Starting /dee2/code/volunteer_pipeline.sh ERR1806572 current disk space = 1523707994112 free memory = 1605387856 ERR1806572 SRAfilesize 8cd30e24dddc54de34c782da54f612ef ERR1806572.sra ERR1806572.sra file validated ERR1806572 is single end ERR1806572 is conventional basespace ERR1806572 read1 length is 8-206 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1806572_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 8-206 %GC 51 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.51525 24.0 21.0 26.0 18.0 28.0 2 23.83375 25.0 21.0 27.0 16.0 29.0 3 23.395 25.0 21.0 27.0 16.0 28.0 4 23.49325 25.0 21.0 27.0 17.0 28.0 5 23.43475 25.0 21.0 27.0 16.0 28.0 6 23.3855 25.0 21.0 27.0 16.0 28.0 7 23.2015 25.0 20.0 27.0 16.0 28.0 8 23.13025 24.0 20.0 27.0 16.0 28.0 9 23.220886551465064 25.0 21.0 27.0 16.0 28.0 10-14 23.28750991699575 25.0 21.0 27.0 16.2 28.0 15-19 23.563539206028537 25.0 21.0 27.0 17.0 28.0 20-24 23.70825638895765 25.0 21.0 27.0 17.2 28.0 25-29 23.652340846748718 25.0 21.0 27.0 17.2 28.0 30-34 23.57224598281952 25.0 21.0 27.0 17.8 28.0 35-39 23.566048733960272 25.0 21.0 26.8 17.2 28.0 40-44 23.513450816820377 25.0 21.0 26.4 17.8 28.0 45-49 23.45110641797049 25.0 21.0 26.4 17.0 28.0 50-54 23.441781830787374 25.0 21.0 26.0 17.2 27.8 55-59 23.398546280345332 25.0 21.0 26.0 17.6 27.6 60-64 23.361227916501726 25.0 21.0 26.0 17.0 27.8 65-69 23.332607364856248 25.0 21.0 26.0 17.2 27.6 70-74 23.32480102253556 25.0 21.0 26.0 17.0 27.2 75-79 23.272898454165023 24.6 20.8 26.0 17.0 27.2 80-84 23.091271886214983 24.0 20.2 26.0 16.8 27.0 85-89 23.07467616787953 24.2 20.0 26.0 16.8 27.0 90-94 22.979348991516513 24.2 20.2 26.0 16.4 27.0 95-99 22.857322526978542 24.0 20.0 26.0 16.6 27.0 100-104 22.923248328549015 24.0 20.0 26.0 16.4 27.0 105-109 22.855572345548296 24.0 20.0 26.0 17.0 27.0 110-114 22.655958712560388 23.8 20.0 26.0 16.4 27.0 115-119 22.47884040371317 23.6 20.0 26.0 16.2 27.0 120-124 22.264341955138143 23.2 19.6 25.8 15.8 27.0 125-129 22.082055871821062 22.8 19.6 25.4 15.6 27.0 130-134 21.862800200144285 22.8 19.4 25.0 14.8 26.4 135-139 21.626725900536098 22.4 19.0 25.0 14.4 26.2 140-144 21.230598550322615 22.0 18.2 25.0 13.4 26.4 145-149 21.374569947596264 22.0 18.8 25.0 13.6 26.0 150-154 21.47820416687417 22.4 18.6 24.8 14.8 26.0 155-159 21.196046031969544 21.5 18.0 25.0 13.5 26.5 160-164 21.073633518850908 NaN NaN NaN NaN NaN 165-169 20.243089920819934 NaN NaN NaN NaN NaN 170-174 19.310187160751955 NaN NaN NaN NaN NaN 175-179 18.012434691745035 NaN NaN NaN NaN NaN 180-184 18.04510889110889 NaN NaN NaN NaN NaN 185-189 17.403534855237645 NaN NaN NaN NaN NaN 190-194 19.279545454545456 NaN NaN NaN NaN NaN 195-199 20.006666666666668 NaN NaN NaN NaN NaN 200-204 17.833333333333332 NaN NaN NaN NaN NaN 205-206 18.0 NaN NaN NaN NaN NaN >>END_MODULE >>Per sequence quality scores warn #Quality Count 11 1.0 12 5.0 13 10.0 14 10.0 15 17.0 16 48.0 17 80.0 18 101.0 19 165.0 20 213.0 21 302.0 22 465.0 23 671.0 24 903.0 25 832.0 26 170.0 27 7.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.775 44.675 16.425 14.124999999999998 2 42.425000000000004 35.199999999999996 6.25 16.125 3 31.45 32.725 18.075 17.75 4 36.199999999999996 29.075 15.9 18.825 5 30.025000000000002 28.000000000000004 16.925 25.05 6 25.85 28.925 19.575 25.650000000000002 7 22.375 30.349999999999998 24.9 22.375 8 25.474999999999998 27.725 21.224999999999998 25.575 9 26.095667417981467 22.890057600801402 23.741547708489858 27.27272727272727 10-14 27.374189331858627 25.328037806042936 23.50309185058569 23.794681011512743 15-19 27.849002849002847 25.08140008140008 22.58852258852259 24.48107448107448 20-24 27.833196215549155 24.712052653229126 22.58329905388729 24.87145207733443 25-29 26.75513921415561 25.084569346864427 23.471246422066095 24.68904501691387 30-34 27.562079124579125 24.71064814814815 22.911405723905723 24.815867003367003 35-39 27.110069758773097 24.271792960221525 23.446402896852867 25.17173438415251 40-44 26.894268345636124 24.554928354320452 23.51823708206687 25.032566217976555 45-49 27.021158129175948 24.599109131403118 22.85077951002227 25.528953229398667 50-54 27.363472810632 23.951018513144913 23.852359120190357 24.833149556032733 55-59 26.409242930982064 24.256612952265126 23.22286409242931 26.111280024323502 60-64 26.479548842937707 24.24320995656965 23.945031438387243 25.3322097621054 65-69 27.00519735917966 24.59615114482371 22.966708807416772 25.431942688579856 70-74 25.569620253164555 25.0939777522056 24.380514000767164 24.955887993862678 75-79 26.428694010640125 23.82014758881071 24.35215376694697 25.399004633602196 80-84 26.651681000781863 24.775215011727912 23.387412040656763 25.185691946833465 85-89 26.552655265526553 24.437443744374438 24.234923492349235 24.774977497749777 90-94 26.552795031055897 24.314182194616976 23.744824016563147 25.388198757763973 95-99 24.96224705527031 25.113258834189068 24.071277559649655 25.853216550890966 100-104 26.467351430667645 24.394717534849597 24.192956713132794 24.944974321349964 105-109 26.061689763075545 23.73714796602593 24.49709432275369 25.70406794814484 110-114 26.794520547945204 24.164383561643834 24.246575342465754 24.794520547945208 115-119 25.310660562459127 25.833878351863966 24.166121648136034 24.689339437540877 120-124 25.67622123536536 25.353249899071457 24.788050060557126 24.182478805006056 125-129 24.23191278493558 25.817641228939543 24.182358771060457 25.768087215064423 130-134 26.6546329723225 25.451263537906136 24.127557160048134 23.766546329723226 135-139 26.09351432880845 24.660633484162897 23.981900452488688 25.26395173453997 140-144 25.0 24.031007751937985 23.837209302325583 27.131782945736433 145-149 26.674937965260547 21.339950372208435 23.82133995037221 28.16377171215881 150-154 23.006134969325153 26.380368098159508 25.61349693251534 25.0 155-159 25.0 25.403225806451612 23.790322580645164 25.806451612903224 160-164 23.705722070844686 29.70027247956403 23.160762942779293 23.43324250681199 165-169 24.82758620689655 25.862068965517242 27.241379310344826 22.06896551724138 170-174 30.275229357798167 22.93577981651376 24.31192660550459 22.477064220183486 175-179 30.128205128205128 21.153846153846153 23.717948717948715 25.0 180-184 19.298245614035086 28.947368421052634 21.929824561403507 29.82456140350877 185-189 12.987012987012985 29.87012987012987 25.97402597402597 31.16883116883117 190-194 30.76923076923077 28.846153846153843 25.0 15.384615384615385 195-199 21.73913043478261 21.73913043478261 34.78260869565217 21.73913043478261 200-204 35.714285714285715 28.57142857142857 0.0 35.714285714285715 205-206 0.0 100.0 0.0 0.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 1.0 9 1.5 10 2.0 11 2.0 12 1.5 13 1.0 14 1.0 15 1.5 16 2.0 17 2.5 18 3.0 19 2.0 20 1.0 21 2.0 22 3.0 23 3.0 24 4.0 25 5.5 26 6.5 27 7.0 28 8.0 29 11.0 30 15.0 31 17.5 32 22.0 33 28.0 34 33.5 35 46.0 36 60.5 37 70.0 38 88.0 39 113.0 40 125.0 41 142.0 42 162.5 43 174.5 44 192.0 45 206.0 46 213.5 47 234.0 48 241.83333333333331 49 232.83333333333331 50 248.5 51 259.5 52 242.5 53 227.5 54 230.33333333333334 55 215.0 56 188.0 57 168.5 58 165.0 59 158.5 60 149.0 61 156.33333333333331 62 143.5 63 128.5 64 124.5 65 113.0 66 105.0 67 101.0 68 88.0 69 74.5 70 62.5 71 54.5 72 50.0 73 47.5 74 43.5 75 33.5 76 25.0 77 16.5 78 10.5 79 9.5 80 9.5 81 7.5 82 3.5 83 1.5 84 1.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-159 0.0 160-164 0.0 165-169 0.0 170-174 0.0 175-179 0.0 180-184 0.0 185-189 0.0 190-194 0.0 195-199 0.0 200-204 0.0 205-206 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 5-9 10.0 10-14 35.0 15-19 52.0 20-24 43.0 25-29 40.0 30-34 44.0 35-39 65.0 40-44 68.0 45-49 138.0 50-54 144.0 55-59 190.0 60-64 225.0 65-69 241.0 70-74 255.0 75-79 285.0 80-84 284.0 85-89 250.0 90-94 215.0 95-99 242.0 100-104 204.0 105-109 179.0 110-114 137.0 115-119 123.0 120-124 98.0 125-129 73.0 130-134 74.0 135-139 54.0 140-144 56.0 145-149 31.0 150-154 32.0 155-159 35.0 160-164 11.0 165-169 19.0 170-174 13.0 175-179 9.0 180-184 7.0 185-189 7.0 190-194 5.0 195-199 4.0 200-204 2.0 205-207 1.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54614220877458 98.7 2 0.27735753908219873 0.5499999999999999 3 0.10085728693898136 0.3 4 0.05042864346949068 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02521432173474534 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACTCCAAGATCATCAACGACAGGGAGACTGGCCGTTCCCGCGGGTTCGGC 10 0.25 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.0 0.0 0.0 0.0 0.0 80-84 0.0 0.0 0.0 0.0 0.0 85-89 0.0 0.0 0.0 0.0 0.0 90-94 0.0 0.0 0.0 0.0 0.0 95-99 0.0 0.0 0.0 0.0 0.0 100-104 0.0 0.0 0.0 0.0 0.0 105-109 0.0 0.0 0.0 0.0 0.0 110-114 0.0 0.0 0.0 0.0 0.0 115-119 0.0 0.0 0.0 0.0 0.0 120-124 0.0 0.0 0.0 0.0 0.0 125-129 0.0 0.0 0.0 0.0 0.0 130-134 0.0 0.0 0.0 0.0 0.0 135-139 0.0 0.0 0.0 0.0 0.0 140-144 0.0 0.0 0.0 0.0 0.0 145-149 0.0 0.0 0.0 0.0 0.0 150-154 0.0 0.0 0.0 0.0 0.0 155-159 0.0 0.0 0.0 0.0 0.0 160-164 0.0 0.0 0.0 0.0 0.0 165-169 0.0 0.0 0.0 0.0 0.0 170-174 0.0 0.0 0.0 0.0 0.0 175-179 0.0 0.0 0.0 0.0 0.0 180-184 0.0 0.0 0.0 0.0 0.0 185-189 0.0 0.0 0.0 0.0 0.0 190-194 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTTTGG 5 4.0377653E-4 3185.0 145-149 CTGGACC 15 0.0 2123.3335 150 TCCCAGG 10 0.004844304 1061.6667 135-139 CACACTG 5 0.006054113 1061.6667 145-149 CACTGGA 5 0.006054113 1061.6667 145-149 GCACACT 5 0.006054113 1061.6667 145-149 ACACTGG 10 0.009686581 796.25 145-149 >>END_MODULE Read 314247 spots for ERR1806572.sra Written 314247 spots for ERR1806572.sra Read 314247 spots for ERR1806572.sra Written 314247 spots for ERR1806572.sra Read 314247 spots for ERR1806572.sra Written 314247 spots for ERR1806572.sra Read 314247 spots for ERR1806572.sra Written 314247 spots for ERR1806572.sra Read 314247 spots for ERR1806572.sra Written 314247 spots for ERR1806572.sra Read 314247 spots for ERR1806572.sra Written 314247 spots for ERR1806572.sra Read 314247 spots for ERR1806572.sra Written 314247 spots for ERR1806572.sra Read 314247 spots for ERR1806572.sra Written 314247 spots for ERR1806572.sra Read 314247 spots for ERR1806572.sra Written 314247 spots for ERR1806572.sra Read 314247 spots for ERR1806572.sra Written 314247 spots for ERR1806572.sra Read 314247 spots for ERR1806572.sra Written 314247 spots for ERR1806572.sra Read 314247 spots for ERR1806572.sra Written 314247 spots for ERR1806572.sra Read 314247 spots for ERR1806572.sra Written 314247 spots for ERR1806572.sra Read 314266 spots for ERR1806572.sra Written 314266 spots for ERR1806572.sra Read 314247 spots for ERR1806572.sra Written 314247 spots for ERR1806572.sra Read 314247 spots for ERR1806572.sra Written 314247 spots for ERR1806572.sra Read 314247 spots for ERR1806572.sra Written 314247 spots for ERR1806572.sra Read 314247 spots for ERR1806572.sra Written 314247 spots for ERR1806572.sra Read 314247 spots for ERR1806572.sra Written 314247 spots for ERR1806572.sra Read 314247 spots for ERR1806572.sra Written 314247 spots for ERR1806572.sra SRR ids: ['ERR1806572.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_26dtfk1z ERR1806572.sra spots: 6284959 blocks: [[1, 314247], [314248, 628494], [628495, 942741], [942742, 1256988], [1256989, 1571235], [1571236, 1885482], [1885483, 2199729], [2199730, 2513976], [2513977, 2828223], [2828224, 3142470], [3142471, 3456717], [3456718, 3770964], [3770965, 4085211], [4085212, 4399458], [4399459, 4713705], [4713706, 5027952], [5027953, 5342199], [5342200, 5656446], [5656447, 5970693], [5970694, 6284959]] ERR1806572 file size 1294964 ERR1806572 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1806572 ERR1806572_1.fastq Input file: ERR1806572_1.fastq trimmed: ERR1806572-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 16:56:56 2024 >> started Mon Dec 9 16:56:59 2024 >> done (3.173s) 6284959 reads processed; of these: 119658 ( 1.90%) short reads filtered out after trimming by size control 4 ( 0.00%) empty reads filtered out after trimming by size control 6165297 (98.10%) reads available; of these: 97675 ( 1.58%) trimmed reads available after processing 6067622 (98.42%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 12670 0.21% 19 12066 0.20% 20 11837 0.19% 21 11991 0.19% 22 12108 0.20% 23 12228 0.20% 24 13381 0.22% 25 12949 0.21% 26 13365 0.22% 27 14242 0.23% 28 14892 0.24% 29 15097 0.24% 30 16463 0.27% 31 16363 0.27% 32 16855 0.27% 33 18747 0.30% 34 19617 0.32% 35 19410 0.31% 36 21465 0.35% 37 21619 0.35% 38 23265 0.38% 39 26561 0.43% 40 25942 0.42% 41 27258 0.44% 42 32551 0.53% 43 30890 0.50% 44 32004 0.52% 45 36169 0.59% 46 36866 0.60% 47 37867 0.61% 48 41826 0.68% 49 43136 0.70% 50 44399 0.72% 51 49274 0.80% 52 50114 0.81% 53 51050 0.83% 54 55585 0.90% 55 56346 0.91% 56 57905 0.94% 57 62285 1.01% 58 62748 1.02% 59 65436 1.06% 60 70836 1.15% 61 71183 1.15% 62 69968 1.13% 63 75992 1.23% 64 74462 1.21% 65 74217 1.20% 66 76227 1.24% 67 76763 1.25% 68 79200 1.28% 69 81751 1.33% 70 82038 1.33% 71 81957 1.33% 72 84527 1.37% 73 81341 1.32% 74 82651 1.34% 75 84236 1.37% 76 83315 1.35% 77 90584 1.47% 78 90699 1.47% 79 82845 1.34% 80 81276 1.32% 81 82004 1.33% 82 85852 1.39% 83 81968 1.33% 84 80386 1.30% 85 79441 1.29% 86 75185 1.22% 87 76584 1.24% 88 74824 1.21% 89 73245 1.19% 90 75636 1.23% 91 71250 1.16% 92 69993 1.14% 93 73662 1.19% 94 68620 1.11% 95 66287 1.08% 96 66251 1.07% 97 62113 1.01% 98 62007 1.01% 99 60950 0.99% 100 60092 0.97% 101 58534 0.95% 102 57922 0.94% 103 58356 0.95% 104 54068 0.88% 105 52366 0.85% 106 49934 0.81% 107 49881 0.81% 108 48530 0.79% 109 48440 0.79% 110 45697 0.74% 111 44929 0.73% 112 43829 0.71% 113 40926 0.66% 114 41198 0.67% 115 39962 0.65% 116 38064 0.62% 117 37273 0.60% 118 36158 0.59% 119 34642 0.56% 120 33960 0.55% 121 32231 0.52% 122 32047 0.52% 123 30173 0.49% 124 29352 0.48% 125 28659 0.46% 126 27822 0.45% 127 26649 0.43% 128 25244 0.41% 129 24968 0.40% 130 24244 0.39% 131 23008 0.37% 132 22538 0.37% 133 21760 0.35% 134 21318 0.35% 135 20648 0.33% 136 19470 0.32% 137 19050 0.31% 138 18844 0.31% 139 18025 0.29% 140 17664 0.29% 141 16499 0.27% 142 15679 0.25% 143 14872 0.24% 144 14567 0.24% 145 14250 0.23% 146 13695 0.22% 147 13552 0.22% 148 12654 0.21% 149 11838 0.19% 150 11818 0.19% 151 11172 0.18% 152 10511 0.17% 153 10510 0.17% 154 10080 0.16% 155 10011 0.16% 156 9436 0.15% 157 9057 0.15% 158 8496 0.14% 159 8273 0.13% 160 7967 0.13% 161 7606 0.12% 162 7165 0.12% 163 7155 0.12% 164 6753 0.11% 165 6504 0.11% 166 6212 0.10% 167 5987 0.10% 168 5752 0.09% 169 5367 0.09% 170 5128 0.08% 171 4945 0.08% 172 4727 0.08% 173 4460 0.07% 174 4192 0.07% 175 3997 0.06% 176 3835 0.06% 177 3741 0.06% 178 3430 0.06% 179 3275 0.05% 180 3186 0.05% 181 3094 0.05% 182 2807 0.05% 183 2658 0.04% 184 2671 0.04% 185 2422 0.04% 186 2319 0.04% 187 2160 0.04% 188 2068 0.03% 189 1988 0.03% 190 1806 0.03% 191 1746 0.03% 192 1676 0.03% 193 1464 0.02% 194 1550 0.03% 195 1326 0.02% 196 1276 0.02% 197 1198 0.02% 198 1114 0.02% 199 1071 0.02% 200 956 0.02% 201 887 0.01% 202 876 0.01% 203 850 0.01% 204 747 0.01% 205 706 0.01% 206 665 0.01% 207 591 0.01% 208 589 0.01% 209 557 0.01% 210 489 0.01% 211 457 0.01% 212 406 0.01% 213 384 0.01% 214 328 0.01% 215 320 0.01% 216 302 0.00% 217 283 0.00% 218 233 0.00% 219 242 0.00% 220 206 0.00% 221 187 0.00% 222 157 0.00% 223 160 0.00% 224 150 0.00% 225 125 0.00% 226 111 0.00% 227 107 0.00% 228 87 0.00% 229 86 0.00% 230 69 0.00% 231 68 0.00% 232 56 0.00% 233 54 0.00% 234 42 0.00% 235 49 0.00% 236 38 0.00% 237 26 0.00% 238 35 0.00% 239 22 0.00% 240 21 0.00% 241 23 0.00% 242 25 0.00% 243 9 0.00% 244 9 0.00% 245 13 0.00% 246 15 0.00% 247 10 0.00% 248 11 0.00% 249 3 0.00% 250 10 0.00% 251 8 0.00% 252 3 0.00% 253 5 0.00% 254 1 0.00% 255 0 0.00% 256 2 0.00% 257 2 0.00% 258 2 0.00% 259 1 0.00% 260 5 0.00% 261 2 0.00% 262 0 0.00% 263 0 0.00% 264 0 0.00% 265 1 0.00% 266 0 0.00% 267 0 0.00% 268 1 0.00% 269 0 0.00% 270 0 0.00% 271 0 0.00% 272 1 0.00% 6165297 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=4.05 fanout-score-rank=30 prefix-density=0.27 prefix-fanout=3.0 sequence=AAGATCCAGGACAAGGAGGGCAT criterion=fanout-score sequence-density=0.09 sequence-density-rank=8 fanout-score=54.89 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=12.6 sequence=GAGAAGAAGGAC Started job on | Dec 09 16:58:21 Started mapping on | Dec 09 16:58:21 Finished on | Dec 09 16:58:33 Mapping speed, Million of reads per hour | 1849.59 Number of input reads | 6165297 Average input read length | 85 UNIQUE READS: Uniquely mapped reads number | 5113616 Uniquely mapped reads % | 82.94% Average mapped length | 81.31 Number of splices: Total | 1407848 Number of splices: Annotated (sjdb) | 1329544 Number of splices: GT/AG | 1379648 Number of splices: GC/AG | 15602 Number of splices: AT/AC | 1291 Number of splices: Non-canonical | 11307 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.14% Deletion average length | 1.09 Insertion rate per base | 0.18% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 165158 % of reads mapped to multiple loci | 2.68% Number of reads mapped to too many loci | 78587 % of reads mapped to too many loci | 1.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.84% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 886523 886523 886523 N_multimapping 165158 165158 165158 N_noFeature 144545 185033 5010448 N_ambiguous 71497 9207 504 UnstrandedReadsAssigned:4897574 PositiveStrandReadsAssigned:4919376 NegativeStrandReadsAssigned:102664 Dataset is classified positive stranded MeadianReadLen=82 20thPercentileLength=59 echo kmer=55 ERR1806572 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR1806572-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,165,297 reads, 5,081,029 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,005 rounds 52973 ERR1806572.ke.tsv 35125 ERR1806572.se.tsv 88098 total ==> ERR1806572.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 81.1275 28.9075 PNS24247 1044 945 11.6667 3.68199 PNS24249 1928 1829 47.401 7.72932 PNS24246 1044 945 11.6667 3.68199 PNS24248 1044 945 11.6667 3.68199 PNS24244 1471 1372 49.4714 10.754 PNS24243 293 194 0 0 KQK14069 1603 1504 1037.41 205.717 KQK14071 474 375 103.178 82.0582 ==> ERR1806572.se.tsv <== BRADI_1g14170v3 1181 BRADI_1g53295v3 37 BRADI_1g59795v3 102 BRADI_1g07683v3 0 BRADI_1g00485v3 14 BRADI_1g20270v3 613 BRADI_1g74790v3 86 BRADI_1g09890v3 0 BRADI_1g77505v3 105 BRADI_1g48960v3 0 ERR1806572 completed mapping pipeline successfully