Starting /dee2/code/volunteer_pipeline.sh ERR1806565 current disk space = 1523372945408 free memory = 1604810872 ERR1806565 SRAfilesize 6248ed6bc95927063559e6275f97343e ERR1806565.sra ERR1806565.sra file validated ERR1806565 is single end ERR1806565 is conventional basespace ERR1806565 read1 length is 8-217 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1806565_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 8-217 %GC 50 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.961 24.0 21.0 26.0 17.0 27.0 2 22.893 24.0 20.0 26.0 16.0 28.0 3 22.57675 24.0 20.0 26.0 14.0 27.0 4 22.71125 24.0 20.0 26.0 14.0 28.0 5 22.536 24.0 20.0 26.0 14.0 28.0 6 22.529 24.0 20.0 26.0 14.0 28.0 7 22.5095 24.0 20.0 26.0 14.0 28.0 8 22.52775 24.0 20.0 26.0 14.0 28.0 9 22.630838774485184 24.0 20.0 26.0 15.0 28.0 10-14 22.69698828786749 24.0 20.0 26.0 15.4 28.0 15-19 23.01269420791137 24.0 20.2 26.2 16.0 28.0 20-24 23.28128859705864 25.0 20.8 27.0 16.2 28.0 25-29 23.423793181420344 25.0 21.0 27.0 17.0 28.0 30-34 23.292171415859237 24.8 20.8 26.4 17.0 28.0 35-39 23.30541500967538 24.8 20.8 26.4 17.0 28.0 40-44 23.313566728839866 25.0 21.0 26.2 17.0 28.0 45-49 23.290325777975646 25.0 21.0 26.0 17.0 27.8 50-54 23.310042136224418 25.0 21.0 26.0 17.0 28.0 55-59 23.235687338895076 24.8 20.4 26.0 16.6 28.0 60-64 23.279306296655033 24.8 21.0 26.0 17.0 27.6 65-69 23.153474611172058 24.4 20.0 26.0 16.8 27.4 70-74 23.28021254594774 24.6 20.6 26.2 17.0 27.4 75-79 23.071531661167164 24.0 20.0 26.0 16.8 27.0 80-84 23.095636497110217 24.0 20.2 26.0 17.0 27.0 85-89 22.958717749404304 24.0 20.0 26.0 16.4 27.0 90-94 22.845872848704353 24.0 20.0 26.0 16.2 27.0 95-99 22.713811553877548 24.0 20.0 26.0 16.4 27.0 100-104 22.778205261092015 23.8 20.0 26.0 16.4 27.0 105-109 22.68344033519309 23.4 20.0 26.0 16.8 27.0 110-114 22.527547537990046 23.4 20.0 26.0 16.0 27.0 115-119 22.434937996448646 23.2 19.8 26.0 16.2 27.0 120-124 22.28736200067565 23.2 19.8 25.6 15.4 27.0 125-129 22.027807620131547 23.0 19.4 25.4 14.8 27.0 130-134 21.766391459056543 22.4 19.2 25.0 14.0 26.8 135-139 21.626907141091788 22.4 19.0 25.0 14.2 26.4 140-144 21.92558746113882 22.4 19.4 25.0 15.8 26.2 145-149 21.637678061736114 22.333333333333332 19.0 25.0 15.0 26.0 150-154 21.13358443717941 NaN NaN NaN NaN NaN 155-159 21.280561262889655 NaN NaN NaN NaN NaN 160-164 20.975874038465605 NaN NaN NaN NaN NaN 165-169 20.826521136521137 NaN NaN NaN NaN NaN 170-174 19.91405701174778 NaN NaN NaN NaN NaN 175-179 19.789383022774324 NaN NaN NaN NaN NaN 180-184 19.160644257703083 NaN NaN NaN NaN NaN 185-189 18.563318903318905 NaN NaN NaN NaN NaN 190-194 18.377142857142857 NaN NaN NaN NaN NaN 195-199 18.63 NaN NaN NaN NaN NaN 200-204 17.0 NaN NaN NaN NaN NaN 205-209 12.4 NaN NaN NaN NaN NaN 210-214 14.6 NaN NaN NaN NaN NaN 215-217 14.0 NaN NaN NaN NaN NaN >>END_MODULE >>Per sequence quality scores warn #Quality Count 9 1.0 10 3.0 11 6.0 12 15.0 13 16.0 14 38.0 15 55.0 16 83.0 17 133.0 18 154.0 19 203.0 20 207.0 21 321.0 22 411.0 23 625.0 24 831.0 25 701.0 26 190.0 27 7.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.75 43.325 18.575 13.350000000000001 2 42.425000000000004 34.575 6.875000000000001 16.125 3 29.5 32.25 20.925 17.325 4 37.9 27.200000000000003 16.325 18.575 5 30.45 28.7 17.0 23.849999999999998 6 27.150000000000002 29.225 19.375 24.25 7 22.925 31.724999999999998 23.025000000000002 22.325 8 24.825 27.6 24.85 22.725 9 25.062782521346055 23.405323957810147 23.606228026117527 27.92566549472627 10-14 26.605878457541642 25.41388620039733 24.22189394325302 23.758341398808007 15-19 27.321944809461236 24.97240473061761 23.5742444152431 24.131406044678055 20-24 27.863275554835575 24.7745558615476 23.419191101031373 23.942977482585455 25-29 26.43184101819806 24.639946410628557 24.182203862900526 24.74600870827286 30-34 26.94621168305379 25.118565644881436 24.071717755928283 23.863504916136495 35-39 26.98986975397974 24.993970091654607 23.787988422575975 24.228171731789676 40-44 27.023407105044967 24.402066458320046 24.108680400535746 24.46584603609924 45-49 26.509132885176882 25.633190738100087 24.098594418415157 23.75908195830787 50-54 26.49054951470481 25.24264759541706 24.06042472451288 24.206378165365248 55-59 25.660407383831956 24.57829408020369 24.49077021005729 25.270528325907065 60-64 25.496952027564273 24.75483699973496 25.231910946196663 24.51630002650411 65-69 26.887534408179313 24.007078254030674 24.655918206842312 24.449469130947698 70-74 26.066871975362954 24.21909370875495 25.34095908490981 24.373075230972283 75-79 26.04541506390371 25.74761136617446 24.457128676014396 23.749844893907433 80-84 25.805084745762713 24.675141242937855 24.774011299435028 24.74576271186441 85-89 25.693191140278916 24.57752255947498 25.693191140278916 24.036095159967186 90-94 25.60386473429952 24.386473429951693 25.10144927536232 24.908212560386474 95-99 25.51299589603283 23.917008663930687 25.85499316005472 24.71500227998176 100-104 25.84779706275033 24.566088117489986 25.82109479305741 23.76502002670227 105-109 25.166825548141087 25.166825548141087 25.10327295837305 24.563075945344774 110-114 26.380368098159508 25.191717791411044 25.268404907975462 23.159509202453986 115-119 24.68384074941452 25.85480093676815 23.372365339578455 26.088992974238877 120-124 24.92803684513529 26.137017846862403 25.273459988485897 23.661485319516405 125-129 26.423049894588896 25.01756851721715 24.947294448348558 23.612087139845396 130-134 23.623445825932503 25.754884547069274 26.376554174067497 24.24511545293073 135-139 25.196850393700785 25.646794150731157 24.07199100112486 25.084364454443193 140-144 24.896265560165975 23.92807745504841 26.41770401106501 24.75795297372061 145-149 22.137404580152673 25.763358778625957 25.190839694656486 26.908396946564885 150-154 25.263157894736842 28.157894736842103 21.31578947368421 25.263157894736842 155-159 23.92857142857143 26.071428571428573 24.285714285714285 25.71428571428571 160-164 28.110599078341014 27.188940092165897 20.737327188940093 23.963133640552993 165-169 22.95918367346939 25.510204081632654 23.46938775510204 28.061224489795915 170-174 30.434782608695656 21.73913043478261 27.536231884057973 20.28985507246377 175-179 20.535714285714285 24.107142857142858 26.785714285714285 28.57142857142857 180-184 25.675675675675674 22.972972972972975 28.37837837837838 22.972972972972975 185-189 20.454545454545457 31.818181818181817 25.0 22.727272727272727 190-194 44.44444444444444 3.7037037037037033 33.33333333333333 18.51851851851852 195-199 25.0 12.5 45.83333333333333 16.666666666666664 200-204 41.66666666666667 16.666666666666664 33.33333333333333 8.333333333333332 205-209 20.0 20.0 40.0 20.0 210-214 60.0 20.0 20.0 0.0 215-217 0.0 33.33333333333333 33.33333333333333 33.33333333333333 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 2.0 11 2.0 12 2.0 13 2.0 14 3.0 15 3.5 16 2.5 17 2.0 18 2.0 19 3.0 20 3.5 21 4.5 22 6.0 23 7.5 24 9.5 25 12.0 26 14.5 27 16.0 28 22.5 29 32.0 30 37.0 31 47.5 32 63.5 33 73.0 34 78.0 35 86.5 36 97.5 37 119.0 38 146.0 39 167.0 40 196.5 41 218.0 42 216.5 43 224.5 44 259.8333333333333 45 294.16666666666663 46 314.5 47 308.5 48 297.83333333333337 49 299.33333333333337 50 297.0 51 288.5 52 302.5 53 300.5 54 284.5 55 271.0 56 230.5 57 211.0 58 211.5 59 220.0 60 217.5 61 198.83333333333331 62 183.33333333333334 63 167.0 64 167.0 65 158.5 66 131.5 67 120.5 68 111.0 69 106.0 70 96.5 71 78.5 72 59.5 73 48.0 74 44.5 75 33.5 76 27.5 77 26.5 78 22.5 79 16.0 80 10.0 81 8.5 82 7.5 83 6.0 84 5.0 85 5.0 86 4.5 87 3.5 88 1.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-159 0.0 160-164 0.0 165-169 0.0 170-174 0.0 175-179 0.0 180-184 0.0 185-189 0.0 190-194 0.0 195-199 0.0 200-204 0.0 205-209 0.0 210-214 0.0 215-217 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 5-9 31.0 10-14 114.0 15-19 109.0 20-24 108.0 25-29 135.0 30-34 125.0 35-39 160.0 40-44 195.0 45-49 195.0 50-54 220.0 55-59 242.0 60-64 252.0 65-69 206.0 70-74 222.0 75-79 184.0 80-84 212.0 85-89 185.0 90-94 168.0 95-99 141.0 100-104 128.0 105-109 99.0 110-114 105.0 115-119 84.0 120-124 76.0 125-129 55.0 130-134 55.0 135-139 33.0 140-144 42.0 145-149 36.0 150-154 19.0 155-159 17.0 160-164 7.0 165-169 9.0 170-174 6.0 175-179 8.0 180-184 6.0 185-189 4.0 190-194 2.0 195-199 1.0 200-204 2.0 205-209 1.0 210-214 0.0 215-218 1.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26395939086294 97.775 2 0.4822335025380711 0.95 3 0.10152284263959391 0.3 4 0.0 0.0 5 0.025380710659898477 0.125 6 0.025380710659898477 0.15 7 0.10152284263959391 0.7000000000000001 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGAAGAAGCTCACTGCCGAGGCTTATGACTGCAACAATACGGTTGAGCA 7 0.17500000000000002 No Hit GGGAAGAAGCTCACTGCCGAGGCTTATGACTGCAACAATACGGTTGAGCAAGAGCTCCCG 7 0.17500000000000002 No Hit ACTCCAAGATCATCAACGACAGGGAGACTGGCCGTTCCCGCGGGTTCGGC 7 0.17500000000000002 No Hit GCGGATTGCTCGAGCTGCTCACGCGGCGAGAGCGGGTCGCCG 7 0.17500000000000002 No Hit GGGGAAGAAGCTCACTGCCGAGGCTTATGACTGCAACAATACGGTTGAGC 6 0.15 No Hit ATGGGGGCCGGCGATGCGTCCTGGCCGTATGCGGAACGGCTTTTGCTGGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.0 0.0 0.0 0.0 0.0 80-84 0.0 0.0 0.0 0.0 0.0 85-89 0.0 0.0 0.0 0.0 0.0 90-94 0.0 0.0 0.0 0.0 0.0 95-99 0.0 0.0 0.0 0.0 0.0 100-104 0.0 0.0 0.0 0.0 0.0 105-109 0.0 0.0 0.0 0.0 0.0 110-114 0.0 0.0 0.0 0.0 0.0 115-119 0.0 0.0 0.0 0.0 0.0 120-124 0.0 0.0 0.0 0.0 0.0 125-129 0.0 0.0 0.0 0.0 0.0 130-134 0.0 0.0 0.0 0.0 0.0 135-139 0.0 0.0 0.0 0.0 0.0 140-144 0.0 0.0 0.0 0.0 0.0 145-149 0.0 0.0 0.0 0.0 0.0 150-154 0.0 0.0 0.0 0.0 0.0 155-159 0.0 0.0 0.0 0.0 0.0 160-164 0.0 0.0 0.0 0.0 0.0 165-169 0.0 0.0 0.0 0.0 0.0 170-174 0.0 0.0 0.0 0.0 0.0 175-179 0.0 0.0 0.0 0.0 0.0 180-184 0.0 0.0 0.0 0.0 0.0 185-189 0.0 0.0 0.0 0.0 0.0 190-194 0.0 0.0 0.0 0.0 0.0 195-199 0.0 0.0 0.0 0.0 0.0 200-204 0.0 0.0 0.0 0.0 0.0 205 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGGTA 5 6.2329456E-4 2563.5 136-137 AGGTATC 5 6.2329456E-4 2563.5 138-139 GGTATCA 5 6.2329456E-4 2563.5 138-139 GAGGTAT 10 0.0024931782 1281.75 136-137 ACCACTC 5 0.0037387947 1281.75 134-135 ACCACCG 5 0.0037387947 1281.75 126-127 CCACTCC 5 0.0037387947 1281.75 134-135 AGAGAGG 5 0.0037387947 1281.75 134-135 GAGAGAG 5 0.0037387947 1281.75 132-133 CGTGAGA 5 0.0037387947 1281.75 130-131 TACCACT 5 0.0037387947 1281.75 132-133 CGGTACC 5 0.0037387947 1281.75 130-131 TGAGAGA 5 0.0037387947 1281.75 132-133 ATGATGC 5 0.009344556 854.5 128-129 TCCGGTA 5 0.009344556 854.5 128-129 AGCGTGA 5 0.009344556 854.5 128-129 CCGGTAC 5 0.009344556 854.5 128-129 >>END_MODULE Read 313727 spots for ERR1806565.sra Written 313727 spots for ERR1806565.sra Read 313727 spots for ERR1806565.sra Written 313727 spots for ERR1806565.sra Read 313727 spots for ERR1806565.sra Written 313727 spots for ERR1806565.sra Read 313727 spots for ERR1806565.sra Written 313727 spots for ERR1806565.sra Read 313727 spots for ERR1806565.sra Written 313727 spots for ERR1806565.sra Read 313727 spots for ERR1806565.sra Written 313727 spots for ERR1806565.sra Read 313727 spots for ERR1806565.sra Written 313727 spots for ERR1806565.sra Read 313727 spots for ERR1806565.sra Written 313727 spots for ERR1806565.sra Read 313727 spots for ERR1806565.sra Written 313727 spots for ERR1806565.sra Read 313727 spots for ERR1806565.sra Written 313727 spots for ERR1806565.sra Read 313727 spots for ERR1806565.sra Written 313727 spots for ERR1806565.sra Read 313727 spots for ERR1806565.sra Written 313727 spots for ERR1806565.sra Read 313737 spots for ERR1806565.sra Written 313737 spots for ERR1806565.sra Read 313727 spots for ERR1806565.sra Written 313727 spots for ERR1806565.sra Read 313727 spots for ERR1806565.sra Written 313727 spots for ERR1806565.sra Read 313727 spots for ERR1806565.sra Written 313727 spots for ERR1806565.sra Read 313727 spots for ERR1806565.sra Written 313727 spots for ERR1806565.sra Read 313727 spots for ERR1806565.sra Written 313727 spots for ERR1806565.sra Read 313727 spots for ERR1806565.sra Written 313727 spots for ERR1806565.sra Read 313727 spots for ERR1806565.sra Written 313727 spots for ERR1806565.sra SRR ids: ['ERR1806565.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_25f41654 ERR1806565.sra spots: 6274550 blocks: [[1, 313727], [313728, 627454], [627455, 941181], [941182, 1254908], [1254909, 1568635], [1568636, 1882362], [1882363, 2196089], [2196090, 2509816], [2509817, 2823543], [2823544, 3137270], [3137271, 3450997], [3450998, 3764724], [3764725, 4078451], [4078452, 4392178], [4392179, 4705905], [4705906, 5019632], [5019633, 5333359], [5333360, 5647086], [5647087, 5960813], [5960814, 6274550]] ERR1806565 file size 1114434 ERR1806565 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1806565 ERR1806565_1.fastq Input file: ERR1806565_1.fastq trimmed: ERR1806565-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 16:45:29 2024 >> started Mon Dec 9 16:45:33 2024 >> done (3.487s) 6274550 reads processed; of these: 395543 ( 6.30%) short reads filtered out after trimming by size control 35 ( 0.00%) empty reads filtered out after trimming by size control 5878972 (93.70%) reads available; of these: 102163 ( 1.74%) trimmed reads available after processing 5776809 (98.26%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 32446 0.55% 19 31516 0.54% 20 30511 0.52% 21 31994 0.54% 22 31419 0.53% 23 31891 0.54% 24 34798 0.59% 25 34084 0.58% 26 34893 0.59% 27 36692 0.62% 28 37320 0.63% 29 37542 0.64% 30 41299 0.70% 31 40308 0.69% 32 41337 0.70% 33 45537 0.77% 34 46676 0.79% 35 46192 0.79% 36 48460 0.82% 37 48154 0.82% 38 49176 0.84% 39 56083 0.95% 40 52494 0.89% 41 53726 0.91% 42 64813 1.10% 43 57896 0.98% 44 58482 0.99% 45 64647 1.10% 46 62232 1.06% 47 62992 1.07% 48 65839 1.12% 49 65657 1.12% 50 65915 1.12% 51 70724 1.20% 52 68240 1.16% 53 67735 1.15% 54 71760 1.22% 55 70078 1.19% 56 70094 1.19% 57 72446 1.23% 58 71423 1.21% 59 74603 1.27% 60 79373 1.35% 61 77339 1.32% 62 74058 1.26% 63 76428 1.30% 64 74315 1.26% 65 72214 1.23% 66 72707 1.24% 67 72161 1.23% 68 71046 1.21% 69 72183 1.23% 70 70377 1.20% 71 70004 1.19% 72 71656 1.22% 73 67320 1.15% 74 67897 1.15% 75 67571 1.15% 76 66408 1.13% 77 69739 1.19% 78 69938 1.19% 79 64434 1.10% 80 62290 1.06% 81 61385 1.04% 82 66849 1.14% 83 66923 1.14% 84 60149 1.02% 85 57726 0.98% 86 55217 0.94% 87 55482 0.94% 88 53767 0.91% 89 53733 0.91% 90 53611 0.91% 91 50429 0.86% 92 49220 0.84% 93 51193 0.87% 94 47687 0.81% 95 46328 0.79% 96 45972 0.78% 97 43494 0.74% 98 42769 0.73% 99 42256 0.72% 100 41466 0.71% 101 39999 0.68% 102 38918 0.66% 103 37842 0.64% 104 36357 0.62% 105 35288 0.60% 106 33826 0.58% 107 33320 0.57% 108 32548 0.55% 109 32093 0.55% 110 30728 0.52% 111 30599 0.52% 112 29170 0.50% 113 27663 0.47% 114 27761 0.47% 115 26888 0.46% 116 25691 0.44% 117 25074 0.43% 118 23891 0.41% 119 23276 0.40% 120 22821 0.39% 121 23419 0.40% 122 21142 0.36% 123 19994 0.34% 124 19222 0.33% 125 18706 0.32% 126 18295 0.31% 127 17307 0.29% 128 16697 0.28% 129 16402 0.28% 130 15843 0.27% 131 15009 0.26% 132 14853 0.25% 133 13869 0.24% 134 13515 0.23% 135 13129 0.22% 136 12342 0.21% 137 11757 0.20% 138 12064 0.21% 139 11272 0.19% 140 11205 0.19% 141 10449 0.18% 142 9899 0.17% 143 9515 0.16% 144 9104 0.15% 145 9002 0.15% 146 8391 0.14% 147 8506 0.14% 148 7911 0.13% 149 7694 0.13% 150 7403 0.13% 151 7100 0.12% 152 6620 0.11% 153 6421 0.11% 154 6156 0.10% 155 6021 0.10% 156 5773 0.10% 157 5488 0.09% 158 5029 0.09% 159 5131 0.09% 160 4804 0.08% 161 4586 0.08% 162 4325 0.07% 163 4242 0.07% 164 4089 0.07% 165 3817 0.06% 166 3591 0.06% 167 3418 0.06% 168 3290 0.06% 169 3065 0.05% 170 2989 0.05% 171 2939 0.05% 172 2814 0.05% 173 2521 0.04% 174 2474 0.04% 175 2414 0.04% 176 2284 0.04% 177 2161 0.04% 178 1962 0.03% 179 1908 0.03% 180 1782 0.03% 181 1654 0.03% 182 1610 0.03% 183 1522 0.03% 184 1405 0.02% 185 1408 0.02% 186 1323 0.02% 187 1245 0.02% 188 1180 0.02% 189 1029 0.02% 190 1010 0.02% 191 946 0.02% 192 858 0.01% 193 871 0.01% 194 766 0.01% 195 653 0.01% 196 692 0.01% 197 647 0.01% 198 572 0.01% 199 560 0.01% 200 535 0.01% 201 481 0.01% 202 483 0.01% 203 450 0.01% 204 401 0.01% 205 410 0.01% 206 352 0.01% 207 318 0.01% 208 311 0.01% 209 282 0.00% 210 244 0.00% 211 266 0.00% 212 208 0.00% 213 195 0.00% 214 180 0.00% 215 172 0.00% 216 160 0.00% 217 161 0.00% 218 122 0.00% 219 125 0.00% 220 109 0.00% 221 97 0.00% 222 89 0.00% 223 65 0.00% 224 80 0.00% 225 53 0.00% 226 56 0.00% 227 42 0.00% 228 57 0.00% 229 42 0.00% 230 42 0.00% 231 35 0.00% 232 31 0.00% 233 25 0.00% 234 28 0.00% 235 17 0.00% 236 16 0.00% 237 19 0.00% 238 14 0.00% 239 12 0.00% 240 22 0.00% 241 11 0.00% 242 10 0.00% 243 8 0.00% 244 9 0.00% 245 9 0.00% 246 3 0.00% 247 6 0.00% 248 3 0.00% 249 4 0.00% 250 3 0.00% 251 4 0.00% 252 4 0.00% 253 1 0.00% 254 3 0.00% 255 0 0.00% 256 4 0.00% 257 4 0.00% 258 0 0.00% 259 1 0.00% 260 1 0.00% 261 0 0.00% 262 1 0.00% 263 0 0.00% 264 0 0.00% 265 0 0.00% 266 0 0.00% 267 1 0.00% 268 1 0.00% 269 0 0.00% 270 0 0.00% 271 0 0.00% 272 0 0.00% 273 0 0.00% 274 0 0.00% 275 0 0.00% 276 0 0.00% 277 0 0.00% 278 0 0.00% 279 0 0.00% 280 0 0.00% 281 0 0.00% 282 0 0.00% 283 0 0.00% 284 0 0.00% 285 0 0.00% 286 0 0.00% 287 1 0.00% 288 0 0.00% 289 0 0.00% 290 0 0.00% 291 0 0.00% 292 0 0.00% 293 0 0.00% 294 0 0.00% 295 0 0.00% 296 0 0.00% 297 0 0.00% 298 0 0.00% 299 0 0.00% 300 0 0.00% 301 0 0.00% 302 0 0.00% 303 0 0.00% 304 0 0.00% 305 0 0.00% 306 0 0.00% 307 0 0.00% 308 0 0.00% 309 0 0.00% 310 0 0.00% 311 0 0.00% 312 0 0.00% 313 0 0.00% 314 0 0.00% 315 0 0.00% 316 0 0.00% 317 0 0.00% 318 0 0.00% 319 0 0.00% 320 0 0.00% 321 0 0.00% 322 0 0.00% 323 0 0.00% 324 0 0.00% 325 0 0.00% 326 0 0.00% 327 0 0.00% 328 0 0.00% 329 0 0.00% 330 0 0.00% 331 0 0.00% 332 0 0.00% 333 1 0.00% 5878972 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.91 fanout-score-rank=20 prefix-density=0.20 prefix-fanout=3.2 sequence=AAGATCCAGGACAAGGAGGGCAT criterion=fanout-score sequence-density=0.06 sequence-density-rank=19 fanout-score=98.61 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=12.6 sequence=AGAAGAAGGACCCAACCGGCGCCAAGGTCACCAAGCGGCTGCCAAGA Started job on | Dec 09 16:45:48 Started mapping on | Dec 09 16:45:48 Finished on | Dec 09 16:46:00 Mapping speed, Million of reads per hour | 1763.69 Number of input reads | 5878972 Average input read length | 73 UNIQUE READS: Uniquely mapped reads number | 4776787 Uniquely mapped reads % | 81.25% Average mapped length | 70.73 Number of splices: Total | 1057479 Number of splices: Annotated (sjdb) | 993231 Number of splices: GT/AG | 1035957 Number of splices: GC/AG | 11607 Number of splices: AT/AC | 901 Number of splices: Non-canonical | 9014 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.13% Deletion average length | 1.09 Insertion rate per base | 0.16% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 220270 % of reads mapped to multiple loci | 3.75% Number of reads mapped to too many loci | 142784 % of reads mapped to too many loci | 2.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.19% % of reads unmapped: other | 0.38% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 881915 881915 881915 N_multimapping 220270 220270 220270 N_noFeature 166209 210213 4668258 N_ambiguous 73125 8727 531 UnstrandedReadsAssigned:4537453 PositiveStrandReadsAssigned:4557847 NegativeStrandReadsAssigned:107998 Dataset is classified positive stranded MeadianReadLen=70 20thPercentileLength=45 echo kmer=41 ERR1806565 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR1806565-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,878,972 reads, 4,431,685 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,042 rounds 52973 ERR1806565.ke.tsv 35125 ERR1806565.se.tsv 88098 total ==> ERR1806565.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 13.4078 5.358 PNS24247 1044 945 25.8451 9.14784 PNS24249 1928 1829 22.794 4.16849 PNS24246 1044 945 25.8451 9.14784 PNS24248 1044 945 25.8451 9.14784 PNS24244 1471 1372 112.263 27.3687 PNS24243 293 194 0 0 KQK14069 1603 1504 931.046 207.06 KQK14071 474 375 53.8078 47.9939 ==> ERR1806565.se.tsv <== BRADI_1g14170v3 1051 BRADI_1g53295v3 32 BRADI_1g59795v3 76 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 550 BRADI_1g74790v3 69 BRADI_1g09890v3 0 BRADI_1g77505v3 109 BRADI_1g48960v3 0 ERR1806565 completed mapping pipeline successfully