Starting /dee2/code/volunteer_pipeline.sh ERR1806566 current disk space = 1523383250944 free memory = 1604808596 ERR1806566 SRAfilesize df5b3d6483d98d5cfbb2021bfa90cbcb ERR1806566.sra ERR1806566.sra file validated ERR1806566 is single end ERR1806566 is conventional basespace ERR1806566 read1 length is 8-235 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1806566_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 8-235 %GC 52 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.6425 24.0 21.0 27.0 19.0 28.0 2 23.64275 25.0 21.0 27.0 17.0 28.0 3 23.37775 25.0 21.0 27.0 16.0 28.0 4 23.689 25.0 21.0 27.0 16.0 29.0 5 23.55675 25.0 21.0 27.0 16.0 28.0 6 23.54525 25.0 21.0 27.0 16.0 28.0 7 23.31775 25.0 21.0 27.0 16.0 28.0 8 23.36025 25.0 21.0 27.0 16.0 28.0 9 23.384172301527673 25.0 21.0 27.0 16.0 28.0 10-14 23.45639727022943 25.0 21.0 27.0 16.8 28.0 15-19 23.683913982642935 25.0 21.0 27.0 17.0 28.0 20-24 23.828784883530762 25.0 21.0 27.0 18.0 28.0 25-29 23.84489337980569 25.0 21.0 27.0 18.0 28.0 30-34 23.799973814765945 25.0 21.0 27.0 18.0 28.0 35-39 23.780807882356804 25.0 21.0 27.0 18.0 28.0 40-44 23.82771659831002 25.0 21.0 27.0 18.0 28.0 45-49 23.7598120086387 25.0 21.0 27.0 18.0 28.0 50-54 23.830964789119225 25.0 21.0 27.0 18.0 28.0 55-59 23.926010140703543 25.0 21.2 27.0 18.2 28.0 60-64 23.915567628078083 25.0 21.4 27.0 18.2 28.0 65-69 23.834740709538586 25.0 21.0 27.0 18.0 28.0 70-74 23.810568525681084 25.0 21.0 27.0 18.0 28.0 75-79 23.829735821896296 25.0 21.0 27.0 18.0 28.0 80-84 23.716367747188965 25.0 21.0 27.0 17.8 28.0 85-89 23.65209918258509 25.0 21.0 26.6 17.8 28.0 90-94 23.642146522915713 25.0 21.0 26.8 18.0 27.8 95-99 23.60916841865596 25.0 21.0 26.8 17.8 27.8 100-104 23.62221132229622 25.0 21.0 26.6 18.0 27.6 105-109 23.60572567536314 25.0 21.0 26.4 17.8 27.6 110-114 23.491371566753696 25.0 21.0 26.2 17.2 27.2 115-119 23.374037799676355 25.0 20.8 26.0 17.2 27.0 120-124 23.30534649307591 25.0 20.8 26.0 17.4 27.0 125-129 22.995702251633574 24.2 20.2 26.0 16.4 27.0 130-134 23.002874842977555 24.2 20.4 26.0 16.8 27.0 135-139 22.610445641650063 24.0 20.0 26.0 16.4 27.0 140-144 22.703538640534155 24.0 20.0 26.0 16.4 27.0 145-149 22.74734146895995 23.8 20.2 26.0 16.8 27.0 150-154 22.32316274519244 23.4 19.8 26.0 15.6 27.0 155-159 21.958961821895727 23.0 19.0 25.6 14.6 27.0 160-164 22.140947801550674 23.0 19.2 25.2 15.8 26.8 165-169 21.70288705145125 22.8 19.0 25.0 14.8 26.4 170-174 21.28323539676269 22.0 18.8 24.6 13.8 26.0 175-179 20.89223618786782 21.8 18.4 24.4 13.4 26.0 180-184 20.807248949403164 21.0 17.0 24.0 12.0 26.0 185-189 20.58257610014546 NaN NaN NaN NaN NaN 190-194 19.58071509454846 NaN NaN NaN NaN NaN 195-199 19.867141779788838 NaN NaN NaN NaN NaN 200-204 20.1320111071724 NaN NaN NaN NaN NaN 205-209 18.905020703933747 NaN NaN NaN NaN NaN 210-214 19.231124011007914 NaN NaN NaN NaN NaN 215-219 17.884871794871792 NaN NaN NaN NaN NaN 220-224 19.77190476190476 NaN NaN NaN NaN NaN 225-229 20.27 NaN NaN NaN NaN NaN 230-234 17.566666666666666 NaN NaN NaN NaN NaN 235 17.0 NaN NaN NaN NaN NaN >>END_MODULE >>Per sequence quality scores warn #Quality Count 9 1.0 10 0.0 11 3.0 12 5.0 13 5.0 14 13.0 15 26.0 16 57.0 17 70.0 18 98.0 19 131.0 20 145.0 21 245.0 22 371.0 23 595.0 24 1114.0 25 974.0 26 145.0 27 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.025 41.9 18.025 15.049999999999999 2 41.55 35.875 5.675 16.900000000000002 3 30.65 32.2 20.424999999999997 16.725 4 36.775000000000006 28.675 15.8 18.75 5 28.999999999999996 27.675 16.6 26.724999999999998 6 26.1 29.675 19.7 24.525 7 23.025000000000002 30.95 22.55 23.474999999999998 8 25.825 24.675 24.5 25.0 9 25.820185324317556 23.741547708489858 23.816679188580014 26.62158777861257 10-14 27.087422618148878 24.52060999547033 23.388192661935676 25.003774724445115 15-19 28.197155818339365 24.573117895917225 22.427238901065294 24.802487384678116 20-24 28.09127351218008 24.26251413300442 22.55627505396238 25.089937300853123 25-29 27.297675141096672 24.827836172526276 22.81882669704344 25.05566198933361 30-34 27.388535031847134 23.98454630886499 23.279732692910095 25.34718596637778 35-39 27.496709660436956 24.12213740458015 22.795472492761252 25.585680442221637 40-44 27.20744680851064 24.53191489361702 23.079787234042552 25.18085106382979 45-49 27.132535317588697 24.042920306265504 23.886552356303245 24.937992019842554 50-54 27.374637720785255 23.37726253622792 23.62333898397769 25.62476075900913 55-59 27.29698182424546 23.761880940470235 23.278305819576456 25.662831415707853 60-64 27.22370437645456 23.829255832434583 23.86331384458194 25.083725946528922 65-69 27.681986700406046 24.03931030424292 22.626964044018123 25.651738951332902 70-74 27.071891391545822 24.436902190681888 23.02375809935205 25.46744831842024 75-79 26.322682032477733 23.880303823991618 24.57438449449974 25.22262964903091 80-84 27.14537134811686 23.88595564941922 23.181978176698344 25.786694825765576 85-89 26.128538638102526 24.758990053557767 23.817903596021424 25.29456771231829 90-94 26.159023979806477 23.845183003786286 23.979806478754735 26.015986537652502 95-99 26.819635132593568 24.4780891480158 22.982885085574573 25.719390633816065 100-104 26.29213483146067 24.205457463884432 24.794007490636705 24.70840021401819 105-109 26.67735569807597 23.914652195362603 24.457326097681303 24.95066600888012 110-114 26.407849829351537 24.2320819112628 24.01877133105802 25.341296928327644 115-119 26.393929396238864 24.232926426921807 24.44737710326625 24.925767073573077 120-124 26.747311827956988 24.711981566820278 23.9247311827957 24.615975422427034 125-129 26.63350666968121 23.762152385258876 24.46303413972417 25.141306805335745 130-134 26.005434782608695 24.809782608695652 24.782608695652176 24.40217391304348 135-139 24.710051546391753 23.969072164948454 26.868556701030926 24.452319587628864 140-144 27.055067837190744 24.102154828411813 24.90023942537909 23.942537909018355 145-149 24.98803255146003 24.317855433221638 26.0411680229775 24.652943992340834 150-154 28.324697754749568 25.676453655728267 22.394933793897525 23.60391479562464 155-159 24.96493688639551 25.8765778401122 23.071528751753156 26.08695652173913 160-164 25.893635571054922 23.016564952048824 26.329555361813426 24.760244115082823 165-169 25.108695652173914 25.43478260869565 24.456521739130434 25.0 170-174 25.66995768688293 23.695345557122707 27.50352609308886 23.1311706629055 175-179 25.938566552901023 25.085324232081913 22.696245733788395 26.27986348122867 180-184 28.913043478260867 22.39130434782609 23.91304347826087 24.782608695652176 185-189 29.559748427672954 23.270440251572328 22.641509433962266 24.528301886792452 190-194 26.29310344827586 26.72413793103448 23.275862068965516 23.70689655172414 195-199 22.22222222222222 27.513227513227513 28.04232804232804 22.22222222222222 200-204 30.76923076923077 20.27972027972028 26.573426573426573 22.377622377622377 205-209 19.82758620689655 27.586206896551722 33.62068965517241 18.96551724137931 210-214 33.33333333333333 24.444444444444443 21.11111111111111 21.11111111111111 215-219 27.536231884057973 21.73913043478261 28.985507246376812 21.73913043478261 220-224 35.714285714285715 21.428571428571427 16.666666666666664 26.190476190476193 225-229 25.0 25.0 29.166666666666668 20.833333333333336 230-234 11.11111111111111 44.44444444444444 22.22222222222222 22.22222222222222 235 0.0 0.0 0.0 100.0 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 2.0 16 3.0 17 3.0 18 2.5 19 4.0 20 6.0 21 5.0 22 3.5 23 3.5 24 4.0 25 3.5 26 3.0 27 3.5 28 6.0 29 9.0 30 9.5 31 11.5 32 16.0 33 22.5 34 27.0 35 36.5 36 47.5 37 54.5 38 61.5 39 69.66666666666667 40 89.0 41 117.5 42 144.16666666666666 43 156.5 44 175.66666666666669 45 191.83333333333334 46 199.83333333333334 47 208.66666666666666 48 215.16666666666666 49 221.5 50 216.50000000000003 51 200.66666666666669 52 192.16666666666666 53 209.50000000000003 54 213.83333333333331 55 186.5 56 174.0 57 169.0 58 171.5 59 172.0 60 158.83333333333331 61 157.33333333333334 62 153.33333333333334 63 139.0 64 119.5 65 109.5 66 108.0 67 99.5 68 80.0 69 73.5 70 67.0 71 50.0 72 36.5 73 23.0 74 22.5 75 22.0 76 19.0 77 14.0 78 7.5 79 3.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.5 86 1.0 87 1.0 88 2.0 89 3.0 90 3.0 91 3.0 92 2.5 93 2.0 94 2.0 95 1.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-159 0.0 160-164 0.0 165-169 0.0 170-174 0.0 175-179 0.0 180-184 0.0 185-189 0.0 190-194 0.0 195-199 0.0 200-204 0.0 205-209 0.0 210-214 0.0 215-219 0.0 220-224 0.0 225-229 0.0 230-234 0.0 235 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 5-9 10.0 10-14 42.0 15-19 44.0 20-24 31.0 25-29 29.0 30-34 33.0 35-39 36.0 40-44 43.0 45-49 54.0 50-54 56.0 55-59 61.0 60-64 110.0 65-69 136.0 70-74 182.0 75-79 202.0 80-84 238.0 85-89 208.0 90-94 257.0 95-99 269.0 100-104 233.0 105-109 243.0 110-114 201.0 115-119 174.0 120-124 160.0 125-129 156.0 130-134 124.0 135-139 117.0 140-144 106.0 145-149 68.0 150-154 70.0 155-159 60.0 160-164 44.0 165-169 47.0 170-174 29.0 175-179 20.0 180-184 34.0 185-189 22.0 190-194 11.0 195-199 9.0 200-204 7.0 205-209 4.0 210-214 5.0 215-219 3.0 220-224 7.0 225-229 2.0 230-234 2.0 235-236 1.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.00813835198372 97.32499999999999 2 0.7375381485249237 1.4500000000000002 3 0.1525940996948118 0.44999999999999996 4 0.025432349949135298 0.1 5 0.025432349949135298 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025432349949135298 0.22499999999999998 >10 0.025432349949135298 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACTCCAAGATCATCAACGACAGGGAGACTGGCCGTTCCCGCGGGTTCGGC 13 0.325 No Hit ATGGGGGCCGGCGATGCGTCCTGGCCGTATGCGGAACGGCTTTTGCTGGT 9 0.22499999999999998 No Hit ACCCAATCCTCTCGCCGACGCCGTAGCAACCTTTGAGAGAACGAGATCTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.0 0.0 0.0 0.0 0.0 80-84 0.0 0.0 0.0 0.0 0.0 85-89 0.0 0.0 0.0 0.0 0.0 90-94 0.0 0.0 0.0 0.0 0.0 95-99 0.0 0.0 0.0 0.0 0.0 100-104 0.0 0.0 0.0 0.0 0.0 105-109 0.0 0.0 0.0 0.0 0.0 110-114 0.0 0.0 0.0 0.0 0.0 115-119 0.0 0.0 0.0 0.0 0.0 120-124 0.0 0.0 0.0 0.0 0.0 125-129 0.0 0.0 0.0 0.0 0.0 130-134 0.0 0.0 0.0 0.0 0.0 135-139 0.0 0.0 0.0 0.0 0.0 140-144 0.0 0.0 0.0 0.0 0.0 145-149 0.0 0.0 0.0 0.0 0.0 150-154 0.0 0.0 0.0 0.0 0.0 155-159 0.0 0.0 0.0 0.0 0.0 160-164 0.0 0.0 0.0 0.0 0.0 165-169 0.0 0.0 0.0 0.0 0.0 170-174 0.0 0.0 0.0 0.0 0.0 175-179 0.0 0.0 0.0 0.0 0.0 180-184 0.0 0.0 0.0 0.0 0.0 185-189 0.0 0.0 0.0 0.0 0.0 190-194 0.0 0.0 0.0 0.0 0.0 195-199 0.0 0.0 0.0 0.0 0.0 200-204 0.0 0.0 0.0 0.0 0.0 205-209 0.0 0.0 0.0 0.0 0.0 210-214 0.0 0.0 0.0 0.0 0.0 215-219 0.0 0.0 0.0 0.0 0.0 220-223 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTTGA 5 0.0 7086.0 170 GCTGCCG 5 9.788092E-4 2362.0 150-154 GTGTTTT 5 0.0032620833 1417.2001 165-169 GGCGTGT 5 0.0032620833 1417.2001 165-169 CCACGGC 5 0.0032620833 1417.2001 160-164 TGTTTTG 5 0.0032620833 1417.2001 165-169 CTCCACG 5 0.0032620833 1417.2001 155-159 GCGTGTT 5 0.0032620833 1417.2001 165-169 CGGCGTG 5 0.0032620833 1417.2001 160-164 TCCACGG 5 0.0032620833 1417.2001 160-164 CGTGTTT 5 0.0032620833 1417.2001 165-169 GCTCCAC 5 0.0032620833 1417.2001 155-159 GAGGCTC 5 0.0032620833 1417.2001 155-159 CAGCACC 5 0.0048926645 1181.0 140-144 TCCGGGA 10 0.003914868 1181.0 150-154 AGGCTCC 15 0.0029367036 1181.0 155-159 GGCTCCA 10 0.003914868 1181.0 155-159 CACGGCG 10 0.003914868 1181.0 160-164 GATTTGG 5 0.009131256 885.75 145-149 ACGGCGT 10 0.007828264 885.75 160-164 >>END_MODULE Read 335317 spots for ERR1806566.sra Written 335317 spots for ERR1806566.sra Read 335317 spots for ERR1806566.sra Written 335317 spots for ERR1806566.sra Read 335317 spots for ERR1806566.sra Written 335317 spots for ERR1806566.sra Read 335317 spots for ERR1806566.sra Written 335317 spots for ERR1806566.sra Read 335317 spots for ERR1806566.sra Written 335317 spots for ERR1806566.sra Read 335317 spots for ERR1806566.sra Written 335317 spots for ERR1806566.sra Read 335317 spots for ERR1806566.sra Written 335317 spots for ERR1806566.sra Read 335317 spots for ERR1806566.sra Written 335317 spots for ERR1806566.sra Read 335317 spots for ERR1806566.sra Written 335317 spots for ERR1806566.sra Read 335317 spots for ERR1806566.sra Written 335317 spots for ERR1806566.sra Read 335325 spots for ERR1806566.sra Written 335325 spots for ERR1806566.sra Read 335317 spots for ERR1806566.sra Written 335317 spots for ERR1806566.sra Read 335317 spots for ERR1806566.sra Written 335317 spots for ERR1806566.sra Read 335317 spots for ERR1806566.sra Written 335317 spots for ERR1806566.sra Read 335317 spots for ERR1806566.sra Written 335317 spots for ERR1806566.sra Read 335317 spots for ERR1806566.sra Written 335317 spots for ERR1806566.sra Read 335317 spots for ERR1806566.sra Written 335317 spots for ERR1806566.sra Read 335317 spots for ERR1806566.sra Written 335317 spots for ERR1806566.sra Read 335317 spots for ERR1806566.sra Written 335317 spots for ERR1806566.sra Read 335317 spots for ERR1806566.sra Written 335317 spots for ERR1806566.sra SRR ids: ['ERR1806566.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1t2t6pa7 ERR1806566.sra spots: 6706348 blocks: [[1, 335317], [335318, 670634], [670635, 1005951], [1005952, 1341268], [1341269, 1676585], [1676586, 2011902], [2011903, 2347219], [2347220, 2682536], [2682537, 3017853], [3017854, 3353170], [3353171, 3688487], [3688488, 4023804], [4023805, 4359121], [4359122, 4694438], [4694439, 5029755], [5029756, 5365072], [5365073, 5700389], [5700390, 6035706], [6035707, 6371023], [6371024, 6706348]] ERR1806566 file size 1583873 ERR1806566 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1806566 ERR1806566_1.fastq Input file: ERR1806566_1.fastq trimmed: ERR1806566-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 16:45:57 2024 >> started Mon Dec 9 16:46:01 2024 >> done (3.598s) 6706348 reads processed; of these: 145622 ( 2.17%) short reads filtered out after trimming by size control 7 ( 0.00%) empty reads filtered out after trimming by size control 6560719 (97.83%) reads available; of these: 110302 ( 1.68%) trimmed reads available after processing 6450417 (98.32%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 12489 0.19% 19 12007 0.18% 20 11631 0.18% 21 11391 0.17% 22 11031 0.17% 23 10932 0.17% 24 12068 0.18% 25 11193 0.17% 26 11241 0.17% 27 11178 0.17% 28 11415 0.17% 29 11535 0.18% 30 12103 0.18% 31 11716 0.18% 32 11834 0.18% 33 12203 0.19% 34 12371 0.19% 35 12581 0.19% 36 12954 0.20% 37 13006 0.20% 38 12987 0.20% 39 14080 0.21% 40 13719 0.21% 41 14175 0.22% 42 16096 0.25% 43 15121 0.23% 44 15617 0.24% 45 16761 0.26% 46 17103 0.26% 47 17158 0.26% 48 18659 0.28% 49 19210 0.29% 50 19680 0.30% 51 21294 0.32% 52 22164 0.34% 53 22332 0.34% 54 24312 0.37% 55 25397 0.39% 56 26109 0.40% 57 28582 0.44% 58 28771 0.44% 59 30552 0.47% 60 33809 0.52% 61 34476 0.53% 62 35818 0.55% 63 39754 0.61% 64 39463 0.60% 65 40765 0.62% 66 43184 0.66% 67 44702 0.68% 68 46589 0.71% 69 49753 0.76% 70 51383 0.78% 71 52730 0.80% 72 57272 0.87% 73 56491 0.86% 74 60183 0.92% 75 61894 0.94% 76 63874 0.97% 77 73340 1.12% 78 74209 1.13% 79 67700 1.03% 80 69133 1.05% 81 72312 1.10% 82 76597 1.17% 83 74211 1.13% 84 76926 1.17% 85 79707 1.21% 86 76349 1.16% 87 78851 1.20% 88 79178 1.21% 89 80204 1.22% 90 86783 1.32% 91 81029 1.24% 92 81898 1.25% 93 88953 1.36% 94 82146 1.25% 95 82189 1.25% 96 84861 1.29% 97 80163 1.22% 98 80892 1.23% 99 81727 1.25% 100 82292 1.25% 101 81031 1.24% 102 80009 1.22% 103 84552 1.29% 104 77994 1.19% 105 76675 1.17% 106 74190 1.13% 107 73980 1.13% 108 73789 1.12% 109 73944 1.13% 110 71166 1.08% 111 71785 1.09% 112 70499 1.07% 113 66326 1.01% 114 69563 1.06% 115 65486 1.00% 116 63145 0.96% 117 62423 0.95% 118 60869 0.93% 119 59222 0.90% 120 58821 0.90% 121 55283 0.84% 122 54686 0.83% 123 53106 0.81% 124 52135 0.79% 125 50289 0.77% 126 49987 0.76% 127 48074 0.73% 128 46327 0.71% 129 46621 0.71% 130 44626 0.68% 131 42455 0.65% 132 42989 0.66% 133 41061 0.63% 134 40125 0.61% 135 38616 0.59% 136 36220 0.55% 137 36131 0.55% 138 36179 0.55% 139 34358 0.52% 140 34487 0.53% 141 32087 0.49% 142 30381 0.46% 143 29092 0.44% 144 28448 0.43% 145 27667 0.42% 146 27188 0.41% 147 26552 0.40% 148 25405 0.39% 149 23949 0.37% 150 23940 0.36% 151 22741 0.35% 152 22032 0.34% 153 21681 0.33% 154 20959 0.32% 155 20563 0.31% 156 19411 0.30% 157 19401 0.30% 158 17737 0.27% 159 17305 0.26% 160 16724 0.25% 161 16174 0.25% 162 15520 0.24% 163 14970 0.23% 164 14915 0.23% 165 14224 0.22% 166 13490 0.21% 167 13209 0.20% 168 13150 0.20% 169 12047 0.18% 170 11509 0.18% 171 11430 0.17% 172 11130 0.17% 173 10481 0.16% 174 10339 0.16% 175 9691 0.15% 176 9336 0.14% 177 9245 0.14% 178 8763 0.13% 179 8263 0.13% 180 7990 0.12% 181 7829 0.12% 182 7417 0.11% 183 7369 0.11% 184 6931 0.11% 185 6628 0.10% 186 6604 0.10% 187 6169 0.09% 188 5970 0.09% 189 5611 0.09% 190 5450 0.08% 191 5401 0.08% 192 4920 0.07% 193 4742 0.07% 194 4660 0.07% 195 4484 0.07% 196 4226 0.06% 197 4134 0.06% 198 3970 0.06% 199 3633 0.06% 200 3559 0.05% 201 3466 0.05% 202 3213 0.05% 203 3124 0.05% 204 3024 0.05% 205 2939 0.04% 206 2771 0.04% 207 2621 0.04% 208 2501 0.04% 209 2447 0.04% 210 2249 0.03% 211 2135 0.03% 212 1958 0.03% 213 1967 0.03% 214 1729 0.03% 215 1755 0.03% 216 1595 0.02% 217 1617 0.02% 218 1414 0.02% 219 1347 0.02% 220 1283 0.02% 221 1232 0.02% 222 1121 0.02% 223 1057 0.02% 224 947 0.01% 225 988 0.02% 226 903 0.01% 227 874 0.01% 228 798 0.01% 229 724 0.01% 230 679 0.01% 231 679 0.01% 232 641 0.01% 233 558 0.01% 234 481 0.01% 235 456 0.01% 236 427 0.01% 237 393 0.01% 238 356 0.01% 239 342 0.01% 240 298 0.00% 241 282 0.00% 242 270 0.00% 243 237 0.00% 244 221 0.00% 245 174 0.00% 246 167 0.00% 247 174 0.00% 248 160 0.00% 249 120 0.00% 250 110 0.00% 251 92 0.00% 252 100 0.00% 253 98 0.00% 254 95 0.00% 255 72 0.00% 256 71 0.00% 257 59 0.00% 258 65 0.00% 259 48 0.00% 260 45 0.00% 261 40 0.00% 262 41 0.00% 263 35 0.00% 264 30 0.00% 265 32 0.00% 266 17 0.00% 267 21 0.00% 268 15 0.00% 269 13 0.00% 270 9 0.00% 271 15 0.00% 272 13 0.00% 273 7 0.00% 274 3 0.00% 275 4 0.00% 276 3 0.00% 277 2 0.00% 278 3 0.00% 279 2 0.00% 280 4 0.00% 281 3 0.00% 282 3 0.00% 283 2 0.00% 284 1 0.00% 285 3 0.00% 286 1 0.00% 287 1 0.00% 288 0 0.00% 289 0 0.00% 290 1 0.00% 291 1 0.00% 292 0 0.00% 293 0 0.00% 294 0 0.00% 295 0 0.00% 296 0 0.00% 297 0 0.00% 298 0 0.00% 299 0 0.00% 300 0 0.00% 301 0 0.00% 302 0 0.00% 303 0 0.00% 304 0 0.00% 305 1 0.00% 306 0 0.00% 307 1 0.00% 308 0 0.00% 309 0 0.00% 310 0 0.00% 311 1 0.00% 312 0 0.00% 313 0 0.00% 314 1 0.00% 315 0 0.00% 316 1 0.00% 317 0 0.00% 318 0 0.00% 319 0 0.00% 320 0 0.00% 321 0 0.00% 322 0 0.00% 323 0 0.00% 324 0 0.00% 325 0 0.00% 326 0 0.00% 327 0 0.00% 328 0 0.00% 329 0 0.00% 330 0 0.00% 331 0 0.00% 332 0 0.00% 333 0 0.00% 334 0 0.00% 335 0 0.00% 336 0 0.00% 337 1 0.00% 338 0 0.00% 339 0 0.00% 340 0 0.00% 341 0 0.00% 342 0 0.00% 343 0 0.00% 344 1 0.00% 6560719 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=4.60 fanout-score-rank=25 prefix-density=0.36 prefix-fanout=3.8 sequence=GGCAAGACCATCACCCTTGAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=694.51 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=23.0 sequence=CAGCAGCAGAGAGCCGGAGCGCCACCAGCCATCCGATCAAAACACACAGATCAATCCGATGGCTCTCGCTCTCTCCGGTTCCTCGGCTGCTGCCCGCGCGCTGGCCCAGCTGCTGGCCCCGTCCACCAGAAG Started job on | Dec 09 16:47:22 Started mapping on | Dec 09 16:47:22 Finished on | Dec 09 16:47:34 Mapping speed, Million of reads per hour | 1968.22 Number of input reads | 6560719 Average input read length | 101 UNIQUE READS: Uniquely mapped reads number | 5167989 Uniquely mapped reads % | 78.77% Average mapped length | 95.44 Number of splices: Total | 1607653 Number of splices: Annotated (sjdb) | 1509025 Number of splices: GT/AG | 1573336 Number of splices: GC/AG | 17301 Number of splices: AT/AC | 1278 Number of splices: Non-canonical | 15738 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.15% Deletion average length | 1.10 Insertion rate per base | 0.12% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 149640 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 141631 % of reads mapped to too many loci | 2.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 16.32% % of reads unmapped: other | 0.47% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1243090 1243090 1243090 N_multimapping 149640 149640 149640 N_noFeature 149192 202490 5043943 N_ambiguous 81174 11075 501 UnstrandedReadsAssigned:4937623 PositiveStrandReadsAssigned:4954424 NegativeStrandReadsAssigned:123545 Dataset is classified positive stranded MeadianReadLen=99 20thPercentileLength=74 echo kmer=69 ERR1806566 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR1806566-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,560,719 reads, 5,211,750 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 984 rounds 52973 ERR1806566.ke.tsv 35125 ERR1806566.se.tsv 88098 total ==> ERR1806566.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 77.7984 26.7695 PNS24247 1044 945 15.906 4.84757 PNS24249 1928 1829 55.983 8.81532 PNS24246 1044 945 15.906 4.84757 PNS24248 1044 945 15.906 4.84757 PNS24244 1471 1372 41.5008 8.71159 PNS24243 293 194 0 0 KQK14069 1603 1504 2236.88 428.341 KQK14071 474 375 122.621 94.1735 ==> ERR1806566.se.tsv <== BRADI_1g14170v3 2402 BRADI_1g53295v3 45 BRADI_1g59795v3 80 BRADI_1g07683v3 0 BRADI_1g00485v3 14 BRADI_1g20270v3 524 BRADI_1g74790v3 123 BRADI_1g09890v3 0 BRADI_1g77505v3 110 BRADI_1g48960v3 0 ERR1806566 completed mapping pipeline successfully