Starting /dee2/code/volunteer_pipeline.sh ERR1806568 current disk space = 1523638427648 free memory = 1605431896 ERR1806568 SRAfilesize c3b1f475983716f058a91530bf1108e8 ERR1806568.sra ERR1806568.sra file validated ERR1806568 is single end ERR1806568 is conventional basespace ERR1806568 read1 length is 8-267 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1806568_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 8-267 %GC 51 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.37925 24.0 21.0 26.0 18.0 27.0 2 23.33725 25.0 20.0 27.0 16.0 28.0 3 23.04225 24.0 20.0 27.0 16.0 28.0 4 23.35225 25.0 21.0 27.0 16.0 28.0 5 23.21375 25.0 20.0 27.0 16.0 28.0 6 23.25 25.0 20.0 27.0 16.0 28.0 7 23.08125 24.0 20.0 27.0 16.0 28.0 8 23.085 24.0 20.0 27.0 16.0 28.0 9 23.090704084189426 24.0 20.0 27.0 16.0 28.0 10-14 23.206063965312484 24.8 20.4 27.0 16.0 28.0 15-19 23.440668319460265 25.0 21.0 27.0 16.8 28.0 20-24 23.615982529302684 25.0 21.0 27.0 17.2 28.0 25-29 23.6888098755935 25.0 21.0 27.0 17.8 28.0 30-34 23.608524877702116 25.0 21.0 27.0 17.2 28.0 35-39 23.662900793084837 25.0 21.0 27.0 17.6 28.0 40-44 23.645092790638436 25.0 21.0 27.0 17.8 28.0 45-49 23.58746127314072 25.0 21.0 27.0 17.4 28.0 50-54 23.577488922354267 25.0 21.0 27.0 17.6 28.0 55-59 23.692599558242534 25.0 21.0 27.0 17.8 28.0 60-64 23.722575740287837 25.0 21.0 27.0 18.0 28.0 65-69 23.596988350917723 25.0 21.0 26.4 18.0 28.0 70-74 23.54235417380314 25.0 21.0 26.6 18.0 27.8 75-79 23.64148287791859 25.0 21.0 26.8 17.8 28.0 80-84 23.604346365001586 25.0 21.0 26.4 18.0 28.0 85-89 23.58864657546578 25.0 21.0 26.2 18.0 27.6 90-94 23.49431747877826 25.0 21.0 26.0 17.6 27.6 95-99 23.571805615188303 25.0 21.0 26.0 17.8 27.6 100-104 23.46993290637441 25.0 21.0 26.2 17.6 27.2 105-109 23.337692312914143 25.0 20.8 26.0 17.4 27.0 110-114 23.272385229250794 24.6 20.6 26.0 17.2 27.0 115-119 23.214739314648643 24.6 21.0 26.0 17.2 27.0 120-124 23.06864184869233 24.0 20.4 26.0 17.2 27.0 125-129 22.8498845286528 24.0 20.2 26.0 16.6 27.0 130-134 22.83103801110922 24.0 20.2 26.0 16.4 27.0 135-139 22.797313410486648 24.0 20.0 26.0 16.8 27.0 140-144 22.407550631123918 23.6 20.0 26.0 16.0 27.0 145-149 22.168830926826033 23.0 20.0 25.8 15.8 27.0 150-154 21.88961163393623 22.8 19.2 25.0 15.4 27.0 155-159 21.694063590260193 22.2 18.8 25.2 15.0 26.6 160-164 21.590145205647115 22.2 19.0 25.0 15.0 26.2 165-169 21.241849260678965 22.0 18.6 25.0 14.2 26.0 170-174 21.68938749268346 22.2 19.2 24.6 15.2 26.2 175-179 21.032801633379336 21.4 18.8 24.4 13.8 26.0 180-184 20.839331270686994 21.0 18.0 24.2 14.0 26.0 185-189 20.861499487718483 NaN NaN NaN NaN NaN 190-194 20.757344403435695 NaN NaN NaN NaN NaN 195-199 19.970621978435638 NaN NaN NaN NaN NaN 200-204 20.397764066709044 NaN NaN NaN NaN NaN 205-209 20.29762962962963 NaN NaN NaN NaN NaN 210-214 21.072819730485637 NaN NaN NaN NaN NaN 215-219 19.471533613445377 NaN NaN NaN NaN NaN 220-224 18.32 NaN NaN NaN NaN NaN 225-229 17.05 NaN NaN NaN NaN NaN 230-234 16.133333333333333 NaN NaN NaN NaN NaN 235-239 15.600000000000003 NaN NaN NaN NaN NaN 240-244 16.466666666666665 NaN NaN NaN NaN NaN 245-249 18.6 NaN NaN NaN NaN NaN 250-254 19.0 NaN NaN NaN NaN NaN 255-259 20.0 NaN NaN NaN NaN NaN 260-264 22.6 NaN NaN NaN NaN NaN 265-267 23.0 NaN NaN NaN NaN NaN >>END_MODULE >>Per sequence quality scores warn #Quality Count 10 1.0 11 5.0 12 4.0 13 16.0 14 16.0 15 38.0 16 82.0 17 92.0 18 117.0 19 161.0 20 185.0 21 261.0 22 389.0 23 595.0 24 927.0 25 909.0 26 194.0 27 7.0 28 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.425 44.224999999999994 18.475 13.875000000000002 2 42.575 33.425 6.9 17.1 3 30.325000000000003 31.95 19.025 18.7 4 36.175000000000004 28.025 16.625 19.175 5 28.525 27.500000000000004 17.849999999999998 26.125 6 26.325 28.749999999999996 20.25 24.675 7 25.650000000000002 29.375 22.6 22.375 8 25.825 24.474999999999998 23.849999999999998 25.85 9 25.231771485843147 23.101979453770983 23.878727136056128 27.787521924329745 10-14 26.008492569002122 24.689111313315134 24.35041957334951 24.95197654433323 15-19 27.786078623319078 24.437116801483846 23.25209954144984 24.524705033747228 20-24 27.941408095763116 24.63380059851945 22.87499343728671 24.549797868430723 25-29 27.012234385061173 23.637046576518568 24.270229663017815 25.080489375402447 30-34 27.327014737303458 23.711170766449353 24.176847641483594 24.784966854763603 35-39 27.10459543276008 23.78347899633493 23.005356639413588 26.106568931491402 40-44 27.602779386218877 24.145917776491025 23.746381007527503 24.504921829762594 45-49 26.98526340910447 24.395919097905853 24.00811407433924 24.61070341865044 50-54 27.55662531629945 23.81040548046658 23.662284762081097 24.970684441152873 55-59 26.367614879649892 23.876946840005147 24.282404427854292 25.473033852490666 60-64 26.621695284818752 23.630417007358954 24.379940038157535 25.36794766966476 65-69 26.543119801546766 23.376623376623375 24.63884430176565 25.441412520064205 70-74 26.707831796154448 23.839299671721122 23.87838049085509 25.574488041269344 75-79 26.721297626087694 23.36740728225057 25.08236884345696 24.828926248204784 80-84 25.97402597402597 23.710575139146567 24.517625231910948 25.79777365491651 85-89 26.306655777868514 23.46876276031033 25.244997958350346 24.979583503470803 90-94 26.881840518204154 23.408532499441588 24.748715657806567 24.960911324547688 95-99 26.094935160264253 24.06410570100318 25.11622216784928 24.72473697088329 100-104 26.32791327913279 23.428184281842817 24.769647696476966 25.474254742547426 105-109 25.646845211075807 24.481767287032834 25.586321682554093 24.285065819337266 110-114 25.78231292517007 24.081632653061224 25.136054421768705 25.0 115-119 24.961330239752513 24.45862335653519 25.696055684454755 24.88399071925754 120-124 26.296051180233842 24.11206706375469 24.99448488859475 24.59739686741672 125-129 25.484276729559745 24.754716981132074 24.352201257861637 25.40880503144654 130-134 25.15055921995985 23.860051620303988 24.978491540005734 26.01089761973043 135-139 26.742627345844504 24.6313672922252 23.894101876675602 24.73190348525469 140-144 26.964980544747082 24.31906614785992 23.96887159533074 24.747081712062258 145-149 25.994575045207956 22.694394213381557 24.95479204339964 26.35623869801085 150-154 23.958333333333336 25.32894736842105 26.260964912280706 24.451754385964914 155-159 26.77631578947369 23.684210526315788 25.789473684210527 23.75 160-164 23.961661341853034 25.159744408945688 24.680511182108624 26.198083067092654 165-169 25.595238095238095 25.0 25.099206349206348 24.305555555555554 170-174 27.053140096618357 24.879227053140095 23.42995169082126 24.637681159420293 175-179 25.985401459854014 26.277372262773724 21.897810218978105 25.83941605839416 180-184 24.86583184257603 23.613595706618963 28.44364937388193 23.076923076923077 185-189 22.88888888888889 26.666666666666668 23.555555555555554 26.88888888888889 190-194 27.027027027027028 23.123123123123122 24.624624624624623 25.225225225225223 195-199 34.15637860082305 25.514403292181072 22.22222222222222 18.106995884773664 200-204 28.985507246376812 20.77294685990338 25.120772946859905 25.120772946859905 205-209 23.239436619718308 21.830985915492956 28.87323943661972 26.056338028169012 210-214 28.865979381443296 25.773195876288657 19.587628865979383 25.773195876288657 215-219 30.666666666666664 22.666666666666664 24.0 22.666666666666664 220-224 22.22222222222222 29.629629629629626 22.22222222222222 25.925925925925924 225-229 16.666666666666664 44.44444444444444 22.22222222222222 16.666666666666664 230-234 33.33333333333333 33.33333333333333 13.333333333333334 20.0 235-239 40.0 13.333333333333334 26.666666666666668 20.0 240-244 33.33333333333333 33.33333333333333 25.0 8.333333333333332 245-249 20.0 20.0 40.0 20.0 250-254 0.0 40.0 40.0 20.0 255-259 40.0 0.0 0.0 60.0 260-264 20.0 40.0 20.0 20.0 265-267 0.0 33.33333333333333 0.0 66.66666666666666 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 1.0 6 1.0 7 1.0 8 1.0 9 1.0 10 1.0 11 1.5 12 2.0 13 1.5 14 1.0 15 0.5 16 0.0 17 0.5 18 1.5 19 3.5 20 4.5 21 7.0 22 9.5 23 9.0 24 9.0 25 9.5 26 9.5 27 9.0 28 10.5 29 14.5 30 17.0 31 19.0 32 24.5 33 33.0 34 52.0 35 74.5 36 78.0 37 78.0 38 91.33333333333333 39 112.16666666666667 40 142.0 41 169.5 42 183.16666666666666 43 199.16666666666669 44 217.66666666666669 45 219.0 46 219.5 47 228.83333333333334 48 243.16666666666666 49 249.33333333333334 50 236.66666666666669 51 241.66666666666669 52 242.66666666666669 53 236.16666666666669 54 240.5 55 223.0 56 203.16666666666669 57 199.50000000000003 58 200.33333333333334 59 198.0 60 195.16666666666669 61 190.66666666666669 62 168.33333333333334 63 136.33333333333331 64 122.33333333333334 65 126.33333333333333 66 120.33333333333333 67 107.5 68 99.0 69 87.5 70 84.5 71 75.0 72 55.5 73 44.0 74 34.5 75 24.5 76 16.5 77 15.0 78 16.5 79 14.5 80 11.0 81 9.5 82 8.5 83 7.0 84 4.0 85 2.0 86 1.5 87 1.0 88 1.0 89 1.0 90 0.5 91 0.5 92 1.0 93 1.0 94 1.0 95 1.0 96 1.0 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-159 0.0 160-164 0.0 165-169 0.0 170-174 0.0 175-179 0.0 180-184 0.0 185-189 0.0 190-194 0.0 195-199 0.0 200-204 0.0 205-209 0.0 210-214 0.0 215-219 0.0 220-224 0.0 225-229 0.0 230-234 0.0 235-239 0.0 240-244 0.0 245-249 0.0 250-254 0.0 255-259 0.0 260-264 0.0 265-267 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 0-9 17.0 10-19 142.0 20-29 156.0 30-39 198.0 40-49 201.0 50-59 274.0 60-69 381.0 70-79 393.0 80-89 378.0 90-99 315.0 100-109 309.0 110-119 283.0 120-129 219.0 130-139 195.0 140-149 147.0 150-159 117.0 160-169 97.0 170-179 59.0 180-189 43.0 190-199 32.0 200-209 21.0 210-219 13.0 220-229 7.0 230-239 0.0 240-249 2.0 250-259 0.0 260-268 1.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29203539823008 98.175 2 0.5562579013906448 1.0999999999999999 3 0.05056890012642225 0.15 4 0.07585335018963338 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025284450063211124 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACTCCAAGATCATCAACGACAGGGAGACTGGCCGTTCCCGCGGGTTCGGC 11 0.27499999999999997 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.0 0.0 0.0 0.0 0.0 80-84 0.0 0.0 0.0 0.0 0.0 85-89 0.0 0.0 0.0 0.0 0.0 90-94 0.0 0.0 0.0 0.0 0.0 95-99 0.0 0.0 0.0 0.0 0.0 100-104 0.0 0.0 0.0 0.0 0.0 105-109 0.0 0.0 0.0 0.0 0.0 110-114 0.0 0.0 0.0 0.0 0.0 115-119 0.0 0.0 0.0 0.0 0.0 120-124 0.0 0.0 0.0 0.0 0.0 125-129 0.0 0.0 0.0 0.0 0.0 130-134 0.0 0.0 0.0 0.0 0.0 135-139 0.0 0.0 0.0 0.0 0.0 140-144 0.0 0.0 0.0 0.0 0.0 145-149 0.0 0.0 0.0 0.0 0.0 150-154 0.0 0.0 0.0 0.0 0.0 155-159 0.0 0.0 0.0 0.0 0.0 160-164 0.0 0.0 0.0 0.0 0.0 165-169 0.0 0.0 0.0 0.0 0.0 170-174 0.0 0.0 0.0 0.0 0.0 175-179 0.0 0.0 0.0 0.0 0.0 180-184 0.0 0.0 0.0 0.0 0.0 185-189 0.0 0.0 0.0 0.0 0.0 190-194 0.0 0.0 0.0 0.0 0.0 195-199 0.0 0.0 0.0 0.0 0.0 200-204 0.0 0.0 0.0 0.0 0.0 205-209 0.0 0.0 0.0 0.0 0.0 210-214 0.0 0.0 0.0 0.0 0.0 215-219 0.0 0.0 0.0 0.0 0.0 220-224 0.0 0.0 0.0 0.0 0.0 225-229 0.0 0.0 0.0 0.0 0.0 230-234 0.0 0.0 0.0 0.0 0.0 235-239 0.0 0.0 0.0 0.0 0.0 240-244 0.0 0.0 0.0 0.0 0.0 245-249 0.0 0.0 0.0 0.0 0.0 250-254 0.0 0.0 0.0 0.0 0.0 255 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTATATG 5 0.0012331724 2104.3333 180-182 TATATGG 5 0.0012331724 2104.3333 180-182 GCTATAT 5 0.0012331724 2104.3333 180-182 GAGACAG 5 0.0024660842 1578.2499 175-179 GTACCTT 5 0.0061639086 1052.1666 170-174 CGTACCT 5 0.0061639086 1052.1666 170-174 TTGATCC 5 0.0061639086 1052.1666 145-149 ACGAGGC 5 0.008628561 901.8571 175-179 AGGCTAT 5 0.008628561 901.8571 175-179 GGCTATA 5 0.008628561 901.8571 175-179 GAGGCTA 5 0.008628561 901.8571 175-179 TTATGCC 10 0.009862253 789.12494 155-159 CGAGGCT 10 0.009862253 789.12494 175-179 AGACAGA 10 0.009862253 789.12494 175-179 >>END_MODULE Read 359222 spots for ERR1806568.sra Written 359222 spots for ERR1806568.sra Read 359222 spots for ERR1806568.sra Written 359222 spots for ERR1806568.sra Read 359222 spots for ERR1806568.sra Written 359222 spots for ERR1806568.sra Read 359222 spots for ERR1806568.sra Written 359222 spots for ERR1806568.sra Read 359222 spots for ERR1806568.sra Written 359222 spots for ERR1806568.sra Read 359222 spots for ERR1806568.sra Written 359222 spots for ERR1806568.sra Read 359222 spots for ERR1806568.sra Written 359222 spots for ERR1806568.sra Read 359222 spots for ERR1806568.sra Written 359222 spots for ERR1806568.sra Read 359222 spots for ERR1806568.sra Written 359222 spots for ERR1806568.sra Read 359232 spots for ERR1806568.sra Written 359232 spots for ERR1806568.sra Read 359222 spots for ERR1806568.sra Written 359222 spots for ERR1806568.sra Read 359222 spots for ERR1806568.sra Written 359222 spots for ERR1806568.sra Read 359222 spots for ERR1806568.sra Written 359222 spots for ERR1806568.sra Read 359222 spots for ERR1806568.sra Written 359222 spots for ERR1806568.sra Read 359222 spots for ERR1806568.sra Written 359222 spots for ERR1806568.sra Read 359222 spots for ERR1806568.sra Written 359222 spots for ERR1806568.sra Read 359222 spots for ERR1806568.sra Written 359222 spots for ERR1806568.sra Read 359222 spots for ERR1806568.sra Written 359222 spots for ERR1806568.sra Read 359222 spots for ERR1806568.sra Written 359222 spots for ERR1806568.sra Read 359222 spots for ERR1806568.sra Written 359222 spots for ERR1806568.sra SRR ids: ['ERR1806568.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8afatwo9 ERR1806568.sra spots: 7184450 blocks: [[1, 359222], [359223, 718444], [718445, 1077666], [1077667, 1436888], [1436889, 1796110], [1796111, 2155332], [2155333, 2514554], [2514555, 2873776], [2873777, 3232998], [3232999, 3592220], [3592221, 3951442], [3951443, 4310664], [4310665, 4669886], [4669887, 5029108], [5029109, 5388330], [5388331, 5747552], [5747553, 6106774], [6106775, 6465996], [6465997, 6825218], [6825219, 7184450]] ERR1806568 file size 1542033 ERR1806568 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1806568 ERR1806568_1.fastq Input file: ERR1806568_1.fastq trimmed: ERR1806568-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 16:52:19 2024 >> started Mon Dec 9 16:52:22 2024 >> done (3.792s) 7184450 reads processed; of these: 279952 ( 3.90%) short reads filtered out after trimming by size control 39 ( 0.00%) empty reads filtered out after trimming by size control 6904459 (96.10%) reads available; of these: 119000 ( 1.72%) trimmed reads available after processing 6785459 (98.28%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 25348 0.37% 19 24627 0.36% 20 23855 0.35% 21 24902 0.36% 22 24567 0.36% 23 24335 0.35% 24 27209 0.39% 25 25360 0.37% 26 26022 0.38% 27 27380 0.40% 28 27209 0.39% 29 27418 0.40% 30 29693 0.43% 31 28998 0.42% 32 29569 0.43% 33 31914 0.46% 34 32439 0.47% 35 31749 0.46% 36 33537 0.49% 37 33274 0.48% 38 34143 0.49% 39 37974 0.55% 40 36498 0.53% 41 37016 0.54% 42 41606 0.60% 43 39663 0.57% 44 40832 0.59% 45 44317 0.64% 46 42735 0.62% 47 43682 0.63% 48 46536 0.67% 49 46781 0.68% 50 47621 0.69% 51 50938 0.74% 52 50824 0.74% 53 50525 0.73% 54 55087 0.80% 55 54646 0.79% 56 55227 0.80% 57 57138 0.83% 58 57366 0.83% 59 59500 0.86% 60 65877 0.95% 61 63754 0.92% 62 61135 0.89% 63 65216 0.94% 64 64101 0.93% 65 62792 0.91% 66 64747 0.94% 67 65026 0.94% 68 65612 0.95% 69 68562 0.99% 70 68409 0.99% 71 67357 0.98% 72 70000 1.01% 73 67140 0.97% 74 68215 0.99% 75 70286 1.02% 76 69555 1.01% 77 76400 1.11% 78 77077 1.12% 79 68921 1.00% 80 68786 1.00% 81 69131 1.00% 82 72802 1.05% 83 69576 1.01% 84 68715 1.00% 85 67359 0.98% 86 65510 0.95% 87 66821 0.97% 88 65989 0.96% 89 64623 0.94% 90 66278 0.96% 91 63437 0.92% 92 62359 0.90% 93 66261 0.96% 94 62026 0.90% 95 61165 0.89% 96 61869 0.90% 97 58838 0.85% 98 58511 0.85% 99 59263 0.86% 100 58749 0.85% 101 58307 0.84% 102 56452 0.82% 103 60507 0.88% 104 55682 0.81% 105 54331 0.79% 106 52215 0.76% 107 52054 0.75% 108 51341 0.74% 109 51441 0.75% 110 50126 0.73% 111 50112 0.73% 112 49843 0.72% 113 47289 0.68% 114 47897 0.69% 115 46750 0.68% 116 45215 0.65% 117 44870 0.65% 118 44127 0.64% 119 43054 0.62% 120 42658 0.62% 121 41377 0.60% 122 40437 0.59% 123 39818 0.58% 124 38991 0.56% 125 38136 0.55% 126 38463 0.56% 127 36845 0.53% 128 35796 0.52% 129 35904 0.52% 130 34272 0.50% 131 33641 0.49% 132 33766 0.49% 133 32478 0.47% 134 32520 0.47% 135 31642 0.46% 136 30349 0.44% 137 30051 0.44% 138 30225 0.44% 139 28995 0.42% 140 28601 0.41% 141 27346 0.40% 142 26317 0.38% 143 25899 0.38% 144 25854 0.37% 145 25096 0.36% 146 24410 0.35% 147 24277 0.35% 148 23466 0.34% 149 22526 0.33% 150 22460 0.33% 151 21573 0.31% 152 20912 0.30% 153 20740 0.30% 154 20014 0.29% 155 19997 0.29% 156 19323 0.28% 157 18677 0.27% 158 18049 0.26% 159 17621 0.26% 160 16906 0.24% 161 16658 0.24% 162 16364 0.24% 163 16125 0.23% 164 15435 0.22% 165 14887 0.22% 166 14193 0.21% 167 14063 0.20% 168 13719 0.20% 169 13230 0.19% 170 12954 0.19% 171 12631 0.18% 172 12161 0.18% 173 11913 0.17% 174 11402 0.17% 175 10849 0.16% 176 10757 0.16% 177 10278 0.15% 178 9856 0.14% 179 9544 0.14% 180 9209 0.13% 181 8906 0.13% 182 8856 0.13% 183 8540 0.12% 184 8255 0.12% 185 8019 0.12% 186 7521 0.11% 187 7315 0.11% 188 7167 0.10% 189 6881 0.10% 190 6662 0.10% 191 6315 0.09% 192 6162 0.09% 193 5984 0.09% 194 5778 0.08% 195 5529 0.08% 196 5259 0.08% 197 5049 0.07% 198 4762 0.07% 199 4710 0.07% 200 4450 0.06% 201 4335 0.06% 202 4149 0.06% 203 3952 0.06% 204 3705 0.05% 205 3594 0.05% 206 3468 0.05% 207 3308 0.05% 208 3078 0.04% 209 2983 0.04% 210 2857 0.04% 211 2708 0.04% 212 2689 0.04% 213 2478 0.04% 214 2333 0.03% 215 2265 0.03% 216 2124 0.03% 217 2007 0.03% 218 1941 0.03% 219 1761 0.03% 220 1696 0.02% 221 1616 0.02% 222 1473 0.02% 223 1400 0.02% 224 1398 0.02% 225 1198 0.02% 226 1130 0.02% 227 1071 0.02% 228 1030 0.01% 229 951 0.01% 230 856 0.01% 231 804 0.01% 232 804 0.01% 233 704 0.01% 234 638 0.01% 235 621 0.01% 236 567 0.01% 237 522 0.01% 238 482 0.01% 239 462 0.01% 240 400 0.01% 241 394 0.01% 242 359 0.01% 243 326 0.00% 244 313 0.00% 245 244 0.00% 246 243 0.00% 247 229 0.00% 248 214 0.00% 249 183 0.00% 250 154 0.00% 251 182 0.00% 252 155 0.00% 253 133 0.00% 254 112 0.00% 255 115 0.00% 256 95 0.00% 257 90 0.00% 258 75 0.00% 259 61 0.00% 260 54 0.00% 261 53 0.00% 262 57 0.00% 263 44 0.00% 264 32 0.00% 265 45 0.00% 266 39 0.00% 267 22 0.00% 268 31 0.00% 269 15 0.00% 270 19 0.00% 271 16 0.00% 272 16 0.00% 273 12 0.00% 274 5 0.00% 275 13 0.00% 276 4 0.00% 277 7 0.00% 278 6 0.00% 279 6 0.00% 280 3 0.00% 281 0 0.00% 282 0 0.00% 283 6 0.00% 284 2 0.00% 285 1 0.00% 286 1 0.00% 287 1 0.00% 288 2 0.00% 289 1 0.00% 290 1 0.00% 291 0 0.00% 292 0 0.00% 293 2 0.00% 294 2 0.00% 295 0 0.00% 296 0 0.00% 297 0 0.00% 298 0 0.00% 299 0 0.00% 300 0 0.00% 301 0 0.00% 302 0 0.00% 303 0 0.00% 304 0 0.00% 305 0 0.00% 306 0 0.00% 307 0 0.00% 308 0 0.00% 309 0 0.00% 310 0 0.00% 311 0 0.00% 312 0 0.00% 313 0 0.00% 314 0 0.00% 315 0 0.00% 316 0 0.00% 317 0 0.00% 318 0 0.00% 319 0 0.00% 320 0 0.00% 321 0 0.00% 322 0 0.00% 323 0 0.00% 324 0 0.00% 325 0 0.00% 326 0 0.00% 327 0 0.00% 328 0 0.00% 329 0 0.00% 330 0 0.00% 331 0 0.00% 332 0 0.00% 333 0 0.00% 334 0 0.00% 335 0 0.00% 336 0 0.00% 337 0 0.00% 338 1 0.00% 339 0 0.00% 340 0 0.00% 341 1 0.00% 342 0 0.00% 343 1 0.00% 344 0 0.00% 345 1 0.00% 346 0 0.00% 347 2 0.00% 348 0 0.00% 349 0 0.00% 350 0 0.00% 351 0 0.00% 352 1 0.00% 6904459 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=4.61 fanout-score-rank=24 prefix-density=0.27 prefix-fanout=3.7 sequence=GGCAAGACCATCACCCT criterion=fanout-score sequence-density=0.07 sequence-density-rank=17 fanout-score=109.51 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=12.9 sequence=AGAAGAAGGACCCAACCGGCGCCAAGGTCACCAAGCGGCTGCCAAGA Started job on | Dec 09 16:53:43 Started mapping on | Dec 09 16:53:43 Finished on | Dec 09 16:53:56 Mapping speed, Million of reads per hour | 1912.00 Number of input reads | 6904459 Average input read length | 91 UNIQUE READS: Uniquely mapped reads number | 5317003 Uniquely mapped reads % | 77.01% Average mapped length | 83.98 Number of splices: Total | 1383112 Number of splices: Annotated (sjdb) | 1292443 Number of splices: GT/AG | 1352051 Number of splices: GC/AG | 14873 Number of splices: AT/AC | 1193 Number of splices: Non-canonical | 14995 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.15% Deletion average length | 1.10 Insertion rate per base | 0.12% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 197829 % of reads mapped to multiple loci | 2.87% Number of reads mapped to too many loci | 98500 % of reads mapped to too many loci | 1.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 18.42% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1389627 1389627 1389627 N_multimapping 197829 197829 197829 N_noFeature 154471 200835 5197512 N_ambiguous 84323 11659 534 UnstrandedReadsAssigned:5078209 PositiveStrandReadsAssigned:5104509 NegativeStrandReadsAssigned:118957 Dataset is classified positive stranded MeadianReadLen=87 20thPercentileLength=56 echo kmer=51 ERR1806568 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR1806568-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,904,459 reads, 5,243,013 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 990 rounds 52973 ERR1806568.ke.tsv 35125 ERR1806568.se.tsv 88098 total ==> ERR1806568.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 100.251 33.5458 PNS24247 1044 945 8.75 2.59329 PNS24249 1928 1829 48.0263 7.35429 PNS24246 1044 945 8.75 2.59329 PNS24248 1044 945 8.75 2.59329 PNS24244 1471 1372 43.4728 8.8744 PNS24243 293 194 0 0 KQK14069 1603 1504 1306.59 243.313 KQK14071 474 375 173.345 129.466 ==> ERR1806568.se.tsv <== BRADI_1g14170v3 1511 BRADI_1g53295v3 47 BRADI_1g59795v3 67 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 493 BRADI_1g74790v3 115 BRADI_1g09890v3 0 BRADI_1g77505v3 116 BRADI_1g48960v3 0 ERR1806568 completed mapping pipeline successfully