Starting /dee2/code/volunteer_pipeline.sh ERR1806570 current disk space = 1523635097600 free memory = 1335808152 ERR1806570 SRAfilesize ed94f6ba2bc5c875f35a97017ca3ace8 ERR1806570.sra ERR1806570.sra file validated ERR1806570 is single end ERR1806570 is conventional basespace ERR1806570 read1 length is 8-233 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1806570_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 8-233 %GC 49 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.30025 24.0 21.0 26.0 18.0 28.0 2 23.349 25.0 20.0 27.0 16.0 28.0 3 23.05175 24.0 20.0 27.0 15.0 28.0 4 23.03875 24.0 20.0 27.0 16.0 28.0 5 22.8945 24.0 20.0 26.0 16.0 28.0 6 22.84475 24.0 20.0 26.0 15.0 28.0 7 22.79725 24.0 20.0 26.0 16.0 28.0 8 22.63925 24.0 20.0 26.0 15.0 28.0 9 22.661152882205513 24.0 20.0 26.0 15.0 28.0 10-14 22.789143167945497 24.0 20.0 26.0 14.8 28.0 15-19 23.111979896082545 24.2 20.4 26.2 16.2 28.0 20-24 23.398165246144394 25.0 21.0 26.6 17.0 28.0 25-29 23.417710058153368 25.0 21.0 26.6 17.0 28.0 30-34 23.365363940960496 25.0 21.0 26.2 17.0 28.0 35-39 23.298951080193888 25.0 21.0 26.0 17.0 28.0 40-44 23.285349807712414 25.0 21.0 26.0 17.0 27.8 45-49 23.305611819529812 24.6 21.0 26.0 17.0 28.0 50-54 23.283148905348316 24.4 21.0 26.0 17.0 28.0 55-59 23.205094692438955 24.2 20.6 26.0 17.0 27.8 60-64 23.14696531507791 24.0 20.2 26.0 16.6 27.6 65-69 23.090634115043812 24.0 20.4 26.0 16.6 27.4 70-74 23.04470710340549 24.0 20.2 26.0 16.8 27.0 75-79 22.965845485208664 24.0 20.0 26.0 16.8 27.0 80-84 22.924189700497852 24.0 20.2 26.0 16.8 27.0 85-89 22.833091077106285 24.0 20.0 26.0 16.8 27.0 90-94 22.814658475058344 24.0 20.2 26.0 16.8 27.0 95-99 22.797847686032082 24.0 20.0 26.0 16.4 27.0 100-104 22.7883303596059 24.0 20.0 26.0 16.2 27.0 105-109 22.590535729130302 23.8 20.0 26.0 16.0 27.0 110-114 22.5302992590137 24.0 20.0 26.0 16.0 27.0 115-119 22.63753996227449 24.0 20.0 26.0 16.4 27.0 120-124 22.432020123102586 23.6 20.0 26.0 16.0 27.0 125-129 22.232574495602528 23.2 20.0 25.6 15.8 27.0 130-134 21.852571965495475 22.6 19.2 25.0 14.8 26.6 135-139 21.771476501811858 22.8 19.2 25.0 14.8 26.4 140-144 21.344367383071315 22.2 18.8 24.8 14.0 26.0 145-149 21.56123731240955 22.2 19.0 24.8 15.0 26.2 150-154 21.1208547304698 21.8 18.6 24.6 14.2 26.0 155-159 20.728457259158976 21.0 18.2 24.2 13.8 25.8 160-164 20.18716769735347 20.4 17.2 23.8 13.0 25.4 165-169 20.491952848753733 21.0 18.0 24.0 13.0 26.0 170-174 20.496015279100117 NaN NaN NaN NaN NaN 175-179 19.870266084490222 NaN NaN NaN NaN NaN 180-184 19.91357528436476 NaN NaN NaN NaN NaN 185-189 19.569316813454744 NaN NaN NaN NaN NaN 190-194 19.79665800865801 NaN NaN NaN NaN NaN 195-199 19.07549019607843 NaN NaN NaN NaN NaN 200-204 17.967792207792208 NaN NaN NaN NaN NaN 205-209 17.89174603174603 NaN NaN NaN NaN NaN 210-214 17.18 NaN NaN NaN NaN NaN 215-219 16.95 NaN NaN NaN NaN NaN 220-224 16.73333333333333 NaN NaN NaN NaN NaN 225-229 22.1 NaN NaN NaN NaN NaN 230-233 20.0 NaN NaN NaN NaN NaN >>END_MODULE >>Per sequence quality scores warn #Quality Count 11 2.0 12 6.0 13 9.0 14 17.0 15 44.0 16 59.0 17 99.0 18 132.0 19 187.0 20 264.0 21 328.0 22 442.0 23 673.0 24 829.0 25 720.0 26 176.0 27 12.0 28 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.349999999999998 40.050000000000004 21.575 14.025000000000002 2 39.775 37.1 6.9 16.225 3 29.9 31.85 21.725 16.525000000000002 4 36.75 26.674999999999997 18.95 17.625 5 28.749999999999996 27.425 19.650000000000002 24.175 6 27.825 28.525 21.175 22.475 7 23.95 30.85 23.825 21.375 8 26.25 26.275 24.75 22.725 9 25.839598997493734 23.684210526315788 25.31328320802005 25.162907268170425 10-14 26.61710413189703 25.322409346077983 24.98862084660901 23.07186567541597 15-19 27.081507449605606 25.56580914574419 24.158375006444295 23.19430839820591 20-24 27.21639656816015 24.81199025526957 24.51011545387141 23.46149772269887 25-29 26.52502464133173 24.761800459971525 24.86036578687986 23.85280911181689 30-34 27.31006160164271 24.59502623773671 24.90303445128907 23.191877709331507 35-39 26.730139839333532 25.278191014578994 24.772389169889912 23.21927997619756 40-44 26.787600173945457 25.17860470895198 25.041933279493072 22.99186183760949 45-49 25.795843199158114 25.388055774796108 25.197316495659038 23.61878453038674 50-54 26.483154724381876 25.145338656580513 24.718078027596835 23.65342859144078 55-59 25.944319036869828 25.26711813393529 25.026335590669675 23.762227238525206 60-64 26.081662472603295 25.17249776767595 25.667667830181024 23.078171929539735 65-69 26.534040671971702 24.465075154730325 25.62334217506631 23.377541998231656 70-74 26.219156790363318 24.93685642121624 25.276860306974935 23.567126481445502 75-79 25.986629286176406 25.274962260081953 26.00819495363382 22.73021350010783 80-84 25.824108989174064 24.960467096460285 26.10388030653205 23.111543607833596 85-89 25.444521019986215 25.6237077877326 25.596140592694695 23.335630599586494 90-94 25.249532127261386 24.703680598877106 25.483468496568936 24.563318777292576 95-99 26.36621717530163 25.35486160397445 24.911284599006386 23.36763662171753 100-104 26.62102295610149 25.31212243254128 25.110753121224327 22.956101490132905 105-109 26.036484245439468 25.065150438284768 25.302061122956644 23.596304193319117 110-114 24.939073923639317 24.12672623883022 26.563769293257515 24.37043054427295 115-119 25.047438330170777 25.521821631878556 26.02783048703352 23.40290955091714 120-124 25.506072874493928 25.947736474052263 25.874125874125873 22.672064777327936 125-129 24.913344887348355 24.090121317157713 27.4263431542461 23.570190641247834 130-134 24.502297090352222 24.859622256253193 27.462991322103115 23.175089331291478 135-139 25.722891566265062 25.96385542168675 23.49397590361446 24.819277108433734 140-144 24.798829553767373 25.31089978054133 24.798829553767373 25.091441111923924 145-149 24.40147329650092 24.585635359116022 24.40147329650092 26.611418047882136 150-154 22.474460839954595 24.51759364358683 28.603859250851304 24.404086265607265 155-159 27.770177838577293 24.350205198358413 25.85499316005472 22.024623803009575 160-164 26.013513513513516 25.675675675675674 21.62162162162162 26.68918918918919 165-169 25.423728813559322 25.847457627118644 25.635593220338983 23.093220338983052 170-174 24.92836676217765 27.507163323782237 22.063037249283667 25.501432664756447 175-179 22.04724409448819 27.559055118110237 23.62204724409449 26.77165354330709 180-184 24.120603015075375 22.613065326633166 28.643216080402013 24.623115577889447 185-189 29.01234567901235 23.456790123456788 22.839506172839506 24.691358024691358 190-194 22.88135593220339 19.491525423728813 31.35593220338983 26.27118644067797 195-199 24.390243902439025 34.146341463414636 24.390243902439025 17.073170731707318 200-204 21.428571428571427 30.0 22.857142857142858 25.71428571428571 205-209 21.73913043478261 23.91304347826087 36.95652173913043 17.391304347826086 210-214 28.000000000000004 24.0 20.0 28.000000000000004 215-219 31.57894736842105 15.789473684210526 15.789473684210526 36.84210526315789 220-224 28.57142857142857 21.428571428571427 21.428571428571427 28.57142857142857 225-229 37.5 37.5 12.5 12.5 230-233 25.0 25.0 0.0 50.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 2.0 2 2.0 3 2.5 4 2.5 5 1.5 6 1.0 7 1.0 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 1.5 15 2.5 16 4.0 17 4.5 18 3.5 19 4.5 20 6.5 21 9.5 22 14.0 23 17.0 24 18.5 25 17.5 26 17.0 27 21.0 28 26.5 29 31.0 30 38.0 31 48.5 32 56.5 33 68.5 34 87.0 35 100.33333333333334 36 115.83333333333334 37 127.5 38 144.0 39 175.5 40 194.0 41 211.33333333333331 42 237.33333333333334 43 246.0 44 273.3333333333333 45 304.5 46 292.83333333333337 47 277.33333333333337 48 289.66666666666663 49 306.66666666666663 50 286.5 51 255.16666666666669 52 234.66666666666666 53 234.16666666666666 54 231.33333333333334 55 195.5 56 176.5 57 184.83333333333331 58 184.5 59 169.5 60 150.5 61 152.5 62 162.0 63 147.5 64 121.5 65 113.0 66 113.0 67 108.0 68 101.5 69 85.0 70 68.0 71 57.5 72 47.0 73 40.0 74 36.0 75 29.5 76 25.5 77 21.5 78 16.5 79 15.0 80 13.5 81 11.0 82 10.5 83 10.0 84 10.0 85 9.0 86 6.5 87 6.0 88 5.0 89 3.0 90 2.0 91 1.5 92 1.0 93 1.5 94 1.5 95 1.0 96 1.0 97 1.0 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-159 0.0 160-164 0.0 165-169 0.0 170-174 0.0 175-179 0.0 180-184 0.0 185-189 0.0 190-194 0.0 195-199 0.0 200-204 0.0 205-209 0.0 210-214 0.0 215-219 0.0 220-224 0.0 225-229 0.0 230-233 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 5-9 17.0 10-14 71.0 15-19 90.0 20-24 112.0 25-29 143.0 30-34 151.0 35-39 139.0 40-44 157.0 45-49 183.0 50-54 205.0 55-59 185.0 60-64 211.0 65-69 192.0 70-74 209.0 75-79 204.0 80-84 201.0 85-89 188.0 90-94 155.0 95-99 134.0 100-104 156.0 105-109 120.0 110-114 101.0 115-119 99.0 120-124 84.0 125-129 74.0 130-134 66.0 135-139 51.0 140-144 69.0 145-149 45.0 150-154 25.0 155-159 37.0 160-164 22.0 165-169 25.0 170-174 21.0 175-179 16.0 180-184 6.0 185-189 8.0 190-194 10.0 195-199 3.0 200-204 4.0 205-209 5.0 210-214 2.0 215-219 1.0 220-224 1.0 225-229 1.0 230-234 1.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19130654536265 98.125 2 0.6317917614354309 1.25 3 0.1263583522870862 0.375 4 0.025271670457417232 0.1 5 0.0 0.0 6 0.025271670457417232 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCGACCCCAGGTCAGGCGGGACTACCCGCTGAGTTTAAGCATATAAATAA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.0 0.0 0.0 0.0 0.0 80-84 0.0 0.0 0.0 0.0 0.0 85-89 0.0 0.0 0.0 0.0 0.0 90-94 0.0 0.0 0.0 0.0 0.0 95-99 0.0 0.0 0.0 0.0 0.0 100-104 0.0 0.0 0.0 0.0 0.0 105-109 0.0 0.0 0.0 0.0 0.0 110-114 0.0 0.0 0.0 0.0 0.0 115-119 0.0 0.0 0.0 0.0 0.0 120-124 0.0 0.0 0.0 0.0 0.0 125-129 0.0 0.0 0.0 0.0 0.0 130-134 0.0 0.0 0.0 0.0 0.0 135-139 0.0 0.0 0.0 0.0 0.0 140-144 0.0 0.0 0.0 0.0 0.0 145-149 0.0 0.0 0.0 0.0 0.0 150-154 0.0 0.0 0.0 0.0 0.0 155-159 0.0 0.0 0.0 0.0 0.0 160-164 0.0 0.0 0.0 0.0 0.0 165-169 0.0 0.0 0.0 0.0 0.0 170-174 0.0 0.0 0.0 0.0 0.0 175-179 0.0 0.0 0.0 0.0 0.0 180-184 0.0 0.0 0.0 0.0 0.0 185-189 0.0 0.0 0.0 0.0 0.0 190-194 0.0 0.0 0.0 0.0 0.0 195-199 0.0 0.0 0.0 0.0 0.0 200-204 0.0 0.0 0.0 0.0 0.0 205-209 0.0 0.0 0.0 0.0 0.0 210-214 0.0 0.0 0.0 0.0 0.0 215-219 0.0 0.0 0.0 0.0 0.0 220-221 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACTTCT 10 0.0 3273.0 190-192 CTTCTCC 5 0.0011469512 2182.0 190-192 TTTGAGC 5 0.002293669 1636.5 180-184 TTGAGCA 5 0.002293669 1636.5 180-184 ACTTCTC 10 0.0015294241 1636.5 190-192 TGACTAC 5 0.003822392 1309.2 185-189 CTGACTA 5 0.003822392 1309.2 185-189 ACTACTT 5 0.003822392 1309.2 185-189 GACTACT 5 0.003822392 1309.2 185-189 GGAAGAC 5 0.0057330043 1091.0 150-154 AATTGCA 10 0.004587338 1091.0 170-174 GGTGTCA 10 0.004587338 1091.0 170-174 TATATCT 5 0.008025388 935.1429 180-184 ATATCTG 5 0.008025388 935.1429 180-184 AGAGTAT 10 0.0091728065 818.25 175-179 CTATATC 10 0.0090607 130.92 135-139 >>END_MODULE Read 286299 spots for ERR1806570.sra Written 286299 spots for ERR1806570.sra Read 286299 spots for ERR1806570.sra Written 286299 spots for ERR1806570.sra Read 286299 spots for ERR1806570.sra Written 286299 spots for ERR1806570.sra Read 286299 spots for ERR1806570.sra Written 286299 spots for ERR1806570.sra Read 286299 spots for ERR1806570.sra Written 286299 spots for ERR1806570.sra Read 286299 spots for ERR1806570.sra Written 286299 spots for ERR1806570.sra Read 286299 spots for ERR1806570.sra Written 286299 spots for ERR1806570.sra Read 286299 spots for ERR1806570.sra Written 286299 spots for ERR1806570.sra Read 286299 spots for ERR1806570.sra Written 286299 spots for ERR1806570.sra Read 286299 spots for ERR1806570.sra Written 286299 spots for ERR1806570.sra Read 286299 spots for ERR1806570.sra Written 286299 spots for ERR1806570.sra Read 286299 spots for ERR1806570.sra Written 286299 spots for ERR1806570.sra Read 286299 spots for ERR1806570.sra Written 286299 spots for ERR1806570.sra Read 286299 spots for ERR1806570.sra Written 286299 spots for ERR1806570.sra Read 286299 spots for ERR1806570.sra Written 286299 spots for ERR1806570.sra Read 286309 spots for ERR1806570.sra Written 286309 spots for ERR1806570.sra Read 286299 spots for ERR1806570.sra Written 286299 spots for ERR1806570.sra Read 286299 spots for ERR1806570.sra Written 286299 spots for ERR1806570.sra Read 286299 spots for ERR1806570.sra Written 286299 spots for ERR1806570.sra Read 286299 spots for ERR1806570.sra Written 286299 spots for ERR1806570.sra SRR ids: ['ERR1806570.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9d0dokoq ERR1806570.sra spots: 5725990 blocks: [[1, 286299], [286300, 572598], [572599, 858897], [858898, 1145196], [1145197, 1431495], [1431496, 1717794], [1717795, 2004093], [2004094, 2290392], [2290393, 2576691], [2576692, 2862990], [2862991, 3149289], [3149290, 3435588], [3435589, 3721887], [3721888, 4008186], [4008187, 4294485], [4294486, 4580784], [4580785, 4867083], [4867084, 5153382], [5153383, 5439681], [5439682, 5725990]] ERR1806570 file size 1091524 ERR1806570 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1806570 ERR1806570_1.fastq Input file: ERR1806570_1.fastq trimmed: ERR1806570-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 16:53:52 2024 >> started Mon Dec 9 16:54:06 2024 >> done (14.055s) 5725990 reads processed; of these: 244744 ( 4.27%) short reads filtered out after trimming by size control 15 ( 0.00%) empty reads filtered out after trimming by size control 5481231 (95.73%) reads available; of these: 87503 ( 1.60%) trimmed reads available after processing 5393728 (98.40%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 29414 0.54% 19 29441 0.54% 20 30209 0.55% 21 33087 0.60% 22 32626 0.60% 23 32629 0.60% 24 36252 0.66% 25 34800 0.63% 26 36572 0.67% 27 37772 0.69% 28 38651 0.71% 29 39491 0.72% 30 41741 0.76% 31 41335 0.75% 32 42089 0.77% 33 44895 0.82% 34 47507 0.87% 35 45261 0.83% 36 46714 0.85% 37 44204 0.81% 38 45319 0.83% 39 48715 0.89% 40 46754 0.85% 41 48139 0.88% 42 59744 1.09% 43 49756 0.91% 44 50259 0.92% 45 52496 0.96% 46 51227 0.93% 47 52178 0.95% 48 53854 0.98% 49 53280 0.97% 50 52629 0.96% 51 54309 0.99% 52 53399 0.97% 53 54235 0.99% 54 56428 1.03% 55 54732 1.00% 56 54727 1.00% 57 56370 1.03% 58 54753 1.00% 59 56555 1.03% 60 57218 1.04% 61 56616 1.03% 62 55627 1.01% 63 57468 1.05% 64 56618 1.03% 65 55992 1.02% 66 54935 1.00% 67 54328 0.99% 68 55457 1.01% 69 55619 1.01% 70 55026 1.00% 71 53530 0.98% 72 55121 1.01% 73 53253 0.97% 74 53479 0.98% 75 52622 0.96% 76 51337 0.94% 77 54026 0.99% 78 53858 0.98% 79 51087 0.93% 80 50449 0.92% 81 49729 0.91% 82 50794 0.93% 83 48814 0.89% 84 48813 0.89% 85 47903 0.87% 86 46695 0.85% 87 47089 0.86% 88 45545 0.83% 89 45624 0.83% 90 46570 0.85% 91 44866 0.82% 92 44406 0.81% 93 45292 0.83% 94 42975 0.78% 95 42184 0.77% 96 42912 0.78% 97 41494 0.76% 98 40891 0.75% 99 40541 0.74% 100 40577 0.74% 101 39999 0.73% 102 38478 0.70% 103 38491 0.70% 104 37977 0.69% 105 37457 0.68% 106 35553 0.65% 107 35332 0.64% 108 35145 0.64% 109 34042 0.62% 110 33644 0.61% 111 34156 0.62% 112 32333 0.59% 113 31313 0.57% 114 31043 0.57% 115 30535 0.56% 116 29549 0.54% 117 29254 0.53% 118 28546 0.52% 119 27819 0.51% 120 27478 0.50% 121 26669 0.49% 122 25805 0.47% 123 25283 0.46% 124 24650 0.45% 125 23700 0.43% 126 23784 0.43% 127 22837 0.42% 128 22037 0.40% 129 21665 0.40% 130 20981 0.38% 131 20567 0.38% 132 19993 0.36% 133 19188 0.35% 134 18768 0.34% 135 18410 0.34% 136 17694 0.32% 137 17273 0.32% 138 17133 0.31% 139 16834 0.31% 140 18087 0.33% 141 16494 0.30% 142 15082 0.28% 143 14658 0.27% 144 14023 0.26% 145 13589 0.25% 146 13308 0.24% 147 12983 0.24% 148 12550 0.23% 149 12072 0.22% 150 11739 0.21% 151 11350 0.21% 152 11044 0.20% 153 10777 0.20% 154 10246 0.19% 155 10002 0.18% 156 9893 0.18% 157 9478 0.17% 158 9006 0.16% 159 8937 0.16% 160 8368 0.15% 161 8309 0.15% 162 7853 0.14% 163 7799 0.14% 164 7576 0.14% 165 7232 0.13% 166 6724 0.12% 167 6583 0.12% 168 6337 0.12% 169 6334 0.12% 170 5898 0.11% 171 5644 0.10% 172 5504 0.10% 173 5215 0.10% 174 4991 0.09% 175 4807 0.09% 176 4676 0.09% 177 4440 0.08% 178 4214 0.08% 179 4069 0.07% 180 3880 0.07% 181 3781 0.07% 182 3546 0.06% 183 3329 0.06% 184 3181 0.06% 185 2981 0.05% 186 2911 0.05% 187 2746 0.05% 188 2678 0.05% 189 2660 0.05% 190 2448 0.04% 191 2255 0.04% 192 2162 0.04% 193 2010 0.04% 194 1924 0.04% 195 1876 0.03% 196 1785 0.03% 197 1636 0.03% 198 1580 0.03% 199 1476 0.03% 200 1487 0.03% 201 1311 0.02% 202 1202 0.02% 203 1144 0.02% 204 1078 0.02% 205 1038 0.02% 206 912 0.02% 207 849 0.02% 208 797 0.01% 209 782 0.01% 210 736 0.01% 211 659 0.01% 212 590 0.01% 213 508 0.01% 214 498 0.01% 215 461 0.01% 216 451 0.01% 217 433 0.01% 218 404 0.01% 219 361 0.01% 220 316 0.01% 221 316 0.01% 222 273 0.00% 223 258 0.00% 224 252 0.00% 225 197 0.00% 226 185 0.00% 227 178 0.00% 228 171 0.00% 229 139 0.00% 230 124 0.00% 231 103 0.00% 232 91 0.00% 233 99 0.00% 234 78 0.00% 235 66 0.00% 236 68 0.00% 237 65 0.00% 238 50 0.00% 239 57 0.00% 240 42 0.00% 241 37 0.00% 242 30 0.00% 243 29 0.00% 244 29 0.00% 245 17 0.00% 246 18 0.00% 247 12 0.00% 248 16 0.00% 249 20 0.00% 250 10 0.00% 251 9 0.00% 252 10 0.00% 253 14 0.00% 254 11 0.00% 255 8 0.00% 256 7 0.00% 257 6 0.00% 258 3 0.00% 259 5 0.00% 260 3 0.00% 261 6 0.00% 262 2 0.00% 263 1 0.00% 264 2 0.00% 265 2 0.00% 266 1 0.00% 267 1 0.00% 268 3 0.00% 269 0 0.00% 270 3 0.00% 271 1 0.00% 272 0 0.00% 273 1 0.00% 274 1 0.00% 275 0 0.00% 276 0 0.00% 277 0 0.00% 278 1 0.00% 279 1 0.00% 280 1 0.00% 281 0 0.00% 282 0 0.00% 283 0 0.00% 284 0 0.00% 285 0 0.00% 286 0 0.00% 287 0 0.00% 288 0 0.00% 289 0 0.00% 290 0 0.00% 291 0 0.00% 292 0 0.00% 293 0 0.00% 294 0 0.00% 295 0 0.00% 296 0 0.00% 297 1 0.00% 298 0 0.00% 299 0 0.00% 300 0 0.00% 301 0 0.00% 302 0 0.00% 303 0 0.00% 304 0 0.00% 305 0 0.00% 306 0 0.00% 307 0 0.00% 308 1 0.00% 5481231 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=5.20 fanout-score-rank=16 prefix-density=0.13 prefix-fanout=3.9 sequence=GGCAAGACCATCAC criterion=fanout-score sequence-density=0.06 sequence-density-rank=10 fanout-score=97.18 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=13.5 sequence=AGAAGAAGGACCCAACCGGCGCCAAGGTCACCAAGCGGCTGCCAAGAAGAAATGATTTGTTCTGTGTTGGGGATTGAGATGTCTGGCTGCAGTTTTAGTGTTTACTAAGTTTTGTCTATGTGCATTGCTCGTATTGCTGAGACTCTTGAAACTATGTAAGC Started job on | Dec 09 16:56:11 Started mapping on | Dec 09 16:56:12 Finished on | Dec 09 16:57:07 Mapping speed, Million of reads per hour | 358.77 Number of input reads | 5481231 Average input read length | 79 UNIQUE READS: Uniquely mapped reads number | 4310958 Uniquely mapped reads % | 78.65% Average mapped length | 75.11 Number of splices: Total | 931957 Number of splices: Annotated (sjdb) | 868578 Number of splices: GT/AG | 910081 Number of splices: GC/AG | 10759 Number of splices: AT/AC | 866 Number of splices: Non-canonical | 10251 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.14% Deletion average length | 1.09 Insertion rate per base | 0.18% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 184379 % of reads mapped to multiple loci | 3.36% Number of reads mapped to too many loci | 278061 % of reads mapped to too many loci | 5.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.78% % of reads unmapped: other | 1.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 985894 985894 985894 N_multimapping 184379 184379 184379 N_noFeature 186732 226252 4202310 N_ambiguous 78061 9201 416 UnstrandedReadsAssigned:4046165 PositiveStrandReadsAssigned:4075505 NegativeStrandReadsAssigned:108232 Dataset is classified positive stranded MeadianReadLen=74 20thPercentileLength=44 echo kmer=39 ERR1806570 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR1806570-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,481,231 reads, 3,907,421 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,051 rounds 52973 ERR1806570.ke.tsv 35125 ERR1806570.se.tsv 88098 total ==> ERR1806570.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 14.4064 5.77411 PNS24249 1928 1829 23.2885 4.8227 PNS24246 1044 945 14.4064 5.77411 PNS24248 1044 945 14.4064 5.77411 PNS24244 1471 1372 96.4923 26.6379 PNS24243 293 194 0 0 KQK14069 1603 1504 1068.01 268.96 KQK14071 474 375 118.356 119.542 ==> ERR1806570.se.tsv <== BRADI_1g14170v3 1317 BRADI_1g53295v3 42 BRADI_1g59795v3 126 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 459 BRADI_1g74790v3 84 BRADI_1g09890v3 0 BRADI_1g77505v3 116 BRADI_1g48960v3 1 ERR1806570 completed mapping pipeline successfully