Starting /dee2/code/volunteer_pipeline.sh ERR1806571 current disk space = 1523645681664 free memory = 1605394408 ERR1806571 SRAfilesize 3bd5c3564364b1f4be67d6831c6024d9 ERR1806571.sra ERR1806571.sra file validated ERR1806571 is single end ERR1806571 is conventional basespace ERR1806571 read1 length is 8-231 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1806571_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 8-231 %GC 50 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.18125 24.0 21.0 26.0 18.0 27.0 2 23.2705 25.0 20.0 27.0 16.0 28.0 3 22.8235 24.0 20.0 26.0 16.0 28.0 4 22.96925 24.0 20.0 26.0 16.0 28.0 5 22.9375 24.0 20.0 26.0 16.0 28.0 6 22.90125 24.0 20.0 26.0 16.0 28.0 7 22.83175 24.0 20.0 26.0 15.0 28.0 8 22.87075 24.0 20.0 26.0 16.0 28.0 9 22.873557451078774 24.0 20.0 26.0 16.0 28.0 10-14 23.000698420568995 24.0 20.0 26.0 16.0 28.0 15-19 23.267873032332627 24.8 20.8 26.6 16.4 28.0 20-24 23.521833184567203 25.0 21.0 27.0 17.4 28.0 25-29 23.55061292337117 25.0 21.0 27.0 17.2 28.0 30-34 23.424708504935758 25.0 21.0 26.2 17.2 28.0 35-39 23.41638058001967 25.0 21.0 26.0 17.0 28.0 40-44 23.459381810177142 25.0 21.0 26.8 17.2 28.0 45-49 23.444922898456873 25.0 21.0 26.0 17.0 28.0 50-54 23.357487827730843 24.8 21.0 26.0 17.0 28.0 55-59 23.395110223532022 25.0 21.0 26.0 17.2 27.6 60-64 23.343498332861063 25.0 21.0 26.0 17.0 27.6 65-69 23.38568318556433 24.8 21.0 26.0 17.6 27.6 70-74 23.380329079278138 25.0 21.0 26.0 17.2 27.6 75-79 23.316874226901252 25.0 20.8 26.0 17.0 27.2 80-84 23.3601529615816 25.0 21.0 26.0 17.4 27.2 85-89 23.23889866477515 25.0 20.6 26.0 17.0 27.0 90-94 23.012678137425773 24.0 20.2 26.0 16.8 27.0 95-99 23.044752052763517 24.0 20.2 26.0 17.0 27.0 100-104 23.110473288003696 24.2 20.4 26.0 17.2 27.0 105-109 22.732587371960893 24.0 20.2 26.0 16.2 27.0 110-114 22.791043741081626 23.8 20.0 26.0 16.6 27.0 115-119 22.39730410938258 23.4 19.8 26.0 15.8 27.0 120-124 22.392167632167755 23.4 20.0 26.0 16.2 27.0 125-129 22.413029294343552 23.6 20.0 26.0 15.8 27.0 130-134 22.245706350566813 23.2 19.4 25.4 16.2 27.0 135-139 21.904972075457515 22.8 19.2 25.0 14.8 26.6 140-144 21.70733940100343 22.2 19.0 25.0 15.0 26.2 145-149 21.85830084649015 22.4 19.4 25.0 15.8 26.4 150-154 21.391783088885813 22.2 19.0 24.8 14.2 26.2 155-159 20.829551285920527 21.75 18.0 24.25 13.75 25.5 160-164 20.357377906190603 NaN NaN NaN NaN NaN 165-169 19.974830158585572 NaN NaN NaN NaN NaN 170-174 20.461088622069756 NaN NaN NaN NaN NaN 175-179 20.803913253287966 NaN NaN NaN NaN NaN 180-184 19.62983971366324 NaN NaN NaN NaN NaN 185-189 18.505722904546435 NaN NaN NaN NaN NaN 190-194 17.83863636363636 NaN NaN NaN NaN NaN 195-199 17.97 NaN NaN NaN NaN NaN 200-204 17.6 NaN NaN NaN NaN NaN 205-209 14.7 NaN NaN NaN NaN NaN 210-214 19.4 NaN NaN NaN NaN NaN 215-219 23.6 NaN NaN NaN NaN NaN 220-224 22.4 NaN NaN NaN NaN NaN 225-229 18.0 NaN NaN NaN NaN NaN 230-231 21.5 NaN NaN NaN NaN NaN >>END_MODULE >>Per sequence quality scores warn #Quality Count 10 3.0 11 3.0 12 2.0 13 9.0 14 20.0 15 30.0 16 53.0 17 112.0 18 107.0 19 161.0 20 208.0 21 347.0 22 445.0 23 705.0 24 875.0 25 777.0 26 141.0 27 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.074999999999996 42.199999999999996 18.7 14.025000000000002 2 42.675000000000004 34.825 6.075 16.425 3 30.55 32.85 20.0 16.6 4 38.475 27.125 16.2 18.2 5 29.275000000000002 26.775 17.65 26.3 6 27.800000000000004 29.599999999999998 19.0 23.599999999999998 7 22.95 30.625000000000004 23.65 22.775000000000002 8 24.425 26.075 24.5 25.0 9 26.24184646261917 22.428499749121926 24.912192674360263 26.417461113898643 10-14 26.03410008071025 25.141242937853107 24.02138821630347 24.803268765133172 15-19 27.276915988327445 25.377566170071162 23.631802590487894 23.713715251113502 20-24 27.1222498962225 24.38252386882524 23.697592361975925 24.797633872976338 25-29 26.81426167437947 24.553007993268828 24.25326041228439 24.37946992006731 30-34 26.347849318728294 24.402885386053967 24.07160032059845 25.17766497461929 35-39 26.51668213837165 24.89488341615246 23.753617648664882 24.83481679681101 40-44 26.576172313215167 24.652232443347543 24.242764191159974 24.528831052277315 45-49 26.591107236268524 24.742807323452485 24.562627143272305 24.103458297006682 50-54 26.224434059598227 25.034897129331796 24.306609212842144 24.434059598227833 55-59 25.716651802777424 25.480952987641736 23.88202318766722 24.92037202191362 60-64 25.712347354138398 24.525101763907735 24.511533242876528 25.25101763907734 65-69 26.42024494614136 24.826619448133393 24.18474251143574 24.568393094289508 70-74 26.080597985050375 24.439389015274617 24.902502437439065 24.577510562235943 75-79 25.985533453887882 24.05967450271248 25.11754068716094 24.8372513562387 80-84 26.30875244266173 24.26205903527718 24.868867633446467 24.560320888614626 85-89 25.66256507335542 24.136299100804543 25.236630383341218 24.964505442498815 90-94 25.950937155457552 25.041345093715545 25.165380374862185 23.84233737596472 95-99 26.301054018445324 24.25889328063241 25.148221343873516 24.29183135704875 100-104 25.341246290801188 25.084075173095943 25.222551928783382 24.352126607319484 105-109 26.00875060768109 23.77248420029169 25.255226057365093 24.96353913466213 110-114 25.472813238770687 23.699763593380617 25.14775413711584 25.67966903073286 115-119 26.11967036904335 25.976352561805804 24.14905051952705 23.754926549623793 120-124 25.395468148781532 24.283882000855066 24.454895254382215 25.865754595981187 125-129 26.02172788411795 24.36627004655975 25.81479565442318 23.797206414899122 130-134 25.831202046035806 24.42455242966752 24.744245524296677 25.0 135-139 25.66158781074579 23.817161186848438 27.105052125100244 23.416198877305533 140-144 25.411522633744855 25.205761316872426 22.633744855967077 26.74897119341564 145-149 26.700251889168765 23.425692695214106 25.692695214105793 24.181360201511335 150-154 27.40963855421687 23.49397590361446 26.054216867469883 23.042168674698797 155-159 26.062846580406656 27.35674676524954 22.36598890942699 24.214417744916823 160-164 25.45045045045045 28.153153153153156 24.324324324324326 22.07207207207207 165-169 22.57142857142857 22.285714285714285 27.714285714285715 27.42857142857143 170-174 29.554655870445345 27.530364372469634 21.86234817813765 21.052631578947366 175-179 22.727272727272727 26.623376623376622 30.519480519480517 20.12987012987013 180-184 22.429906542056074 17.75700934579439 34.57943925233645 25.233644859813083 185-189 19.718309859154928 21.12676056338028 25.352112676056336 33.80281690140845 190-194 30.434782608695656 15.217391304347828 32.608695652173914 21.73913043478261 195-199 22.22222222222222 25.925925925925924 22.22222222222222 29.629629629629626 200-204 15.789473684210526 42.10526315789473 21.052631578947366 21.052631578947366 205-209 60.0 10.0 10.0 20.0 210-214 0.0 16.666666666666664 33.33333333333333 50.0 215-219 20.0 20.0 40.0 20.0 220-224 40.0 20.0 0.0 40.0 225-229 40.0 20.0 0.0 40.0 230-231 50.0 50.0 0.0 0.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.5 20 2.0 21 3.0 22 4.0 23 4.5 24 6.0 25 8.0 26 10.0 27 13.5 28 18.0 29 18.5 30 20.5 31 24.5 32 26.5 33 34.5 34 46.0 35 57.5 36 71.0 37 87.5 38 109.0 39 136.83333333333331 40 163.5 41 177.0 42 194.0 43 210.33333333333334 44 216.5 45 232.5 46 258.0 47 282.0 48 281.5 49 261.33333333333337 50 237.0 51 230.0 52 233.0 53 227.5 54 234.5 55 226.5 56 184.5 57 161.0 58 165.33333333333331 59 169.0 60 164.5 61 155.5 62 140.0 63 121.5 64 107.5 65 106.5 66 104.0 67 89.0 68 80.0 69 76.5 70 74.0 71 61.0 72 45.5 73 39.0 74 34.0 75 25.5 76 18.0 77 16.5 78 16.5 79 14.5 80 12.0 81 9.0 82 6.0 83 3.5 84 3.0 85 4.5 86 4.5 87 3.0 88 1.5 89 1.0 90 1.0 91 1.0 92 1.0 93 1.0 94 1.0 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-159 0.0 160-164 0.0 165-169 0.0 170-174 0.0 175-179 0.0 180-184 0.0 185-189 0.0 190-194 0.0 195-199 0.0 200-204 0.0 205-209 0.0 210-214 0.0 215-219 0.0 220-224 0.0 225-229 0.0 230-231 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 5-9 18.0 10-14 50.0 15-19 60.0 20-24 49.0 25-29 53.0 30-34 75.0 35-39 84.0 40-44 111.0 45-49 139.0 50-54 157.0 55-59 178.0 60-64 218.0 65-69 255.0 70-74 227.0 75-79 278.0 80-84 258.0 85-89 239.0 90-94 247.0 95-99 224.0 100-104 178.0 105-109 174.0 110-114 126.0 115-119 99.0 120-124 84.0 125-129 78.0 130-134 74.0 135-139 53.0 140-144 43.0 145-149 34.0 150-154 17.0 155-159 25.0 160-164 18.0 165-169 17.0 170-174 26.0 175-179 7.0 180-184 10.0 185-189 6.0 190-194 4.0 195-199 3.0 200-204 2.0 205-209 0.0 210-214 1.0 215-219 0.0 220-224 0.0 225-229 0.0 230-232 1.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.23973644196656 97.89999999999999 2 0.5575266092245312 1.0999999999999999 3 0.05068423720223011 0.15 4 0.025342118601115054 0.1 5 0.07602635580334516 0.375 6 0.025342118601115054 0.15 7 0.0 0.0 8 0.0 0.0 9 0.025342118601115054 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACTCCAAGATCATCAACGACAGGGAGACTGGCCGTTCCCGCGGGTTCGGC 9 0.22499999999999998 No Hit ACCCAATCCTCTCGCCGACGCCGTAGCAACCTTTGAGAGAACGAGATCTG 6 0.15 No Hit GGGAAGAAGCTCACTGCCGAGGCTTATGACTGCAACAATACGGTTGAGCAAGAGCTCCCG 5 0.125 No Hit ATGGGGGCCGGCGATGCGTCCTGGCCGTATGCGGAACGGCTTTTGCTGGT 5 0.125 No Hit GGAGATGGAGGTCTGTGACTTCGACTTTGAGCCCTGCGGCTACTCCATGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.0 0.0 0.0 0.0 0.0 80-84 0.0 0.0 0.0 0.0 0.0 85-89 0.0 0.0 0.0 0.0 0.0 90-94 0.0 0.0 0.0 0.0 0.0 95-99 0.0 0.0 0.0 0.0 0.0 100-104 0.0 0.0 0.0 0.0 0.0 105-109 0.0 0.0 0.0 0.0 0.0 110-114 0.0 0.0 0.0 0.0 0.0 115-119 0.0 0.0 0.0 0.0 0.0 120-124 0.0 0.0 0.0 0.0 0.0 125-129 0.0 0.0 0.0 0.0 0.0 130-134 0.0 0.0 0.0 0.0 0.0 135-139 0.0 0.0 0.0 0.0 0.0 140-144 0.0 0.0 0.0 0.0 0.0 145-149 0.0 0.0 0.0 0.0 0.0 150-154 0.0 0.0 0.0 0.0 0.0 155-159 0.0 0.0 0.0 0.0 0.0 160-164 0.0 0.0 0.0 0.0 0.0 165-169 0.0 0.0 0.0 0.0 0.0 170-174 0.0 0.0 0.0 0.0 0.0 175-179 0.0 0.0 0.0 0.0 0.0 180-184 0.0 0.0 0.0 0.0 0.0 185-189 0.0 0.0 0.0 0.0 0.0 190-194 0.0 0.0 0.0 0.0 0.0 195-199 0.0 0.0 0.0 0.0 0.0 200-204 0.0 0.0 0.0 0.0 0.0 205-209 0.0 0.0 0.0 0.0 0.0 210-214 0.0 0.0 0.0 0.0 0.0 215-219 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAAATG 10 0.0 3232.0 175-179 CGAATCG 10 0.0 3232.0 165-169 AAAATCT 10 0.0 3232.0 185-189 CTTCTAC 10 0.0 3232.0 190 CGAGGCA 5 0.0011762339 2154.6667 150-154 GATGTCA 10 0.0015684736 1616.0 170-174 GAATCGA 10 0.0015684736 1616.0 165-169 GTTGATA 5 0.003919971 1292.8 155-159 TGTGAAA 5 0.003919971 1292.8 180-184 ATCTTCT 5 0.003919971 1292.8 185-189 TCGATGT 5 0.003919971 1292.8 165-169 GATACGT 5 0.003919971 1292.8 155-159 ACGTCGA 5 0.003919971 1292.8 160-164 GTCAAAT 5 0.003919971 1292.8 170-174 TCGAATC 5 0.003919971 1292.8 160-164 GAAAAAT 5 0.003919971 1292.8 180-184 GTCGAAT 5 0.003919971 1292.8 160-164 TGATACG 5 0.003919971 1292.8 155-159 TACGTCG 5 0.003919971 1292.8 160-164 ATACGTC 5 0.003919971 1292.8 155-159 >>END_MODULE Read 322422 spots for ERR1806571.sra Written 322422 spots for ERR1806571.sra Read 322422 spots for ERR1806571.sra Written 322422 spots for ERR1806571.sra Read 322422 spots for ERR1806571.sra Written 322422 spots for ERR1806571.sra Read 322422 spots for ERR1806571.sra Written 322422 spots for ERR1806571.sra Read 322422 spots for ERR1806571.sra Written 322422 spots for ERR1806571.sra Read 322437 spots for ERR1806571.sra Written 322437 spots for ERR1806571.sra Read 322422 spots for ERR1806571.sra Written 322422 spots for ERR1806571.sra Read 322422 spots for ERR1806571.sra Written 322422 spots for ERR1806571.sra Read 322422 spots for ERR1806571.sra Written 322422 spots for ERR1806571.sra Read 322422 spots for ERR1806571.sra Written 322422 spots for ERR1806571.sra Read 322422 spots for ERR1806571.sra Written 322422 spots for ERR1806571.sra Read 322422 spots for ERR1806571.sra Written 322422 spots for ERR1806571.sra Read 322422 spots for ERR1806571.sra Written 322422 spots for ERR1806571.sra Read 322422 spots for ERR1806571.sra Written 322422 spots for ERR1806571.sra Read 322422 spots for ERR1806571.sra Written 322422 spots for ERR1806571.sra Read 322422 spots for ERR1806571.sra Written 322422 spots for ERR1806571.sra Read 322422 spots for ERR1806571.sra Written 322422 spots for ERR1806571.sra Read 322422 spots for ERR1806571.sra Written 322422 spots for ERR1806571.sra Read 322422 spots for ERR1806571.sra Written 322422 spots for ERR1806571.sra Read 322422 spots for ERR1806571.sra Written 322422 spots for ERR1806571.sra SRR ids: ['ERR1806571.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nvfh_x_s ERR1806571.sra spots: 6448455 blocks: [[1, 322422], [322423, 644844], [644845, 967266], [967267, 1289688], [1289689, 1612110], [1612111, 1934532], [1934533, 2256954], [2256955, 2579376], [2579377, 2901798], [2901799, 3224220], [3224221, 3546642], [3546643, 3869064], [3869065, 4191486], [4191487, 4513908], [4513909, 4836330], [4836331, 5158752], [5158753, 5481174], [5481175, 5803596], [5803597, 6126018], [6126019, 6448455]] ERR1806571 file size 1291972 ERR1806571 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1806571 ERR1806571_1.fastq Input file: ERR1806571_1.fastq trimmed: ERR1806571-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 16:56:45 2024 >> started Mon Dec 9 16:56:49 2024 >> done (3.523s) 6448455 reads processed; of these: 199550 ( 3.09%) short reads filtered out after trimming by size control 11 ( 0.00%) empty reads filtered out after trimming by size control 6248894 (96.91%) reads available; of these: 100063 ( 1.60%) trimmed reads available after processing 6148831 (98.40%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 18881 0.30% 19 18691 0.30% 20 18290 0.29% 21 18660 0.30% 22 18215 0.29% 23 18304 0.29% 24 19654 0.31% 25 19088 0.31% 26 19787 0.32% 27 20748 0.33% 28 21091 0.34% 29 21324 0.34% 30 22531 0.36% 31 22198 0.36% 32 22999 0.37% 33 24996 0.40% 34 25790 0.41% 35 24992 0.40% 36 27206 0.44% 37 26774 0.43% 38 27803 0.44% 39 30773 0.49% 40 29857 0.48% 41 31226 0.50% 42 37057 0.59% 43 34067 0.55% 44 35276 0.56% 45 38565 0.62% 46 39247 0.63% 47 40418 0.65% 48 43322 0.69% 49 44332 0.71% 50 45453 0.73% 51 49556 0.79% 52 49746 0.80% 53 51109 0.82% 54 54618 0.87% 55 56763 0.91% 56 57398 0.92% 57 60473 0.97% 58 61634 0.99% 59 65067 1.04% 60 73531 1.18% 61 71407 1.14% 62 69181 1.11% 63 75376 1.21% 64 73290 1.17% 65 72731 1.16% 66 75057 1.20% 67 78395 1.25% 68 78678 1.26% 69 82018 1.31% 70 82832 1.33% 71 79722 1.28% 72 81867 1.31% 73 80775 1.29% 74 82032 1.31% 75 82885 1.33% 76 83863 1.34% 77 92032 1.47% 78 90917 1.45% 79 83013 1.33% 80 81968 1.31% 81 81283 1.30% 82 89210 1.43% 83 85763 1.37% 84 80826 1.29% 85 78555 1.26% 86 75466 1.21% 87 75664 1.21% 88 75240 1.20% 89 73293 1.17% 90 77609 1.24% 91 72283 1.16% 92 70585 1.13% 93 73825 1.18% 94 68975 1.10% 95 65792 1.05% 96 64591 1.03% 97 62082 0.99% 98 61396 0.98% 99 60867 0.97% 100 59929 0.96% 101 59317 0.95% 102 57163 0.91% 103 56653 0.91% 104 53801 0.86% 105 52639 0.84% 106 49584 0.79% 107 49355 0.79% 108 48139 0.77% 109 47723 0.76% 110 45028 0.72% 111 44329 0.71% 112 43183 0.69% 113 40527 0.65% 114 39310 0.63% 115 38910 0.62% 116 37238 0.60% 117 36353 0.58% 118 34743 0.56% 119 33387 0.53% 120 32590 0.52% 121 31258 0.50% 122 30358 0.49% 123 29127 0.47% 124 28151 0.45% 125 27365 0.44% 126 26774 0.43% 127 25314 0.41% 128 24458 0.39% 129 23999 0.38% 130 22713 0.36% 131 22012 0.35% 132 21679 0.35% 133 20790 0.33% 134 20097 0.32% 135 19154 0.31% 136 18269 0.29% 137 17619 0.28% 138 17605 0.28% 139 16895 0.27% 140 16083 0.26% 141 15563 0.25% 142 14521 0.23% 143 13985 0.22% 144 13521 0.22% 145 13146 0.21% 146 12582 0.20% 147 12343 0.20% 148 11871 0.19% 149 11110 0.18% 150 10768 0.17% 151 10461 0.17% 152 9894 0.16% 153 9669 0.15% 154 9357 0.15% 155 9121 0.15% 156 8725 0.14% 157 8190 0.13% 158 7570 0.12% 159 7365 0.12% 160 7120 0.11% 161 6796 0.11% 162 6594 0.11% 163 6123 0.10% 164 6036 0.10% 165 5749 0.09% 166 5483 0.09% 167 5236 0.08% 168 5055 0.08% 169 4742 0.08% 170 4517 0.07% 171 4404 0.07% 172 4194 0.07% 173 3896 0.06% 174 3611 0.06% 175 3479 0.06% 176 3352 0.05% 177 3239 0.05% 178 3073 0.05% 179 2867 0.05% 180 2683 0.04% 181 2627 0.04% 182 2499 0.04% 183 2425 0.04% 184 2304 0.04% 185 2093 0.03% 186 1953 0.03% 187 1853 0.03% 188 1845 0.03% 189 1683 0.03% 190 1630 0.03% 191 1506 0.02% 192 1471 0.02% 193 1297 0.02% 194 1212 0.02% 195 1131 0.02% 196 1071 0.02% 197 1005 0.02% 198 1004 0.02% 199 937 0.01% 200 855 0.01% 201 798 0.01% 202 756 0.01% 203 710 0.01% 204 649 0.01% 205 603 0.01% 206 546 0.01% 207 492 0.01% 208 475 0.01% 209 415 0.01% 210 427 0.01% 211 367 0.01% 212 350 0.01% 213 337 0.01% 214 307 0.00% 215 262 0.00% 216 239 0.00% 217 243 0.00% 218 184 0.00% 219 189 0.00% 220 182 0.00% 221 163 0.00% 222 140 0.00% 223 119 0.00% 224 102 0.00% 225 107 0.00% 226 72 0.00% 227 87 0.00% 228 80 0.00% 229 75 0.00% 230 68 0.00% 231 43 0.00% 232 38 0.00% 233 40 0.00% 234 36 0.00% 235 39 0.00% 236 25 0.00% 237 34 0.00% 238 34 0.00% 239 14 0.00% 240 22 0.00% 241 19 0.00% 242 12 0.00% 243 18 0.00% 244 14 0.00% 245 10 0.00% 246 4 0.00% 247 4 0.00% 248 8 0.00% 249 7 0.00% 250 6 0.00% 251 3 0.00% 252 4 0.00% 253 3 0.00% 254 4 0.00% 255 5 0.00% 256 2 0.00% 257 1 0.00% 258 3 0.00% 259 1 0.00% 260 2 0.00% 261 3 0.00% 262 2 0.00% 263 0 0.00% 264 0 0.00% 265 0 0.00% 266 0 0.00% 267 0 0.00% 268 0 0.00% 269 0 0.00% 270 1 0.00% 271 1 0.00% 272 0 0.00% 273 0 0.00% 274 0 0.00% 275 1 0.00% 6248894 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=4.26 fanout-score-rank=20 prefix-density=0.22 prefix-fanout=3.5 sequence=GGCAAGACCATCAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=323.02 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=15.1 sequence=CAGCAGCAGAGAGCCGGAGCGCCACCAGCCATCCGATCAAAACACACAGATCAATCCGATGGCTCTCGCTCTCTCCGGTTCCTCGGCTGCTGCCCGCGCGCTGGCCCAGCTGCTGGCCCCGTCCACCA Started job on | Dec 09 16:57:18 Started mapping on | Dec 09 16:57:18 Finished on | Dec 09 16:57:31 Mapping speed, Million of reads per hour | 1730.46 Number of input reads | 6248894 Average input read length | 83 UNIQUE READS: Uniquely mapped reads number | 5015548 Uniquely mapped reads % | 80.26% Average mapped length | 78.69 Number of splices: Total | 1345565 Number of splices: Annotated (sjdb) | 1269809 Number of splices: GT/AG | 1317587 Number of splices: GC/AG | 14842 Number of splices: AT/AC | 1149 Number of splices: Non-canonical | 11987 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.14% Deletion average length | 1.09 Insertion rate per base | 0.17% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 183201 % of reads mapped to multiple loci | 2.93% Number of reads mapped to too many loci | 91553 % of reads mapped to too many loci | 1.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 15.05% % of reads unmapped: other | 0.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1050145 1050145 1050145 N_multimapping 183201 183201 183201 N_noFeature 161528 200533 4914903 N_ambiguous 71155 9935 571 UnstrandedReadsAssigned:4782865 PositiveStrandReadsAssigned:4805080 NegativeStrandReadsAssigned:100074 Dataset is classified positive stranded MeadianReadLen=81 20thPercentileLength=57 echo kmer=53 ERR1806571 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR1806571-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,248,894 reads, 4,953,787 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 994 rounds 52973 ERR1806571.ke.tsv 35125 ERR1806571.se.tsv 88098 total ==> ERR1806571.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 57.4357 21.4994 PNS24247 1044 945 14.5833 4.83497 PNS24249 1928 1829 48.004 8.22305 PNS24246 1044 945 14.5833 4.83497 PNS24248 1044 945 14.5833 4.83497 PNS24244 1471 1372 35.8103 8.17755 PNS24243 293 194 0 0 KQK14069 1603 1504 962.921 200.591 KQK14071 474 375 40.4326 33.7808 ==> ERR1806571.se.tsv <== BRADI_1g14170v3 1067 BRADI_1g53295v3 37 BRADI_1g59795v3 82 BRADI_1g07683v3 0 BRADI_1g00485v3 12 BRADI_1g20270v3 472 BRADI_1g74790v3 68 BRADI_1g09890v3 0 BRADI_1g77505v3 104 BRADI_1g48960v3 0 ERR1806571 completed mapping pipeline successfully