Starting /dee2/code/volunteer_pipeline.sh ERR1806567 current disk space = 1523470913536 free memory = 1580422928 ERR1806567 SRAfilesize 364b19545f45198df232797fa22dc673 ERR1806567.sra ERR1806567.sra file validated ERR1806567 is single end ERR1806567 is conventional basespace ERR1806567 read1 length is 8-236 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1806567_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 8-236 %GC 52 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.22475 24.0 21.0 26.0 18.0 28.0 2 23.30625 25.0 20.0 27.0 16.0 28.0 3 23.08325 24.0 20.0 27.0 16.0 28.0 4 23.27575 24.0 20.0 27.0 16.0 28.0 5 23.2565 24.0 21.0 26.0 17.0 28.0 6 23.25475 24.0 21.0 27.0 16.0 28.0 7 23.06225 24.0 20.0 26.0 16.0 28.0 8 23.14 24.0 21.0 26.0 16.0 28.0 9 23.10705352676338 24.0 20.0 26.0 16.0 28.0 10-14 23.121856065378932 24.0 20.2 26.0 16.2 28.0 15-19 23.21832959752017 24.2 20.8 26.2 16.8 28.0 20-24 23.312734820527698 24.4 21.0 26.0 17.0 28.0 25-29 23.25202770521579 24.6 20.8 26.0 17.0 28.0 30-34 23.105012923829346 24.0 20.4 26.0 16.4 27.6 35-39 23.02067779141127 24.0 20.0 26.0 16.2 27.4 40-44 22.982446065471652 24.0 20.0 26.0 16.2 27.0 45-49 23.003826337296026 24.0 20.0 26.0 16.6 27.0 50-54 22.828650832974002 24.0 20.0 26.0 16.0 27.0 55-59 22.812357508358975 24.0 20.0 26.0 16.2 27.0 60-64 22.827369758066077 24.0 20.0 26.0 16.2 27.0 65-69 22.798305508918396 24.0 20.0 26.0 16.4 27.0 70-74 22.77624350139563 24.0 20.0 26.0 16.4 27.0 75-79 22.728718184022014 24.0 20.0 26.0 16.2 27.0 80-84 22.720194424824438 24.0 20.0 26.0 16.4 27.0 85-89 22.575446048810456 24.0 20.0 26.0 16.0 27.0 90-94 22.53498542899554 24.0 20.0 26.0 16.0 27.0 95-99 22.536507046786067 23.6 20.0 26.0 16.0 27.0 100-104 22.52231665752896 23.6 20.0 26.0 16.0 27.0 105-109 22.48413644059224 23.8 20.0 26.0 16.0 27.0 110-114 22.235196991863084 23.2 19.8 26.0 15.4 27.0 115-119 22.163034423506492 23.0 19.8 26.0 15.8 27.0 120-124 22.072843967209348 23.0 19.6 26.0 15.4 27.0 125-129 21.920869687070468 23.0 19.4 25.0 14.6 27.0 130-134 21.819528273766043 22.8 19.0 25.0 14.6 27.0 135-139 21.69562942656711 22.2 19.2 25.0 15.0 26.8 140-144 21.391566377532506 22.0 19.0 25.0 14.0 26.2 145-149 21.218663539901605 22.0 19.0 24.8 14.0 26.0 150-154 21.03105618019096 21.8 18.4 24.6 13.8 26.0 155-159 20.859021844674867 21.6 18.2 24.2 13.8 26.0 160-164 20.435744128497703 21.0 17.2 24.0 13.2 25.8 165-169 20.138777230604326 20.4 17.6 23.8 13.4 25.2 170-174 20.06702433336118 20.8 17.0 23.8 12.8 25.2 175-179 19.99470418695883 20.8 17.2 23.6 13.0 25.0 180-184 20.393620866916834 21.0 17.6 23.6 13.6 25.6 185-189 20.153772628823724 20.6 17.4 23.2 13.2 25.0 190-194 19.570372984303248 NaN NaN NaN NaN NaN 195-199 19.073229904049175 NaN NaN NaN NaN NaN 200-204 18.69148150191909 NaN NaN NaN NaN NaN 205-209 17.99520626432391 NaN NaN NaN NaN NaN 210-214 17.26953167231805 NaN NaN NaN NaN NaN 215-219 17.58863636363636 NaN NaN NaN NaN NaN 220-224 20.04 NaN NaN NaN NaN NaN 225-229 19.4 NaN NaN NaN NaN NaN 230-234 20.0 NaN NaN NaN NaN NaN 235-236 20.5 NaN NaN NaN NaN NaN >>END_MODULE >>Per sequence quality scores warn #Quality Count 10 1.0 11 1.0 12 1.0 13 5.0 14 6.0 15 10.0 16 29.0 17 63.0 18 158.0 19 225.0 20 335.0 21 460.0 22 600.0 23 766.0 24 731.0 25 513.0 26 93.0 27 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.75 44.45 16.6 13.200000000000001 2 42.65 36.449999999999996 5.775 15.125 3 30.625000000000004 33.1 17.575 18.7 4 36.275 28.1 15.2 20.424999999999997 5 28.075 27.175 16.55 28.199999999999996 6 26.025 30.225 19.15 24.6 7 23.724999999999998 30.725 23.9 21.65 8 25.2 26.25 21.45 27.1 9 23.88694347173587 24.487243621810904 22.861430715357677 28.76438219109555 10-14 26.650280898876407 24.919743178170144 22.993579454253613 25.43639646869984 15-19 27.867446787047314 24.437607182487643 22.46040552809442 25.234540502370624 20-24 27.910758753875083 24.500686080195152 21.944402093815114 25.64415307211465 25-29 27.549084943866305 24.49889783154765 22.750807402470908 25.20120982211514 30-34 27.18717683557394 24.596690796277144 22.507755946225437 25.708376421923475 35-39 27.881293834397567 24.044802679786454 22.40133989322726 25.672563592588716 40-44 27.162326987325663 23.943363207297025 23.116084212759187 25.778225592618124 45-49 27.71357598012744 23.77146560103683 23.19364942218382 25.321308996651908 50-54 27.204668061213255 23.97335682043378 22.5421116371243 26.27986348122867 55-59 27.59608900876602 24.230164081816138 22.493818835693414 25.679928073724433 60-64 27.25639093385891 23.587038432554635 23.18706161961625 25.969509013970203 65-69 27.389144874633477 23.7029501525941 23.122494165519715 25.785410807252706 70-74 27.423358570187418 23.594389971453396 23.17860245749038 25.803649000868813 75-79 26.371046625366805 23.997391587870883 23.436582980110856 26.194978806651452 80-84 26.42646756627166 23.73450236317556 23.54955818891705 26.289471881635727 85-89 27.360600158695807 24.136189857895115 22.816129264949865 25.68708071845921 90-94 26.883785236961366 24.2338121207466 23.29672017820109 25.585682464090944 95-99 26.703132769766285 24.183656555610806 23.313442731642635 25.799767942980274 100-104 27.991395536434528 24.62131397329031 22.28197544142691 25.105315048848258 105-109 26.78432137285491 24.629485179407176 22.903666146645865 25.682527301092044 110-114 27.218302330553772 24.3959803292709 22.85653196493479 25.529185375240537 115-119 27.31753109598686 24.81811781272002 22.57685989204412 25.287491199249 120-124 26.855305466237944 24.617363344051448 22.443729903536976 26.083601286173636 125-129 26.876898596846523 24.938521625922174 22.739765658903515 25.44481411832779 130-134 26.30359212050985 24.780665452739612 23.059096176129778 25.856646250620756 135-139 27.05155435412242 24.232477312222436 23.595288665765594 25.120679667889554 140-144 25.571080062098027 24.46218673763584 23.57507207806609 26.391661122200045 145-149 26.500128766417717 25.75328354365182 23.332474890548546 24.414112799381922 150-154 26.28850259225374 25.52607502287283 23.75724306190912 24.42817932296432 155-159 26.730135481508604 24.935920908092275 23.324789454412304 25.009154155986817 160-164 25.021758050478677 25.195822454308093 24.54308093994778 25.23933855526545 165-169 26.561651276480173 24.98642042368278 22.37914177077675 26.072786529060295 170-174 26.90391459074733 26.120996441281143 23.558718861209965 23.416370106761565 175-179 26.183574879227052 22.801932367149757 25.02415458937198 25.99033816425121 180-184 27.471116816431323 27.856225930680363 22.978177150192554 21.694480102695763 185-189 26.74616695059625 24.87223168654174 22.998296422487225 25.383304940374785 190-194 25.170068027210885 25.623582766439913 24.03628117913832 25.170068027210885 195-199 25.082508250825082 26.732673267326735 24.752475247524753 23.432343234323433 200-204 25.125628140703515 30.15075376884422 23.618090452261306 21.105527638190953 205-209 27.659574468085108 24.822695035460992 25.53191489361702 21.98581560283688 210-214 24.444444444444443 26.666666666666668 26.666666666666668 22.22222222222222 215-219 19.047619047619047 30.952380952380953 26.190476190476193 23.809523809523807 220-224 52.17391304347826 8.695652173913043 26.08695652173913 13.043478260869565 225-229 10.0 30.0 30.0 30.0 230-234 42.857142857142854 42.857142857142854 0.0 14.285714285714285 235-236 50.0 50.0 0.0 0.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 1.0 15 1.5 16 2.0 17 2.0 18 2.0 19 2.0 20 2.5 21 2.5 22 2.0 23 2.0 24 2.0 25 3.0 26 5.0 27 7.5 28 10.5 29 12.5 30 14.0 31 19.5 32 22.5 33 22.5 34 29.0 35 34.0 36 42.0 37 47.833333333333336 38 58.833333333333336 39 80.83333333333333 40 95.16666666666667 41 105.5 42 115.66666666666667 43 127.5 44 157.0 45 173.5 46 180.66666666666663 47 197.0 48 202.66666666666669 49 198.16666666666669 50 186.33333333333331 51 186.16666666666666 52 196.16666666666669 53 206.5 54 192.50000000000003 55 176.83333333333334 56 181.66666666666666 57 164.33333333333334 58 152.5 59 156.83333333333331 60 149.33333333333331 61 143.0 62 130.5 63 130.5 64 123.0 65 109.83333333333334 66 114.83333333333334 67 117.0 68 97.0 69 74.0 70 66.0 71 58.0 72 40.0 73 23.5 74 20.0 75 18.5 76 17.5 77 15.0 78 11.5 79 8.0 80 3.0 81 0.5 82 0.0 83 0.0 84 0.5 85 1.0 86 1.0 87 1.0 88 1.0 89 1.0 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-159 0.0 160-164 0.0 165-169 0.0 170-174 0.0 175-179 0.0 180-184 0.0 185-189 0.0 190-194 0.0 195-199 0.0 200-204 0.0 205-209 0.0 210-214 0.0 215-219 0.0 220-224 0.0 225-229 0.0 230-234 0.0 235-236 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 5-9 3.0 10-14 23.0 15-19 26.0 20-24 33.0 25-29 33.0 30-34 37.0 35-39 51.0 40-44 66.0 45-49 67.0 50-54 69.0 55-59 95.0 60-64 121.0 65-69 98.0 70-74 144.0 75-79 159.0 80-84 140.0 85-89 160.0 90-94 188.0 95-99 182.0 100-104 186.0 105-109 177.0 110-114 172.0 115-119 154.0 120-124 158.0 125-129 178.0 130-134 181.0 135-139 145.0 140-144 125.0 145-149 131.0 150-154 111.0 155-159 93.0 160-164 83.0 165-169 98.0 170-174 83.0 175-179 58.0 180-184 38.0 185-189 36.0 190-194 29.0 195-199 24.0 200-204 11.0 205-209 12.0 210-214 11.0 215-219 4.0 220-224 5.0 225-229 0.0 230-234 1.0 235-237 1.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1123510017753 97.7 2 0.6593963986812071 1.3 3 0.1521683996956632 0.44999999999999996 4 0.0 0.0 5 0.025361399949277198 0.125 6 0.025361399949277198 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025361399949277198 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACTCCAAGATCATCAACGACAGGGAGACTGGCCGTTCCCGCGGGTTCGGC 11 0.27499999999999997 No Hit ATGGGGGCCGGCGATGCGTCCTGGCCGTATGCGGAACGGCTTTTGCTGGT 6 0.15 No Hit GTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCAAGGAAGCTGACGAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.0 0.0 0.0 0.0 0.0 80-84 0.0 0.0 0.0 0.0 0.0 85-89 0.0 0.0 0.0 0.0 0.0 90-94 0.0 0.0 0.0 0.0 0.0 95-99 0.0 0.0 0.0 0.0 0.0 100-104 0.0 0.0 0.0 0.0 0.0 105-109 0.0 0.0 0.0 0.0 0.0 110-114 0.0 0.0 0.0 0.0 0.0 115-119 0.0 0.0 0.0 0.0 0.0 120-124 0.0 0.0 0.0 0.0 0.0 125-129 0.0 0.0 0.0 0.0 0.0 130-134 0.0 0.0 0.0 0.0 0.0 135-139 0.0 0.0 0.0 0.0 0.0 140-144 0.0 0.0 0.0 0.0 0.0 145-149 0.0 0.0 0.0 0.0 0.0 150-154 0.0 0.0 0.01 0.0 0.0 155-159 0.0 0.0 0.025 0.0 0.0 160-164 0.0 0.0 0.025 0.0 0.0 165-169 0.0 0.0 0.025 0.0 0.0 170-174 0.0 0.0 0.025 0.0 0.0 175-179 0.0 0.0 0.025 0.0 0.0 180-184 0.0 0.0 0.025 0.0 0.0 185-189 0.0 0.0 0.025 0.0 0.0 190-194 0.0 0.0 0.025 0.0 0.0 195-199 0.0 0.0 0.025 0.0 0.0 200-204 0.0 0.0 0.025 0.0 0.0 205-209 0.0 0.0 0.025 0.0 0.0 210-214 0.0 0.0 0.025 0.0 0.0 215-219 0.0 0.0 0.025 0.0 0.0 220-224 0.0 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGAACC 5 6.8914023E-4 2815.0 180-184 GTGGACC 5 6.8914023E-4 2815.0 180-184 TTTCTGT 5 0.0022967714 1689.0 185-189 TTCTGTA 5 0.0022967714 1689.0 190-194 GTACAAC 5 0.0022967714 1689.0 190-194 CATTTCT 5 0.0022967714 1689.0 185-189 TCTGTAC 5 0.0022967714 1689.0 190-194 TCATTTC 5 0.0022967714 1689.0 185-189 ATTTCTG 5 0.0022967714 1689.0 185-189 CTGTACA 5 0.0022967714 1689.0 190-194 GAGCTCA 5 0.0048224586 1206.4286 180-184 GCTCATT 5 0.0048224586 1206.4286 180-184 ACTGATG 15 0.0062012826 938.3333 175-179 TGGAGCT 15 0.0062012826 938.3333 180-184 GAACTGG 10 0.00918491 844.5 165-169 CTCATTT 10 0.00918491 844.5 185-189 GATGGAG 15 1.6120034E-4 469.16666 175-179 >>END_MODULE Read 311135 spots for ERR1806567.sra Written 311135 spots for ERR1806567.sra Read 311135 spots for ERR1806567.sra Written 311135 spots for ERR1806567.sra Read 311135 spots for ERR1806567.sra Written 311135 spots for ERR1806567.sra Read 311135 spots for ERR1806567.sra Written 311135 spots for ERR1806567.sra Read 311135 spots for ERR1806567.sra Written 311135 spots for ERR1806567.sra Read 311135 spots for ERR1806567.sra Written 311135 spots for ERR1806567.sra Read 311135 spots for ERR1806567.sra Written 311135 spots for ERR1806567.sra Read 311139 spots for ERR1806567.sra Written 311139 spots for ERR1806567.sra Read 311135 spots for ERR1806567.sra Written 311135 spots for ERR1806567.sra Read 311135 spots for ERR1806567.sra Written 311135 spots for ERR1806567.sra Read 311135 spots for ERR1806567.sra Written 311135 spots for ERR1806567.sra Read 311135 spots for ERR1806567.sra Written 311135 spots for ERR1806567.sra Read 311135 spots for ERR1806567.sra Written 311135 spots for ERR1806567.sra Read 311135 spots for ERR1806567.sra Written 311135 spots for ERR1806567.sra Read 311135 spots for ERR1806567.sra Written 311135 spots for ERR1806567.sra Read 311135 spots for ERR1806567.sra Written 311135 spots for ERR1806567.sra Read 311135 spots for ERR1806567.sra Written 311135 spots for ERR1806567.sra Read 311135 spots for ERR1806567.sra Written 311135 spots for ERR1806567.sra Read 311135 spots for ERR1806567.sra Written 311135 spots for ERR1806567.sra Read 311135 spots for ERR1806567.sra Written 311135 spots for ERR1806567.sra SRR ids: ['ERR1806567.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5bagvhoe ERR1806567.sra spots: 6222704 blocks: [[1, 311135], [311136, 622270], [622271, 933405], [933406, 1244540], [1244541, 1555675], [1555676, 1866810], [1866811, 2177945], [2177946, 2489080], [2489081, 2800215], [2800216, 3111350], [3111351, 3422485], [3422486, 3733620], [3733621, 4044755], [4044756, 4355890], [4355891, 4667025], [4667026, 4978160], [4978161, 5289295], [5289296, 5600430], [5600431, 5911565], [5911566, 6222704]] ERR1806567 file size 1592396 ERR1806567 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1806567 ERR1806567_1.fastq Input file: ERR1806567_1.fastq trimmed: ERR1806567-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 16:48:18 2024 >> started Mon Dec 9 16:48:22 2024 >> done (3.694s) 6222704 reads processed; of these: 81623 ( 1.31%) short reads filtered out after trimming by size control 1 ( 0.00%) empty reads filtered out after trimming by size control 6141080 (98.69%) reads available; of these: 146252 ( 2.38%) trimmed reads available after processing 5994828 (97.62%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 9879 0.16% 19 10095 0.16% 20 9848 0.16% 21 10174 0.17% 22 10113 0.16% 23 10187 0.17% 24 12164 0.20% 25 10578 0.17% 26 10881 0.18% 27 11287 0.18% 28 11404 0.19% 29 11684 0.19% 30 12026 0.20% 31 12070 0.20% 32 12503 0.20% 33 13088 0.21% 34 13423 0.22% 35 13220 0.22% 36 14258 0.23% 37 13983 0.23% 38 14613 0.24% 39 15472 0.25% 40 15562 0.25% 41 15965 0.26% 42 17421 0.28% 43 17516 0.29% 44 17926 0.29% 45 19244 0.31% 46 19400 0.32% 47 19860 0.32% 48 21456 0.35% 49 21669 0.35% 50 22044 0.36% 51 23357 0.38% 52 23702 0.39% 53 24381 0.40% 54 25649 0.42% 55 26429 0.43% 56 26984 0.44% 57 28674 0.47% 58 29267 0.48% 59 30011 0.49% 60 32846 0.53% 61 32834 0.53% 62 32073 0.52% 63 35100 0.57% 64 34163 0.56% 65 34595 0.56% 66 35971 0.59% 67 36832 0.60% 68 37643 0.61% 69 39173 0.64% 70 39218 0.64% 71 39879 0.65% 72 41621 0.68% 73 41151 0.67% 74 43488 0.71% 75 42959 0.70% 76 43871 0.71% 77 47751 0.78% 78 48927 0.80% 79 45402 0.74% 80 45850 0.75% 81 46116 0.75% 82 48658 0.79% 83 47933 0.78% 84 49237 0.80% 85 49566 0.81% 86 48520 0.79% 87 49973 0.81% 88 50279 0.82% 89 49871 0.81% 90 54260 0.88% 91 51835 0.84% 92 51066 0.83% 93 54170 0.88% 94 52173 0.85% 95 51636 0.84% 96 52677 0.86% 97 51539 0.84% 98 52430 0.85% 99 52992 0.86% 100 52943 0.86% 101 53561 0.87% 102 54723 0.89% 103 56595 0.92% 104 53275 0.87% 105 53583 0.87% 106 52265 0.85% 107 52825 0.86% 108 54075 0.88% 109 55439 0.90% 110 53310 0.87% 111 53929 0.88% 112 53860 0.88% 113 52067 0.85% 114 53596 0.87% 115 53454 0.87% 116 53126 0.87% 117 52784 0.86% 118 50900 0.83% 119 51088 0.83% 120 53002 0.86% 121 50340 0.82% 122 50499 0.82% 123 49616 0.81% 124 49434 0.80% 125 48681 0.79% 126 49822 0.81% 127 48987 0.80% 128 48033 0.78% 129 49420 0.80% 130 48225 0.79% 131 46947 0.76% 132 48323 0.79% 133 47533 0.77% 134 46261 0.75% 135 46351 0.75% 136 43523 0.71% 137 43882 0.71% 138 45760 0.75% 139 44524 0.73% 140 43417 0.71% 141 43065 0.70% 142 41779 0.68% 143 40686 0.66% 144 40817 0.66% 145 40293 0.66% 146 39494 0.64% 147 41576 0.68% 148 38522 0.63% 149 37185 0.61% 150 37721 0.61% 151 36579 0.60% 152 36175 0.59% 153 36078 0.59% 154 35554 0.58% 155 34746 0.57% 156 34707 0.57% 157 34342 0.56% 158 32269 0.53% 159 31448 0.51% 160 31262 0.51% 161 30498 0.50% 162 29943 0.49% 163 29538 0.48% 164 28980 0.47% 165 27712 0.45% 166 27269 0.44% 167 27052 0.44% 168 25709 0.42% 169 25232 0.41% 170 24399 0.40% 171 23651 0.39% 172 23193 0.38% 173 22370 0.36% 174 21940 0.36% 175 21101 0.34% 176 20368 0.33% 177 19938 0.32% 178 19160 0.31% 179 18275 0.30% 180 18008 0.29% 181 17128 0.28% 182 16212 0.26% 183 15908 0.26% 184 15241 0.25% 185 14585 0.24% 186 14217 0.23% 187 13637 0.22% 188 13251 0.22% 189 12523 0.20% 190 12090 0.20% 191 11760 0.19% 192 11334 0.18% 193 10497 0.17% 194 10112 0.16% 195 9652 0.16% 196 9177 0.15% 197 8715 0.14% 198 7971 0.13% 199 7586 0.12% 200 7300 0.12% 201 6899 0.11% 202 6617 0.11% 203 6159 0.10% 204 5964 0.10% 205 5516 0.09% 206 5169 0.08% 207 4793 0.08% 208 4521 0.07% 209 4368 0.07% 210 3987 0.06% 211 3687 0.06% 212 3450 0.06% 213 3136 0.05% 214 2952 0.05% 215 2687 0.04% 216 2476 0.04% 217 2372 0.04% 218 2118 0.03% 219 1978 0.03% 220 1776 0.03% 221 1642 0.03% 222 1444 0.02% 223 1354 0.02% 224 1246 0.02% 225 1175 0.02% 226 1025 0.02% 227 970 0.02% 228 863 0.01% 229 806 0.01% 230 722 0.01% 231 675 0.01% 232 535 0.01% 233 520 0.01% 234 453 0.01% 235 414 0.01% 236 383 0.01% 237 330 0.01% 238 290 0.00% 239 286 0.00% 240 231 0.00% 241 210 0.00% 242 217 0.00% 243 185 0.00% 244 153 0.00% 245 141 0.00% 246 117 0.00% 247 90 0.00% 248 86 0.00% 249 88 0.00% 250 70 0.00% 251 59 0.00% 252 53 0.00% 253 40 0.00% 254 32 0.00% 255 36 0.00% 256 28 0.00% 257 29 0.00% 258 21 0.00% 259 29 0.00% 260 17 0.00% 261 17 0.00% 262 13 0.00% 263 11 0.00% 264 11 0.00% 265 12 0.00% 266 5 0.00% 267 11 0.00% 268 8 0.00% 269 1 0.00% 270 6 0.00% 271 3 0.00% 272 4 0.00% 273 3 0.00% 274 2 0.00% 275 4 0.00% 276 2 0.00% 277 0 0.00% 278 3 0.00% 279 0 0.00% 280 1 0.00% 281 1 0.00% 282 1 0.00% 283 1 0.00% 284 1 0.00% 285 1 0.00% 286 1 0.00% 287 1 0.00% 288 1 0.00% 289 1 0.00% 290 0 0.00% 291 1 0.00% 292 0 0.00% 293 0 0.00% 294 1 0.00% 295 0 0.00% 296 1 0.00% 297 0 0.00% 298 0 0.00% 299 0 0.00% 300 0 0.00% 301 0 0.00% 302 0 0.00% 303 1 0.00% 304 0 0.00% 305 1 0.00% 306 1 0.00% 307 0 0.00% 308 0 0.00% 309 0 0.00% 310 1 0.00% 311 0 0.00% 312 0 0.00% 313 0 0.00% 314 0 0.00% 315 0 0.00% 316 2 0.00% 317 0 0.00% 318 0 0.00% 319 0 0.00% 320 0 0.00% 321 0 0.00% 322 0 0.00% 323 0 0.00% 324 0 0.00% 325 0 0.00% 326 0 0.00% 327 0 0.00% 328 0 0.00% 329 0 0.00% 330 0 0.00% 331 0 0.00% 332 0 0.00% 333 0 0.00% 334 0 0.00% 335 0 0.00% 336 0 0.00% 337 0 0.00% 338 0 0.00% 339 0 0.00% 340 0 0.00% 341 1 0.00% 342 0 0.00% 343 0 0.00% 344 0 0.00% 345 0 0.00% 346 0 0.00% 347 0 0.00% 348 1 0.00% 6141080 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=4.35 fanout-score-rank=26 prefix-density=0.29 prefix-fanout=3.6 sequence=GACTACAACATCCAGAAGGAGTCCACCCTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=24 fanout-score=98.46 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=11.8 sequence=GACAAGAAGAAAGCCTCTGTCTTCTTCAAGACTTCTGCTGATGGACACATCTCATGTGCTAAGGAGATGACAAAGGTCTCTGGTATCTCTGAAATCATCCCGGAGATGGAGGTCTGTGACTTCGACTTTGAGCCCTGCGGCTACTCCATGAACGCCATCCATGGATCTGCGTTCTCTACAATCCATGTGACCCCTGAGGACGGCTTCAGCTATGCCAGCTACGAAGTCATGGGCATCGACGCTTCTGCC Started job on | Dec 09 16:48:45 Started mapping on | Dec 09 16:48:45 Finished on | Dec 09 16:49:02 Mapping speed, Million of reads per hour | 1300.46 Number of input reads | 6141080 Average input read length | 111 UNIQUE READS: Uniquely mapped reads number | 4834139 Uniquely mapped reads % | 78.72% Average mapped length | 102.99 Number of splices: Total | 1636280 Number of splices: Annotated (sjdb) | 1534072 Number of splices: GT/AG | 1594725 Number of splices: GC/AG | 19225 Number of splices: AT/AC | 1469 Number of splices: Non-canonical | 20861 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.20% Deletion average length | 1.11 Insertion rate per base | 0.21% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 150959 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 87859 % of reads mapped to too many loci | 1.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 16.83% % of reads unmapped: other | 0.56% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1155982 1155982 1155982 N_multimapping 150959 150959 150959 N_noFeature 126814 168437 4726493 N_ambiguous 76798 11224 427 UnstrandedReadsAssigned:4630527 PositiveStrandReadsAssigned:4654478 NegativeStrandReadsAssigned:107219 Dataset is classified positive stranded MeadianReadLen=109 20thPercentileLength=73 echo kmer=69 ERR1806567 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR1806567-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,141,080 reads, 4,976,459 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,084 rounds 52973 ERR1806567.ke.tsv 35125 ERR1806567.se.tsv 88098 total ==> ERR1806567.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 44.3304 15.5727 PNS24247 1044 945 14.5833 4.53747 PNS24249 1928 1829 88.292 14.1937 PNS24246 1044 945 14.5833 4.53747 PNS24248 1044 945 14.5833 4.53747 PNS24244 1471 1372 33.6277 7.20661 PNS24243 293 194 0 0 KQK14069 1603 1504 943.509 184.454 KQK14071 474 375 123.504 96.8359 ==> ERR1806567.se.tsv <== BRADI_1g14170v3 1074 BRADI_1g53295v3 39 BRADI_1g59795v3 69 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 519 BRADI_1g74790v3 80 BRADI_1g09890v3 0 BRADI_1g77505v3 105 BRADI_1g48960v3 0 ERR1806567 completed mapping pipeline successfully