Starting /dee2/code/volunteer_pipeline.sh ERR1806569 current disk space = 1523635978240 free memory = 1605413808 ERR1806569 SRAfilesize 3e0b9bcbcc0fec9c441a345a51d4f282 ERR1806569.sra ERR1806569.sra file validated ERR1806569 is single end ERR1806569 is conventional basespace ERR1806569 read1 length is 8-223 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1806569_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 8-223 %GC 51 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.08525 24.0 21.0 26.0 18.0 27.0 2 22.9745 24.0 20.0 26.0 16.0 27.0 3 22.81575 24.0 20.0 26.0 16.0 27.0 4 22.94675 24.0 20.0 26.0 16.0 28.0 5 22.90425 24.0 20.0 26.0 16.0 28.0 6 22.91125 24.0 20.0 26.0 16.0 28.0 7 22.94125 24.0 20.0 26.0 16.0 28.0 8 22.96325 24.0 20.0 27.0 16.0 28.0 9 22.98748748748749 24.0 20.0 27.0 16.0 28.0 10-14 23.179824697645863 24.4 20.2 27.0 16.0 28.0 15-19 23.54348539862788 25.0 21.0 27.0 17.0 28.0 20-24 23.71834589519411 25.0 21.0 27.0 17.8 28.0 25-29 23.734507996412653 25.0 21.0 27.0 17.8 28.0 30-34 23.634627995470122 25.0 21.0 27.0 17.4 28.0 35-39 23.67620507558231 25.0 21.0 27.0 18.0 28.0 40-44 23.702435927215774 25.0 21.0 27.0 17.8 28.0 45-49 23.648863506307627 25.0 21.0 27.0 17.8 28.0 50-54 23.670654241276544 25.0 21.0 27.0 17.8 28.0 55-59 23.701327132728565 25.0 21.0 27.0 17.8 28.0 60-64 23.660656912795893 25.0 21.0 27.0 17.4 28.0 65-69 23.63909984158137 25.0 21.0 27.0 18.0 28.0 70-74 23.617355450090194 25.0 21.0 26.6 18.0 28.0 75-79 23.443666757892665 25.0 21.0 26.2 17.4 28.0 80-84 23.42032614903556 25.0 21.0 26.2 17.2 27.8 85-89 23.349024394567458 25.0 20.8 26.2 17.0 27.6 90-94 23.233742082259866 25.0 20.4 26.0 17.0 27.2 95-99 23.441866269277472 25.0 21.0 26.0 17.4 27.4 100-104 23.36347601764687 25.0 20.8 26.0 17.2 27.0 105-109 23.242941758990202 24.6 20.6 26.0 17.2 27.2 110-114 23.02492031648012 24.2 20.2 26.0 17.2 27.0 115-119 23.089237996722808 24.0 20.4 26.0 16.8 27.0 120-124 23.25050248071103 24.4 20.8 26.0 17.6 27.0 125-129 22.9229510260759 24.0 20.2 26.0 16.6 27.0 130-134 22.8243150229558 24.0 20.2 26.0 16.6 27.0 135-139 22.793204509537084 23.8 19.8 26.0 16.4 27.0 140-144 22.332027990723645 23.6 19.4 26.0 15.8 27.0 145-149 22.029692306922446 23.0 19.4 25.8 14.8 27.0 150-154 22.060973079317048 23.0 19.2 25.4 15.6 26.6 155-159 21.805818996773034 22.6 19.2 25.0 14.8 26.4 160-164 21.47980433988106 22.25 19.5 24.75 14.25 26.75 165-169 21.18036100397877 NaN NaN NaN NaN NaN 170-174 21.23391973808296 NaN NaN NaN NaN NaN 175-179 20.702400842666624 NaN NaN NaN NaN NaN 180-184 20.13014390155149 NaN NaN NaN NaN NaN 185-189 19.971079583871166 NaN NaN NaN NaN NaN 190-194 19.06562479871176 NaN NaN NaN NaN NaN 195-199 20.497554406377937 NaN NaN NaN NaN NaN 200-204 19.086060606060606 NaN NaN NaN NaN NaN 205-209 19.531666666666666 NaN NaN NaN NaN NaN 210-214 19.03 NaN NaN NaN NaN NaN 215-219 18.1 NaN NaN NaN NaN NaN 220-223 15.125 NaN NaN NaN NaN NaN >>END_MODULE >>Per sequence quality scores warn #Quality Count 10 2.0 11 3.0 12 8.0 13 9.0 14 21.0 15 26.0 16 69.0 17 94.0 18 115.0 19 131.0 20 170.0 21 264.0 22 404.0 23 620.0 24 882.0 25 927.0 26 242.0 27 13.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.625 41.75 19.650000000000002 13.975000000000001 2 41.625 35.175 6.625 16.575 3 29.675 32.225 20.775 17.325 4 36.725 27.800000000000004 17.724999999999998 17.75 5 30.3 25.575 16.8 27.325 6 27.075 28.999999999999996 19.2 24.725 7 23.45 30.25 23.575 22.725 8 25.324999999999996 24.725 25.0 24.95 9 25.650650650650654 23.073073073073072 24.1991991991992 27.077077077077078 10-14 26.243316856652882 24.926863714314536 24.69988903460103 24.129930394431554 15-19 27.126590756865372 25.416044103251068 23.39636251223659 24.061002627646968 20-24 27.515756302521012 25.131302521008404 23.06197478991597 24.290966386554622 25-29 27.087696686536706 24.76236507169325 23.924601256645722 24.225336985124322 30-34 26.94005960922839 24.942046583508112 23.61187769069434 24.506016116569157 35-39 26.542431192660548 24.547018348623855 23.990825688073393 24.9197247706422 40-44 26.84390565924503 24.125307567664887 24.149312848826742 24.88147392426334 45-49 25.974934792289584 24.180927539919843 24.8234620522934 25.02067561549717 50-54 26.799890500958117 23.911853271283874 24.49356693128935 24.794689296468654 55-59 26.451902234845655 23.656476567755437 24.979445399506687 24.912175797892218 60-64 25.98229795682025 24.633964761353297 24.931756141947226 24.451981139879226 65-69 26.36848507532516 23.795265275568447 24.375409375877233 25.460840273229156 70-74 25.873015873015877 24.296296296296298 25.238095238095237 24.592592592592595 75-79 25.266435157466173 24.559932942162614 24.679679080349658 25.493952820021555 80-84 26.564616635058254 24.099160119208886 24.424275264156055 24.91194798157681 85-89 25.97402597402597 24.31544359255203 25.176028790486622 24.53450164293538 90-94 26.463195691202873 24.685816876122082 24.72172351885099 24.129263913824055 95-99 25.681913554343268 23.85648342425514 25.304238355014686 25.157364666386904 100-104 25.43494241607449 23.548149963244303 26.390590541533935 24.626317079147267 105-109 25.716768027801912 23.747465971618883 24.87691862148856 25.658847379090645 110-114 25.340599455040874 25.51089918256131 23.876021798365123 25.272479564032697 115-119 26.29674306393245 23.361479694410935 23.964616003216726 26.37716123843989 120-124 24.89530013959981 23.91810144253141 26.058631921824105 25.127966496044674 125-129 25.13601741022851 24.9727965179543 25.081610446137105 24.809575625680086 130-134 27.0 21.6 25.8 25.6 135-139 27.773343974461294 24.581005586592177 24.501197126895452 23.144453312051077 140-144 26.54377880184332 22.396313364055302 25.990783410138246 25.069124423963135 145-149 27.802197802197803 22.41758241758242 25.164835164835164 24.615384615384617 150-154 24.796747967479675 26.422764227642276 23.170731707317074 25.609756097560975 155-159 27.027027027027028 26.232114467408586 22.89348171701113 23.84737678855326 160-164 26.923076923076923 23.653846153846153 24.615384615384617 24.807692307692307 165-169 27.830188679245282 26.41509433962264 23.58490566037736 22.169811320754718 170-174 26.851851851851855 29.01234567901235 21.296296296296298 22.839506172839506 175-179 30.45267489711934 24.691358024691358 21.39917695473251 23.456790123456788 180-184 26.153846153846157 24.102564102564102 21.025641025641026 28.717948717948715 185-189 22.929936305732486 25.477707006369428 22.29299363057325 29.29936305732484 190-194 24.59016393442623 27.86885245901639 20.491803278688526 27.049180327868854 195-199 29.333333333333332 24.0 21.333333333333336 25.333333333333336 200-204 16.3265306122449 20.408163265306122 28.57142857142857 34.69387755102041 205-209 25.806451612903224 25.806451612903224 19.35483870967742 29.03225806451613 210-214 23.809523809523807 19.047619047619047 33.33333333333333 23.809523809523807 215-219 25.0 12.5 31.25 31.25 220-223 0.0 40.0 0.0 60.0 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 1.0 8 1.5 9 2.0 10 2.0 11 2.0 12 2.0 13 2.5 14 2.5 15 2.0 16 3.5 17 6.0 18 7.0 19 7.5 20 8.0 21 8.5 22 9.0 23 9.0 24 7.0 25 6.5 26 9.5 27 14.5 28 20.0 29 21.0 30 26.0 31 33.0 32 34.5 33 38.0 34 48.0 35 64.5 36 82.5 37 101.5 38 119.5 39 143.5 40 174.0 41 199.5 42 228.5 43 247.66666666666666 44 258.33333333333337 45 275.0 46 279.0 47 285.5 48 296.66666666666663 49 283.5 50 263.5 51 268.66666666666663 52 257.83333333333337 53 246.00000000000003 54 238.0 55 229.5 56 226.83333333333331 57 209.33333333333331 58 195.83333333333334 59 173.0 60 164.0 61 173.0 62 172.83333333333331 63 166.5 64 150.0 65 121.0 66 111.0 67 112.0 68 95.5 69 75.0 70 69.5 71 67.5 72 57.0 73 51.0 74 45.5 75 32.0 76 21.0 77 16.5 78 13.5 79 13.0 80 10.5 81 5.5 82 2.0 83 1.5 84 3.0 85 4.0 86 4.0 87 2.0 88 0.5 89 1.0 90 1.0 91 1.0 92 1.0 93 1.0 94 1.0 95 1.0 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-159 0.0 160-164 0.0 165-169 0.0 170-174 0.0 175-179 0.0 180-184 0.0 185-189 0.0 190-194 0.0 195-199 0.0 200-204 0.0 205-209 0.0 210-214 0.0 215-219 0.0 220-223 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 5-9 9.0 10-14 77.0 15-19 73.0 20-24 82.0 25-29 89.0 30-34 129.0 35-39 143.0 40-44 183.0 45-49 204.0 50-54 241.0 55-59 238.0 60-64 279.0 65-69 269.0 70-74 227.0 75-79 207.0 80-84 190.0 85-89 184.0 90-94 167.0 95-99 140.0 100-104 130.0 105-109 114.0 110-114 94.0 115-119 82.0 120-124 54.0 125-129 68.0 130-134 60.0 135-139 37.0 140-144 31.0 145-149 43.0 150-154 18.0 155-159 27.0 160-164 17.0 165-169 23.0 170-174 17.0 175-179 11.0 180-184 9.0 185-189 7.0 190-194 10.0 195-199 5.0 200-204 4.0 205-209 3.0 210-214 1.0 215-219 2.0 220-224 2.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49609473418998 98.725 2 0.40312421264802223 0.8 3 0.02519526329050139 0.075 4 0.02519526329050139 0.1 5 0.02519526329050139 0.125 6 0.0 0.0 7 0.02519526329050139 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACTCCAAGATCATCAACGACAGGGAGACTGGCCGTTCCCGCGGGTTCGGC 7 0.17500000000000002 No Hit GGGAAGAAGCTCACTGCCGAGGCTTATGACTGCAACAATACGGTTGAGCAAGAGCTCCCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.0 0.0 0.0 0.0 0.0 80-84 0.0 0.0 0.0 0.0 0.0 85-89 0.0 0.0 0.0 0.0 0.0 90-94 0.0 0.0 0.0 0.0 0.0 95-99 0.0 0.0 0.0 0.0 0.0 100-104 0.0 0.0 0.0 0.0 0.0 105-109 0.0 0.0 0.0 0.0 0.0 110-114 0.0 0.0 0.0 0.0 0.0 115-119 0.0 0.0 0.0 0.0 0.0 120-124 0.0 0.0 0.0 0.0 0.0 125-129 0.0 0.0 0.0 0.0 0.0 130-134 0.0 0.0 0.0 0.0 0.0 135-139 0.0 0.0 0.0 0.0 0.0 140-144 0.0 0.0 0.0 0.0 0.0 145-149 0.0 0.0 0.0 0.0 0.0 150-154 0.0 0.0 0.0 0.0 0.0 155-159 0.0 0.0 0.0 0.0 0.0 160-164 0.0 0.0 0.0 0.0 0.0 165-169 0.0 0.0 0.0 0.0 0.0 170-174 0.0 0.0 0.0 0.0 0.0 175-179 0.0 0.0 0.0 0.0 0.0 180-184 0.0 0.0 0.0 0.0 0.0 185-189 0.0 0.0 0.0 0.0 0.0 190-194 0.0 0.0 0.0 0.0 0.0 195-199 0.0 0.0 0.0 0.0 0.0 200-204 0.0 0.0 0.0 0.0 0.0 205-209 0.0 0.0 0.0 0.0 0.0 210-211 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCATAC 5 0.0032056605 1384.25 210-213 ATACACT 5 0.0032056605 1384.25 210-213 CATACAC 5 0.0032056605 1384.25 210-213 TCATACA 5 0.0032056605 1384.25 210-213 TGGTTCA 5 0.0053421245 1107.4 205-209 CTTTAGG 5 0.0053421245 1107.4 200-204 GTTCATA 5 0.0053421245 1107.4 205-209 GGTTCAT 5 0.0053421245 1107.4 205-209 CGGATAG 5 0.0053421245 1107.4 190-194 AGGTGGT 5 0.0053421245 1107.4 200-204 GGATAGA 5 0.0053421245 1107.4 190-194 TTCTTTA 5 0.0053421245 1107.4 195-199 ATAGATT 5 0.0053421245 1107.4 190-194 TTTAGGT 5 0.0053421245 1107.4 200-204 TTAGGTG 5 0.0053421245 1107.4 200-204 TCTTTAG 5 0.0053421245 1107.4 195-199 AGATTCT 5 0.0053421245 1107.4 195-199 TAGATTC 5 0.0053421245 1107.4 190-194 GATAGAT 5 0.0053421245 1107.4 190-194 TAGGTGG 5 0.0053421245 1107.4 200-204 >>END_MODULE Read 353104 spots for ERR1806569.sra Written 353104 spots for ERR1806569.sra Read 353104 spots for ERR1806569.sra Written 353104 spots for ERR1806569.sra Read 353104 spots for ERR1806569.sra Written 353104 spots for ERR1806569.sra Read 353104 spots for ERR1806569.sra Written 353104 spots for ERR1806569.sra Read 353104 spots for ERR1806569.sra Written 353104 spots for ERR1806569.sra Read 353104 spots for ERR1806569.sra Written 353104 spots for ERR1806569.sra Read 353104 spots for ERR1806569.sra Written 353104 spots for ERR1806569.sra Read 353104 spots for ERR1806569.sra Written 353104 spots for ERR1806569.sra Read 353104 spots for ERR1806569.sra Written 353104 spots for ERR1806569.sra Read 353110 spots for ERR1806569.sra Written 353110 spots for ERR1806569.sra Read 353104 spots for ERR1806569.sra Written 353104 spots for ERR1806569.sra Read 353104 spots for ERR1806569.sra Written 353104 spots for ERR1806569.sra Read 353104 spots for ERR1806569.sra Written 353104 spots for ERR1806569.sra Read 353104 spots for ERR1806569.sra Written 353104 spots for ERR1806569.sra Read 353104 spots for ERR1806569.sra Written 353104 spots for ERR1806569.sra Read 353104 spots for ERR1806569.sra Written 353104 spots for ERR1806569.sra Read 353104 spots for ERR1806569.sra Written 353104 spots for ERR1806569.sra Read 353104 spots for ERR1806569.sra Written 353104 spots for ERR1806569.sra Read 353104 spots for ERR1806569.sra Written 353104 spots for ERR1806569.sra Read 353104 spots for ERR1806569.sra Written 353104 spots for ERR1806569.sra SRR ids: ['ERR1806569.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tvjzwlci ERR1806569.sra spots: 7062086 blocks: [[1, 353104], [353105, 706208], [706209, 1059312], [1059313, 1412416], [1412417, 1765520], [1765521, 2118624], [2118625, 2471728], [2471729, 2824832], [2824833, 3177936], [3177937, 3531040], [3531041, 3884144], [3884145, 4237248], [4237249, 4590352], [4590353, 4943456], [4943457, 5296560], [5296561, 5649664], [5649665, 6002768], [6002769, 6355872], [6355873, 6708976], [6708977, 7062086]] ERR1806569 file size 1312375 ERR1806569 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1806569 ERR1806569_1.fastq Input file: ERR1806569_1.fastq trimmed: ERR1806569-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 16:53:41 2024 >> started Mon Dec 9 16:53:45 2024 >> done (4.113s) 7062086 reads processed; of these: 215183 ( 3.05%) short reads filtered out after trimming by size control 20 ( 0.00%) empty reads filtered out after trimming by size control 6846883 (96.95%) reads available; of these: 98349 ( 1.44%) trimmed reads available after processing 6748534 (98.56%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 25213 0.37% 19 25306 0.37% 20 26099 0.38% 21 27994 0.41% 22 28074 0.41% 23 28932 0.42% 24 32954 0.48% 25 31721 0.46% 26 33776 0.49% 27 36339 0.53% 28 36970 0.54% 29 38384 0.56% 30 42786 0.62% 31 42058 0.61% 32 43617 0.64% 33 48805 0.71% 34 50481 0.74% 35 49789 0.73% 36 53954 0.79% 37 52441 0.77% 38 54739 0.80% 39 62303 0.91% 40 59022 0.86% 41 61612 0.90% 42 72761 1.06% 43 66328 0.97% 44 68269 1.00% 45 74745 1.09% 46 72218 1.05% 47 73697 1.08% 48 80181 1.17% 49 79112 1.16% 50 80751 1.18% 51 84653 1.24% 52 83377 1.22% 53 83096 1.21% 54 88489 1.29% 55 86840 1.27% 56 86552 1.26% 57 90204 1.32% 58 87916 1.28% 59 91429 1.34% 60 98253 1.44% 61 93543 1.37% 62 90755 1.33% 63 93697 1.37% 64 91137 1.33% 65 88257 1.29% 66 88582 1.29% 67 87206 1.27% 68 87885 1.28% 69 89325 1.30% 70 87832 1.28% 71 85196 1.24% 72 86147 1.26% 73 81578 1.19% 74 81244 1.19% 75 80039 1.17% 76 78154 1.14% 77 82436 1.20% 78 81855 1.20% 79 74212 1.08% 80 73315 1.07% 81 71368 1.04% 82 71979 1.05% 83 69059 1.01% 84 66988 0.98% 85 64499 0.94% 86 62055 0.91% 87 61507 0.90% 88 60753 0.89% 89 58538 0.85% 90 58917 0.86% 91 55060 0.80% 92 54186 0.79% 93 56721 0.83% 94 51795 0.76% 95 51093 0.75% 96 50627 0.74% 97 47776 0.70% 98 46846 0.68% 99 46116 0.67% 100 45739 0.67% 101 44385 0.65% 102 43070 0.63% 103 46985 0.69% 104 40713 0.59% 105 39743 0.58% 106 37731 0.55% 107 37301 0.54% 108 36383 0.53% 109 35911 0.52% 110 34185 0.50% 111 34504 0.50% 112 32977 0.48% 113 31662 0.46% 114 31504 0.46% 115 30033 0.44% 116 29281 0.43% 117 28153 0.41% 118 27389 0.40% 119 26860 0.39% 120 26125 0.38% 121 24919 0.36% 122 24229 0.35% 123 23214 0.34% 124 23102 0.34% 125 22310 0.33% 126 21638 0.32% 127 20912 0.31% 128 20156 0.29% 129 19778 0.29% 130 18931 0.28% 131 17981 0.26% 132 17975 0.26% 133 16959 0.25% 134 17018 0.25% 135 16401 0.24% 136 15575 0.23% 137 14942 0.22% 138 14899 0.22% 139 14512 0.21% 140 13891 0.20% 141 13402 0.20% 142 12792 0.19% 143 12341 0.18% 144 11951 0.17% 145 11672 0.17% 146 11283 0.16% 147 11122 0.16% 148 10409 0.15% 149 10007 0.15% 150 9914 0.14% 151 9672 0.14% 152 9148 0.13% 153 9099 0.13% 154 8905 0.13% 155 8447 0.12% 156 8222 0.12% 157 8169 0.12% 158 7533 0.11% 159 7191 0.11% 160 7138 0.10% 161 7023 0.10% 162 6800 0.10% 163 6719 0.10% 164 6537 0.10% 165 6194 0.09% 166 5819 0.08% 167 5587 0.08% 168 5463 0.08% 169 5022 0.07% 170 5203 0.08% 171 4733 0.07% 172 4641 0.07% 173 4482 0.07% 174 4377 0.06% 175 4163 0.06% 176 4090 0.06% 177 4025 0.06% 178 3742 0.05% 179 3628 0.05% 180 3387 0.05% 181 3344 0.05% 182 3281 0.05% 183 2983 0.04% 184 2978 0.04% 185 2845 0.04% 186 2849 0.04% 187 2736 0.04% 188 2582 0.04% 189 2449 0.04% 190 2287 0.03% 191 2243 0.03% 192 2179 0.03% 193 2214 0.03% 194 2032 0.03% 195 1949 0.03% 196 1901 0.03% 197 1744 0.03% 198 1766 0.03% 199 1631 0.02% 200 1668 0.02% 201 1555 0.02% 202 1529 0.02% 203 1358 0.02% 204 1402 0.02% 205 1307 0.02% 206 1216 0.02% 207 1209 0.02% 208 1133 0.02% 209 1067 0.02% 210 1030 0.02% 211 1021 0.01% 212 938 0.01% 213 845 0.01% 214 861 0.01% 215 761 0.01% 216 760 0.01% 217 692 0.01% 218 685 0.01% 219 637 0.01% 220 599 0.01% 221 536 0.01% 222 565 0.01% 223 455 0.01% 224 502 0.01% 225 436 0.01% 226 405 0.01% 227 397 0.01% 228 347 0.01% 229 339 0.00% 230 306 0.00% 231 332 0.00% 232 267 0.00% 233 247 0.00% 234 236 0.00% 235 207 0.00% 236 191 0.00% 237 192 0.00% 238 199 0.00% 239 176 0.00% 240 151 0.00% 241 127 0.00% 242 126 0.00% 243 114 0.00% 244 112 0.00% 245 93 0.00% 246 93 0.00% 247 95 0.00% 248 84 0.00% 249 79 0.00% 250 57 0.00% 251 65 0.00% 252 49 0.00% 253 63 0.00% 254 43 0.00% 255 51 0.00% 256 32 0.00% 257 40 0.00% 258 22 0.00% 259 31 0.00% 260 29 0.00% 261 27 0.00% 262 27 0.00% 263 14 0.00% 264 21 0.00% 265 9 0.00% 266 12 0.00% 267 7 0.00% 268 4 0.00% 269 12 0.00% 270 8 0.00% 271 5 0.00% 272 2 0.00% 273 4 0.00% 274 5 0.00% 275 3 0.00% 276 5 0.00% 277 4 0.00% 278 0 0.00% 279 0 0.00% 280 2 0.00% 281 0 0.00% 282 2 0.00% 283 1 0.00% 284 3 0.00% 285 1 0.00% 286 0 0.00% 287 1 0.00% 288 0 0.00% 289 0 0.00% 290 0 0.00% 291 0 0.00% 292 0 0.00% 293 0 0.00% 294 0 0.00% 295 0 0.00% 296 1 0.00% 6846883 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=40.12 fanout-score-rank=2 prefix-density=0.60 prefix-fanout=25.4 sequence=ATCACCGACTGCCCATAGAGAGGCTGAGACTGCCAAGGCACACAGGGGATAGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=11 fanout-score=45.58 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=11.7 sequence=GAGAAGAAGGAC Started job on | Dec 09 16:53:58 Started mapping on | Dec 09 16:53:58 Finished on | Dec 09 16:54:09 Mapping speed, Million of reads per hour | 2240.80 Number of input reads | 6846883 Average input read length | 76 UNIQUE READS: Uniquely mapped reads number | 5504199 Uniquely mapped reads % | 80.39% Average mapped length | 70.40 Number of splices: Total | 1231737 Number of splices: Annotated (sjdb) | 1159299 Number of splices: GT/AG | 1205542 Number of splices: GC/AG | 13725 Number of splices: AT/AC | 1018 Number of splices: Non-canonical | 11452 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.13% Deletion average length | 1.10 Insertion rate per base | 0.12% Insertion average length | 1.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 203496 % of reads mapped to multiple loci | 2.97% Number of reads mapped to too many loci | 149601 % of reads mapped to too many loci | 2.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 14.15% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1139188 1139188 1139188 N_multimapping 203496 203496 203496 N_noFeature 169241 213684 5385793 N_ambiguous 84528 11020 494 UnstrandedReadsAssigned:5250430 PositiveStrandReadsAssigned:5279495 NegativeStrandReadsAssigned:117912 Dataset is classified positive stranded MeadianReadLen=70 20thPercentileLength=47 echo kmer=43 ERR1806569 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR1806569-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,846,883 reads, 5,266,123 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,046 rounds 52973 ERR1806569.ke.tsv 35125 ERR1806569.se.tsv 88098 total ==> ERR1806569.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 66.8373 23.0476 PNS24247 1044 945 12.7378 3.8904 PNS24249 1928 1829 57.4616 9.06767 PNS24246 1044 945 12.7378 3.8904 PNS24248 1044 945 12.7378 3.8904 PNS24244 1471 1372 52.4877 11.0417 PNS24243 293 194 0 0 KQK14069 1603 1504 1184.21 227.255 KQK14071 474 375 89.8206 69.1315 ==> ERR1806569.se.tsv <== BRADI_1g14170v3 1369 BRADI_1g53295v3 51 BRADI_1g59795v3 84 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 560 BRADI_1g74790v3 103 BRADI_1g09890v3 0 BRADI_1g77505v3 114 BRADI_1g48960v3 0 ERR1806569 completed mapping pipeline successfully