN NaN NaN NaN 175-179 21.963932451196605 NaN NaN NaN NaN NaN 180-184 21.021189726515814 NaN NaN NaN NaN NaN 185-189 19.787648956104103 NaN NaN NaN NaN NaN 190-194 20.672774327122152 NaN NaN NaN NaN NaN 195-199 19.786117467582002 NaN NaN NaN NaN NaN 200-204 20.89028637770898 NaN NaN NaN NaN NaN 205-209 19.707619047619048 NaN NaN NaN NaN NaN 210-214 20.59969696969697 NaN NaN NaN NaN NaN 215-219 19.060555555555556 NaN NaN NaN NaN NaN 220-224 18.7 NaN NaN NaN NaN NaN 225-229 14.2 NaN NaN NaN NaN NaN 230-233 13.0 NaN NaN NaN NaN NaN >>END_MODULE >>Per sequence quality scores warn #Quality Count 11 5.0 12 12.0 13 16.0 14 27.0 15 48.0 16 72.0 17 118.0 18 136.0 19 136.0 20 172.0 21 243.0 22 346.0 23 545.0 24 977.0 25 978.0 26 167.0 27 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.875 43.075 18.875 13.175 2 41.9 36.6 5.925 15.575 3 32.85 31.95 18.275 16.925 4 36.449999999999996 28.875 16.675 18.0 5 30.425 28.000000000000004 16.675 24.9 6 27.275 28.4 20.225 24.099999999999998 7 22.625 30.575000000000003 23.175 23.625 8 25.275 27.500000000000004 22.875 24.349999999999998 9 26.165413533834585 22.706766917293233 23.784461152882205 27.343358395989974 10-14 26.973917447455054 24.887313243859204 24.06685236768802 24.07191694099772 15-19 28.199308815185432 25.088977149636353 22.442874090885645 24.268839944292566 20-24 27.757112170587313 24.639807198616857 22.842772567716246 24.760308063079584 25-29 27.358890183204494 24.11839457799428 23.234141692258817 25.288573546542416 30-34 27.327456460976133 24.27434960223608 23.392818748656204 25.005375188131584 35-39 27.578082191780823 24.120547945205477 23.10684931506849 25.194520547945203 40-44 27.748808522567987 24.28371180263527 23.470703672553967 24.496776002242783 45-49 27.89988492520138 24.20023014959724 23.486766398158803 24.413118527042577 50-54 27.56341550553769 24.091937596760747 23.07371680362034 25.27093009408122 55-59 26.68084307961724 24.660704234160985 23.172180874351117 25.486271811870658 60-64 27.27878464818763 24.067164179104477 23.98720682302772 24.66684434968017 65-69 27.310165450473235 23.517086915685283 23.762733906509645 25.410013727331844 70-74 27.220245156188216 23.598260181890073 23.867141162514827 25.314353499406877 75-79 26.365082169994697 25.269482240678563 23.873475879130588 24.49195971019615 80-84 26.531021349102936 24.50636463866894 24.18562694196652 24.7769870702616 85-89 25.83931465617041 24.774253299374855 24.762676545496642 24.62375549895809 90-94 26.28748151136211 25.25211778943122 24.337770606427323 24.122630092779346 95-99 26.082148499210113 24.62875197472354 24.739336492890995 24.549763033175356 100-104 26.27723516153268 23.797896318557477 24.812171299774604 25.11269722013524 105-109 25.611382836816365 23.877278790573587 24.477545575811472 26.033792796798576 110-114 26.700052714812863 23.695308381655245 25.171323141802848 24.433315761729048 115-119 25.876095118898622 23.967459324155193 26.47058823529412 23.685857321652065 120-124 25.110456553755522 23.821796759941087 25.331369661266567 25.736377025036816 125-129 26.046304541406943 26.268922528940337 23.82012466607302 23.864648263579696 130-134 25.861126298523786 23.072717331875342 24.439584472389285 26.626571897211594 135-139 23.008849557522122 23.961878829135465 27.43362831858407 25.59564329475834 140-144 25.700164744645797 23.97034596375618 26.523887973640857 23.805601317957166 145-149 25.64366632337796 24.81977342945417 23.583934088568487 25.952626158599383 150-154 28.074534161490682 25.465838509316768 21.490683229813666 24.96894409937888 155-159 25.766871165644172 24.539877300613497 26.68711656441718 23.006134969325153 160-164 24.25925925925926 23.333333333333332 25.185185185185183 27.22222222222222 165-169 26.840855106888363 24.94061757719715 23.75296912114014 24.46555819477435 170-174 30.523255813953487 18.8953488372093 27.03488372093023 23.546511627906977 175-179 24.90974729241877 23.465703971119133 23.465703971119133 28.158844765342963 180-184 22.325581395348838 26.046511627906977 33.02325581395349 18.6046511627907 185-189 26.41509433962264 23.89937106918239 20.754716981132077 28.930817610062892 190-194 19.379844961240313 21.705426356589147 24.031007751937985 34.883720930232556 195-199 20.5607476635514 20.5607476635514 23.364485981308412 35.51401869158878 200-204 26.190476190476193 35.714285714285715 20.238095238095237 17.857142857142858 205-209 28.57142857142857 25.71428571428571 22.857142857142858 22.857142857142858 210-214 32.075471698113205 26.41509433962264 24.528301886792452 16.9811320754717 215-219 28.947368421052634 31.57894736842105 28.947368421052634 10.526315789473683 220-224 27.27272727272727 36.36363636363637 9.090909090909092 27.27272727272727 225-229 40.0 0.0 20.0 40.0 230-233 25.0 25.0 25.0 25.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 1.0 7 1.0 8 2.0 9 3.0 10 3.0 11 2.5 12 2.5 13 2.0 14 1.0 15 1.5 16 2.0 17 2.0 18 2.5 19 3.0 20 3.0 21 3.5 22 4.5 23 6.0 24 7.5 25 13.0 26 16.0 27 15.5 28 17.5 29 22.0 30 24.5 31 24.0 32 32.0 33 46.5 34 57.0 35 66.0 36 75.0 37 84.5 38 102.5 39 122.33333333333333 40 142.83333333333331 41 163.0 42 178.5 43 184.0 44 191.83333333333334 45 223.16666666666669 46 243.0 47 245.16666666666669 48 251.5 49 251.33333333333331 50 248.50000000000003 51 248.83333333333334 52 241.66666666666669 53 227.66666666666666 54 221.0 55 213.83333333333334 56 207.5 57 197.5 58 188.5 59 175.0 60 175.5 61 192.5 62 172.5 63 139.5 64 125.0 65 120.0 66 109.0 67 99.5 68 87.5 69 78.5 70 74.0 71 63.5 72 54.0 73 40.5 74 29.5 75 20.0 76 13.0 77 11.0 78 9.5 79 8.0 80 7.0 81 8.0 82 7.5 83 6.0 84 5.5 85 4.5 86 3.5 87 3.0 88 2.5 89 1.5 90 1.0 91 1.0 92 1.0 93 1.0 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-159 0.0 160-164 0.0 165-169 0.0 170-174 0.0 175-179 0.0 180-184 0.0 185-189 0.0 190-194 0.0 195-199 0.0 200-204 0.0 205-209 0.0 210-214 0.0 215-219 0.0 220-224 0.0 225-229 0.0 230-233 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 5-9 19.0 10-14 76.0 15-19 70.0 20-24 41.0 25-29 45.0 30-34 69.0 35-39 83.0 40-44 80.0 45-49 111.0 50-54 142.0 55-59 180.0 60-64 215.0 65-69 253.0 70-74 244.0 75-79 267.0 80-84 274.0 85-89 254.0 90-94 223.0 95-99 218.0 100-104 173.0 105-109 149.0 110-114 135.0 115-119 96.0 120-124 98.0 125-129 87.0 130-134 80.0 135-139 54.0 140-144 53.0 145-149 39.0 150-154 27.0 155-159 29.0 160-164 22.0 165-169 20.0 170-174 14.0 175-179 12.0 180-184 11.0 185-189 9.0 190-194 5.0 195-199 4.0 200-204 4.0 205-209 3.0 210-214 3.0 215-219 5.0 220-224 3.0 225-229 0.0 230-234 1.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.25 #Duplication Level Percentage of deduplicated Percentage of total 1 98.88040712468194 97.15 2 0.9160305343511451 1.7999999999999998 3 0.07633587786259542 0.22499999999999998 4 0.07633587786259542 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05089058524173028 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACTCCAAGATCATCAACGACAGGGAGACTGGCCGTTCCCGCGGGTTCGGC 11 0.27499999999999997 No Hit AGGAGCAACTGGGCGTTCCTGAACGAGCCGCCGCAGGAGGAGGCCCCCGG 10 0.25 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.0 0.0 0.0 0.0 0.0 80-84 0.0 0.0 0.0 0.0 0.0 85-89 0.0 0.0 0.0 0.0 0.0 90-94 0.0 0.0 0.0 0.0 0.0 95-99 0.0 0.0 0.0 0.0 0.0 100-104 0.0 0.0 0.0 0.0 0.0 105-109 0.0 0.0 0.0 0.0 0.0 110-114 0.0 0.0 0.0 0.0 0.0 115-119 0.0 0.0 0.0 0.0 0.0 120-124 0.0 0.0 0.0 0.0 0.0 125-129 0.0 0.0 0.0 0.0 0.0 130-134 0.0 0.0 0.0 0.0 0.0 135-139 0.0 0.0 0.0 0.0 0.0 140-144 0.0 0.0 0.0 0.0 0.0 145-149 0.0 0.0 0.0 0.0 0.0 150-154 0.0 0.0 0.0 0.0 0.0 155-159 0.0 0.0 0.0 0.0 0.0 160-164 0.0 0.0 0.0 0.0 0.0 165-169 0.0 0.0 0.0 0.0 0.0 170-174 0.0 0.0 0.0 0.0 0.0 175-179 0.0 0.0 0.0 0.0 0.0 180-184 0.0 0.0 0.0 0.0 0.0 185-189 0.0 0.0 0.0 0.0 0.0 190-194 0.0 0.0 0.0 0.0 0.0 195-199 0.0 0.0 0.0 0.0 0.0 200-204 0.0 0.0 0.0 0.0 0.0 205-209 0.0 0.0 0.0 0.0 0.0 210-214 0.0 0.0 0.0 0.0 0.0 215-219 0.0 0.0 0.0 0.0 0.0 220-221 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTGCGA 5 0.0 6365.0 185 ACATCCC 5 0.0024259584 1591.25 135-139 AGCTTGT 5 0.0040428406 1273.0001 180-184 GTTTAGA 5 0.0040428406 1273.0001 175-179 AGAGCTT 5 0.0040428406 1273.0001 175-179 GCTTGTG 5 0.0040428406 1273.0001 180-184 TTTAGAG 5 0.0040428406 1273.0001 175-179 CTTGTGC 5 0.0040428406 1273.0001 180-184 TAGAGCT 5 0.0040428406 1273.0001 175-179 TTGTGCG 5 0.0040428406 1273.0001 180-184 TTAGAGC 5 0.0040428406 1273.0001 175-179 GGGTTGC 10 0.004851917 1060.8334 140-144 GCTCGAG 10 0.004851917 1060.8334 145-149 TTGCTGG 10 0.009701801 795.625 135-139 >>END_MODULE Read 249755 spots for ERR1806564.sra Written 249755 spots for ERR1806564.sra Read 249755 spots for ERR1806564.sra Written 249755 spots for ERR1806564.sra Read 249755 spots for ERR1806564.sra Written 249755 spots for ERR1806564.sra Read 249755 spots for ERR1806564.sra Written 249755 spots for ERR1806564.sra Read 249755 spots for ERR1806564.sra Written 249755 spots for ERR1806564.sra Read 249755 spots for ERR1806564.sra Written 249755 spots for ERR1806564.sra Read 249755 spots for ERR1806564.sra Written 249755 spots for ERR1806564.sra Read 249755 spots for ERR1806564.sra Written 249755 spots for ERR1806564.sra Read 249755 spots for ERR1806564.sra Written 249755 spots for ERR1806564.sra Read 249755 spots for ERR1806564.sra Written 249755 spots for ERR1806564.sra Read 249755 spots for ERR1806564.sra Written 249755 spots for ERR1806564.sra Read 249755 spots for ERR1806564.sra Written 249755 spots for ERR1806564.sra Read 249755 spots for ERR1806564.sra Written 249755 spots for ERR1806564.sra Read 249755 spots for ERR1806564.sra Written 249755 spots for ERR1806564.sra Read 249755 spots for ERR1806564.sra Written 249755 spots for ERR1806564.sra Read 249755 spots for ERR1806564.sra Written 249755 spots for ERR1806564.sra Read 249764 spots for ERR1806564.sra Written 249764 spots for ERR1806564.sra Read 249755 spots for ERR1806564.sra Written 249755 spots for ERR1806564.sra Read 249755 spots for ERR1806564.sra Written 249755 spots for ERR1806564.sra Read 249755 spots for ERR1806564.sra Written 249755 spots for ERR1806564.sra SRR ids: ['ERR1806564.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_34cqyg3o ERR1806564.sra spots: 4995109 blocks: [[1, 249755], [249756, 499510], [499511, 749265], [749266, 999020], [999021, 1248775], [1248776, 1498530], [1498531, 1748285], [1748286, 1998040], [1998041, 2247795], [2247796, 2497550], [2497551, 2747305], [2747306, 2997060], [2997061, 3246815], [3246816, 3496570], [3496571, 3746325], [3746326, 3996080], [3996081, 4245835], [4245836, 4495590], [4495591, 4745345], [4745346, 4995109]] ERR1806564 file size 1004015 ERR1806564 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1806564 ERR1806564_1.fastq Input file: ERR1806564_1.fastq trimmed: ERR1806564-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 16:39:21 2024 >> started Mon Dec 9 16:39:24 2024 >> done (2.733s) 4995109 reads processed; of these: 263673 ( 5.28%) short reads filtered out after trimming by size control 37 ( 0.00%) empty reads filtered out after trimming by size control 4731399 (94.72%) reads available; of these: 76798 ( 1.62%) trimmed reads available after processing 4654601 (98.38%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 16740 0.35% 19 15330 0.32% 20 14383 0.30% 21 14214 0.30% 22 13545 0.29% 23 13133 0.28% 24 13975 0.30% 25 13279 0.28% 26 13254 0.28% 27 13945 0.29% 28 13736 0.29% 29 13860 0.29% 30 14467 0.31% 31 14435 0.31% 32 14713 0.31% 33 15350 0.32% 34 16396 0.35% 35 16058 0.34% 36 16910 0.36% 37 16752 0.35% 38 17713 0.37% 39 19521 0.41% 40 19099 0.40% 41 19851 0.42% 42 22726 0.48% 43 21547 0.46% 44 22839 0.48% 45 24941 0.53% 46 25508 0.54% 47 26560 0.56% 48 29518 0.62% 49 29223 0.62% 50 29875 0.63% 51 33403 0.71% 52 33771 0.71% 53 34783 0.74% 54 38472 0.81% 55 39549 0.84% 56 40522 0.86% 57 43847 0.93% 58 44073 0.93% 59 48008 1.01% 60 52703 1.11% 61 53730 1.14% 62 51081 1.08% 63 55729 1.18% 64 55169 1.17% 65 55279 1.17% 66 57493 1.22% 67 57735 1.22% 68 59692 1.26% 69 60921 1.29% 70 60991 1.29% 71 61861 1.31% 72 65021 1.37% 73 62030 1.31% 74 62199 1.31% 75 64966 1.37% 76 64761 1.37% 77 73306 1.55% 78 73216 1.55% 79 63166 1.34% 80 63053 1.33% 81 62554 1.32% 82 67838 1.43% 83 65629 1.39% 84 63222 1.34% 85 71687 1.52% 86 60437 1.28% 87 59767 1.26% 88 58447 1.24% 89 57646 1.22% 90 60041 1.27% 91 54778 1.16% 92 54894 1.16% 93 58520 1.24% 94 52414 1.11% 95 51523 1.09% 96 51136 1.08% 97 48728 1.03% 98 47943 1.01% 99 47233 1.00% 100 47710 1.01% 101 45435 0.96% 102 44768 0.95% 103 43771 0.93% 104 41320 0.87% 105 40412 0.85% 106 38745 0.82% 107 38479 0.81% 108 36839 0.78% 109 36150 0.76% 110 34332 0.73% 111 33782 0.71% 112 33283 0.70% 113 30400 0.64% 114 30611 0.65% 115 29677 0.63% 116 28181 0.60% 117 28277 0.60% 118 26841 0.57% 119 25142 0.53% 120 25037 0.53% 121 23713 0.50% 122 23097 0.49% 123 22990 0.49% 124 21681 0.46% 125 20603 0.44% 126 20465 0.43% 127 19659 0.42% 128 18670 0.39% 129 18532 0.39% 130 17452 0.37% 131 17284 0.37% 132 16859 0.36% 133 15891 0.34% 134 15873 0.34% 135 14883 0.31% 136 13850 0.29% 137 13456 0.28% 138 13771 0.29% 139 13092 0.28% 140 12360 0.26% 141 11951 0.25% 142 11208 0.24% 143 10915 0.23% 144 10575 0.22% 145 10023 0.21% 146 9892 0.21% 147 10024 0.21% 148 9391 0.20% 149 8690 0.18% 150 8675 0.18% 151 8128 0.17% 152 7852 0.17% 153 7835 0.17% 154 7421 0.16% 155 7259 0.15% 156 6933 0.15% 157 6760 0.14% 158 6218 0.13% 159 6053 0.13% 160 5929 0.13% 161 5562 0.12% 162 5529 0.12% 163 5406 0.11% 164 5174 0.11% 165 4958 0.10% 166 4657 0.10% 167 4682 0.10% 168 4296 0.09% 169 4207 0.09% 170 4015 0.08% 171 3901 0.08% 172 3897 0.08% 173 3653 0.08% 174 3484 0.07% 175 3396 0.07% 176 3287 0.07% 177 3125 0.07% 178 2967 0.06% 179 2803 0.06% 180 2703 0.06% 181 2705 0.06% 182 2618 0.06% 183 2481 0.05% 184 2322 0.05% 185 2264 0.05% 186 2124 0.04% 187 2069 0.04% 188 1915 0.04% 189 1873 0.04% 190 1820 0.04% 191 1754 0.04% 192 1660 0.04% 193 1592 0.03% 194 1525 0.03% 195 1406 0.03% 196 1402 0.03% 197 1356 0.03% 198 1225 0.03% 199 1253 0.03% 200 1183 0.03% 201 1155 0.02% 202 1085 0.02% 203 937 0.02% 204 922 0.02% 205 940 0.02% 206 819 0.02% 207 820 0.02% 208 847 0.02% 209 768 0.02% 210 716 0.02% 211 703 0.01% 212 656 0.01% 213 612 0.01% 214 563 0.01% 215 542 0.01% 216 522 0.01% 217 452 0.01% 218 451 0.01% 219 456 0.01% 220 436 0.01% 221 387 0.01% 222 389 0.01% 223 341 0.01% 224 302 0.01% 225 307 0.01% 226 291 0.01% 227 261 0.01% 228 230 0.00% 229 215 0.00% 230 229 0.00% 231 202 0.00% 232 189 0.00% 233 171 0.00% 234 152 0.00% 235 145 0.00% 236 146 0.00% 237 115 0.00% 238 116 0.00% 239 99 0.00% 240 85 0.00% 241 76 0.00% 242 94 0.00% 243 85 0.00% 244 55 0.00% 245 68 0.00% 246 72 0.00% 247 47 0.00% 248 38 0.00% 249 30 0.00% 250 28 0.00% 251 45 0.00% 252 24 0.00% 253 31 0.00% 254 18 0.00% 255 21 0.00% 256 18 0.00% 257 16 0.00% 258 16 0.00% 259 20 0.00% 260 15 0.00% 261 10 0.00% 262 14 0.00% 263 9 0.00% 264 6 0.00% 265 4 0.00% 266 7 0.00% 267 4 0.00% 268 2 0.00% 269 8 0.00% 270 5 0.00% 271 1 0.00% 272 3 0.00% 273 4 0.00% 274 2 0.00% 275 1 0.00% 276 0 0.00% 277 1 0.00% 278 4 0.00% 279 1 0.00% 280 1 0.00% 281 0 0.00% 282 0 0.00% 283 1 0.00% 284 2 0.00% 285 0 0.00% 286 0 0.00% 287 0 0.00% 288 0 0.00% 289 0 0.00% 290 0 0.00% 291 1 0.00% 4731399 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=3.49 fanout-score-rank=25 prefix-density=0.43 prefix-fanout=3.1 sequence=AAGATCCAGGACAAGGAGGGCAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=93.02 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=7.2 sequence=AGAAGATTGTGATCAAGACCTGTGGGACTACCATGCTCCTGCTCACCATTCCAAGGATTCTTGAGCTTGCTGAAGAGCTGTGCATGCCGCTTGCTGCTGTGAAGTACTCTCGAGGGATGTTCATCTTCCCTGGCGCACAGCCAGCTCCCCACAGGAGCTTCTCTGAGGAGGTTGATGTCCTTAACCGCTACTTTGGTGGCCTGAAATCTGGTGGCAATGCTTATGTGATTGGAGATCCAGCCAAGCCAGGCCAGAAGTGGCACATCTATTATGCCACTGAGCAACCTGAGAAACCTATGGTCACACTGGAGATGTGCATGACTGGGCTGGACAAGAAGAAAGCCTCTGTCTTCTTCAAGACTTCTGCTGATGGACACATCTCATGTGCTAAGGAGATGACAAAGGTCTCTGGTATCTCTGAAATCATCCCGGAGATGGAGGTCTGTGACTTCGACTTTGAGCCCTGCGGCTACTCCATGAACGCCATCCATGGATCTGCGTTCTCTACAAT Started job on | Dec 09 16:39:42 Started mapping on | Dec 09 16:39:42 Finished on | Dec 09 16:39:52 Mapping speed, Million of reads per hour | 1703.30 Number of input reads | 4731399 Average input read length | 85 UNIQUE READS: Uniquely mapped reads number | 3846732 Uniquely mapped reads % | 81.30% Average mapped length | 82.14 Number of splices: Total | 878621 Number of splices: Annotated (sjdb) | 824497 Number of splices: GT/AG | 859385 Number of splices: GC/AG | 9960 Number of splices: AT/AC | 659 Number of splices: Non-canonical | 8617 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.14% Deletion average length | 1.09 Insertion rate per base | 0.13% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 133368 % of reads mapped to multiple loci | 2.82% Number of reads mapped to too many loci | 86627 % of reads mapped to too many loci | 1.83% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.75% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 751299 751299 751299 N_multimapping 133368 133368 133368 N_noFeature 144056 198492 3734419 N_ambiguous 64460 6679 419 UnstrandedReadsAssigned:3638216 PositiveStrandReadsAssigned:3641561 NegativeStrandReadsAssigned:111894 Dataset is classified positive stranded MeadianReadLen=83 20thPercentileLength=59 echo kmer=55 ERR1806564 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR1806564-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,731,399 reads, 3,711,830 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,129 rounds 52973 ERR1806564.ke.tsv 35125 ERR1806564.se.tsv 88098 total ==> ERR1806564.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 40.3555 19.5904 PNS24247 1044 945 11.6667 5.01627 PNS24249 1928 1829 35.5233 7.89161 PNS24246 1044 945 11.6667 5.01627 PNS24248 1044 945 11.6667 5.01627 PNS24244 1471 1372 71.1212 21.0625 PNS24243 293 194 0 0 KQK14069 1603 1504 2951.11 797.266 KQK14071 474 375 167.57 181.564 ==> ERR1806564.se.tsv <== BRADI_1g14170v3 3334 BRADI_1g53295v3 75 BRADI_1g59795v3 32 BRADI_1g07683v3 0 BRADI_1g00485v3 28 BRADI_1g20270v3 290 BRADI_1g74790v3 41 BRADI_1g09890v3 0 BRADI_1g77505v3 56 BRADI_1g48960v3 0 ERR1806564 completed mapping pipeline successfully