Starting /dee2/code/volunteer_pipeline.sh ERR1806573 current disk space = 1523719356416 free memory = 1580412336 ERR1806573 SRAfilesize dce43d8f517a4f94b1bd72fa521a4c8a ERR1806573.sra ERR1806573.sra file validated ERR1806573 is single end ERR1806573 is conventional basespace ERR1806573 read1 length is 8-213 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1806573_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 8-213 %GC 51 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.01125 24.0 21.0 26.0 18.0 27.0 2 22.88575 24.0 20.0 26.0 16.0 28.0 3 22.7935 24.0 20.0 26.0 16.0 28.0 4 22.9545 24.0 20.0 26.0 16.0 28.0 5 23.00475 24.0 20.0 26.0 16.0 28.0 6 22.93925 24.0 20.0 26.0 16.0 28.0 7 22.8195 24.0 20.0 26.0 16.0 28.0 8 22.8555 24.0 20.0 26.0 16.0 28.0 9 22.78878878878879 24.0 20.0 26.0 16.0 28.0 10-14 22.778375235398162 24.0 20.0 26.0 16.0 27.6 15-19 23.05837269904665 24.0 20.4 26.0 16.6 28.0 20-24 23.314690104977274 25.0 21.0 26.0 17.0 28.0 25-29 23.329700333795227 25.0 21.0 26.0 17.0 28.0 30-34 23.20118318968299 24.0 20.8 26.0 17.0 27.6 35-39 23.184786095458197 24.2 20.4 26.0 17.0 27.8 40-44 23.21606774256039 24.2 21.0 26.0 17.0 27.8 45-49 23.0787952150058 24.0 20.4 26.0 16.8 27.0 50-54 23.08858588182013 24.0 20.4 26.0 16.8 27.0 55-59 23.038241451629062 24.0 20.0 26.0 16.8 27.0 60-64 23.053600151590423 24.0 20.0 26.0 17.0 27.2 65-69 23.075184134289945 24.0 20.2 26.0 17.0 27.0 70-74 23.11004537611755 24.0 20.0 26.0 17.0 27.0 75-79 22.97307798567977 24.0 20.0 26.0 17.0 27.0 80-84 22.946930481518056 24.0 20.0 26.0 16.6 27.0 85-89 22.896192227777924 24.0 20.0 26.0 16.6 27.0 90-94 22.8236541883603 24.0 20.0 26.0 16.0 27.0 95-99 22.79094417186507 24.0 20.0 26.0 16.6 27.0 100-104 22.824683363868715 24.0 20.0 26.0 16.6 27.0 105-109 22.689646018761 24.0 20.0 26.0 16.6 27.0 110-114 22.744274543339838 24.0 20.0 26.0 16.8 27.0 115-119 22.624711945066853 23.4 20.0 26.0 16.6 27.0 120-124 22.374059444504212 23.2 20.0 26.0 15.8 27.0 125-129 22.217222252772533 23.2 19.4 25.4 15.4 27.0 130-134 21.88463663073171 23.0 19.0 25.0 15.2 27.0 135-139 21.834356240951813 22.8 19.4 25.0 14.6 27.0 140-144 21.56672548669303 22.6 19.0 25.0 14.0 26.0 145-149 21.225391223551107 22.0 18.6 24.8 14.2 26.2 150-154 20.961403849140282 21.8 17.8 24.4 13.8 26.2 155-159 20.504798565392655 21.0 17.8 24.0 13.6 26.0 160-164 20.882645264403816 21.4 18.6 24.0 13.8 25.8 165-169 20.2864964578301 21.5 18.0 23.5 14.5 25.5 170-174 20.153771616097192 NaN NaN NaN NaN NaN 175-179 20.298362557574073 NaN NaN NaN NaN NaN 180-184 19.771569556569556 NaN NaN NaN NaN NaN 185-189 19.515971959075404 NaN NaN NaN NaN NaN 190-194 19.12241927281973 NaN NaN NaN NaN NaN 195-199 20.065632798573972 NaN NaN NaN NaN NaN 200-204 22.130158730158733 NaN NaN NaN NaN NaN 205-209 21.246666666666666 NaN NaN NaN NaN NaN 210-213 19.291666666666664 NaN NaN NaN NaN NaN >>END_MODULE >>Per sequence quality scores warn #Quality Count 11 3.0 12 2.0 13 6.0 14 10.0 15 21.0 16 39.0 17 70.0 18 134.0 19 190.0 20 279.0 21 382.0 22 530.0 23 699.0 24 859.0 25 639.0 26 123.0 27 14.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.974999999999998 45.45 17.375 13.200000000000001 2 41.8 35.775 6.575 15.85 3 31.874999999999996 31.8 18.525 17.8 4 37.1 27.35 16.2 19.35 5 28.275 27.025 17.65 27.05 6 27.025 27.05 20.375 25.55 7 23.150000000000002 30.275000000000002 23.474999999999998 23.1 8 24.675 26.55 22.825 25.95 9 24.874874874874877 23.873873873873876 23.84884884884885 27.402402402402405 10-14 26.610672433737363 25.051551576723835 24.14122617311271 24.196549816426092 15-19 26.85743484925907 25.350025549310168 22.97904956566173 24.813490035769036 20-24 26.67881311816762 25.19521082769391 22.935970848516398 25.190005205622075 25-29 26.561838204150785 24.878229563744174 24.015247776365946 24.544684455739095 30-34 27.313989301345437 24.22326687199438 23.374939212189982 25.0878046144702 35-39 26.674773380499666 24.563342913995136 23.817156754366568 24.944726951138623 40-44 26.798315501934894 24.493512406100614 23.88458911905304 24.823582972911453 45-49 26.6347969782814 24.415722379603398 23.54225684608121 25.407223796033996 50-54 26.327433628318587 25.147492625368734 22.996558505408064 25.52851524090462 55-59 26.6036157755903 25.123849964614298 23.811362027922538 24.46117223187287 60-64 26.469782102233797 24.893791969302452 24.551185418665206 24.08524050979855 65-69 27.28404099560761 24.44363103953148 23.360175695461198 24.912152269399705 70-74 25.941915227629515 24.66248037676609 23.940345368916798 25.4552590266876 75-79 26.637813985064497 23.888323150033944 24.54175152749491 24.932111337406653 80-84 26.102292768959433 24.98839691822148 24.190104891859278 24.719205420959806 85-89 26.009244992295837 24.40677966101695 24.684129429892142 24.89984591679507 90-94 24.885740402193786 25.776965265082268 24.520109689213896 24.817184643510053 95-99 26.119212074699412 24.30289076490151 25.09593246354566 24.481964696853414 100-104 25.58883396336144 24.861878453038674 24.672870020354754 24.87641756324513 105-109 24.85089463220676 24.734923790589793 25.381047051027174 25.033134526176276 110-114 25.778038755137995 24.995106674495986 24.544920728126833 24.681933842239186 115-119 25.277057297807122 24.640414996463097 25.65432680971469 24.42820089601509 120-124 24.56623519691545 24.786560176259982 25.172128890112916 25.47507573671165 125-129 24.740932642487046 25.226683937823836 25.971502590673573 24.060880829015545 130-134 24.637112593173793 26.59866614358572 24.166339741074932 24.597881522165554 135-139 24.87708947885939 25.61455260570305 25.417895771878072 24.09046214355949 140-144 24.737167594310453 25.60296846011132 24.6134817563389 25.04638218923933 145-149 24.7244094488189 25.03937007874016 23.38582677165354 26.8503937007874 150-154 24.90234375 25.09765625 24.609375 25.390625 155-159 24.66091245376079 23.42786683107275 25.893958076448833 26.017262638717632 160-164 23.84737678855326 24.96025437201908 25.59618441971383 25.59618441971383 165-169 27.695560253699792 26.849894291754755 22.41014799154334 23.044397463002113 170-174 24.203821656050955 26.43312101910828 25.796178343949045 23.56687898089172 175-179 27.800829875518673 17.842323651452283 32.780082987551864 21.57676348547718 180-184 27.419354838709676 22.043010752688172 29.03225806451613 21.50537634408602 185-189 19.565217391304348 25.36231884057971 27.536231884057973 27.536231884057973 190-194 25.925925925925924 25.0 22.22222222222222 26.851851851851855 195-199 22.22222222222222 31.944444444444443 19.444444444444446 26.38888888888889 200-204 23.809523809523807 21.428571428571427 28.57142857142857 26.190476190476193 205-209 26.08695652173913 21.73913043478261 17.391304347826086 34.78260869565217 210-213 54.54545454545454 9.090909090909092 9.090909090909092 27.27272727272727 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 2.0 2 2.0 3 2.5 4 2.5 5 1.5 6 1.0 7 1.0 8 1.0 9 1.0 10 0.5 11 0.0 12 0.0 13 1.0 14 2.0 15 2.5 16 3.0 17 2.5 18 1.5 19 2.5 20 3.5 21 3.5 22 5.0 23 5.5 24 5.5 25 5.5 26 5.0 27 6.5 28 8.5 29 10.5 30 14.0 31 17.5 32 22.5 33 31.0 34 39.0 35 46.5 36 59.5 37 82.5 38 102.5 39 127.0 40 149.16666666666669 41 161.83333333333334 42 190.83333333333331 43 213.5 44 217.83333333333334 45 223.0 46 240.33333333333334 47 248.5 48 243.83333333333331 49 234.16666666666666 50 234.0 51 236.5 52 232.5 53 232.0 54 220.0 55 200.0 56 197.5 57 189.5 58 180.0 59 174.0 60 162.5 61 162.0 62 151.0 63 141.5 64 143.5 65 130.5 66 107.5 67 94.5 68 80.0 69 69.5 70 75.0 71 78.0 72 62.5 73 42.0 74 33.5 75 29.5 76 20.0 77 11.5 78 8.0 79 6.0 80 6.0 81 7.5 82 7.5 83 6.5 84 5.0 85 4.5 86 5.5 87 5.5 88 4.5 89 4.0 90 3.5 91 2.5 92 2.0 93 2.0 94 2.0 95 1.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-159 0.0 160-164 0.0 165-169 0.0 170-174 0.0 175-179 0.0 180-184 0.0 185-189 0.0 190-194 0.0 195-199 0.0 200-204 0.0 205-209 0.0 210-213 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 5-9 8.0 10-14 42.0 15-19 78.0 20-24 66.0 25-29 72.0 30-34 82.0 35-39 90.0 40-44 123.0 45-49 131.0 50-54 135.0 55-59 170.0 60-64 203.0 65-69 172.0 70-74 195.0 75-79 190.0 80-84 211.0 85-89 205.0 90-94 184.0 95-99 196.0 100-104 171.0 105-109 186.0 110-114 179.0 115-119 141.0 120-124 111.0 125-129 103.0 130-134 110.0 135-139 97.0 140-144 65.0 145-149 63.0 150-154 42.0 155-159 40.0 160-164 30.0 165-169 37.0 170-174 18.0 175-179 10.0 180-184 15.0 185-189 5.0 190-194 6.0 195-199 8.0 200-204 4.0 205-209 2.0 210-214 4.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06352822070362 97.85000000000001 2 0.7846114907618323 1.55 3 0.07593014426727411 0.22499999999999998 4 0.02531004808909137 0.1 5 0.02531004808909137 0.125 6 0.02531004808909137 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACTCCAAGATCATCAACGACAGGGAGACTGGCCGTTCCCGCGGGTTCGGC 6 0.15 No Hit ATGGGGGCCGGCGATGCGTCCTGGCCGTATGCGGAACGGCTTTTGCTGGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.0 0.0 0.0 0.0 0.0 80-84 0.0 0.0 0.0 0.0 0.0 85-89 0.0 0.0 0.0 0.0 0.0 90-94 0.0 0.0 0.0 0.0 0.0 95-99 0.0 0.0 0.0 0.0 0.0 100-104 0.0 0.0 0.0 0.0 0.0 105-109 0.0 0.0 0.0 0.0 0.0 110-114 0.0 0.0 0.0 0.0 0.0 115-119 0.0 0.0 0.0 0.0 0.0 120-124 0.0 0.0 0.0 0.0 0.0 125-129 0.0 0.0 0.0 0.0 0.0 130-134 0.0 0.0 0.0 0.0 0.0 135-139 0.0 0.0 0.0 0.0 0.0 140-144 0.0 0.0 0.0 0.0 0.0 145-149 0.0 0.0 0.0 0.0 0.0 150-154 0.0 0.0 0.0 0.0 0.0 155-159 0.0 0.0 0.0 0.0 0.0 160-164 0.0 0.0 0.0 0.0 0.0 165-169 0.0 0.0 0.0 0.0 0.0 170-174 0.0 0.0 0.0 0.0 0.0 175-179 0.0 0.0 0.0 0.0 0.0 180-184 0.0 0.0 0.0 0.0 0.0 185-189 0.0 0.0 0.0 0.0 0.0 190-194 0.0 0.0 0.0 0.0 0.0 195-199 0.0 0.0 0.0 0.0 0.0 200-201 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTCCG 5 0.001108357 2219.6667 165-167 CCTCCGC 5 0.001108357 2219.6667 165-167 TCACGCC 5 0.001108357 2219.6667 160-164 GGCCTCC 5 0.001108357 2219.6667 165-167 AGCCTGC 5 0.005540121 1109.8334 135-139 CTGCCTG 10 0.008864193 832.375 150-154 TACAAGT 15 0.009973216 739.88885 160-164 >>END_MODULE Read 310603 spots for ERR1806573.sra Written 310603 spots for ERR1806573.sra Read 310603 spots for ERR1806573.sra Written 310603 spots for ERR1806573.sra Read 310603 spots for ERR1806573.sra Written 310603 spots for ERR1806573.sra Read 310603 spots for ERR1806573.sra Written 310603 spots for ERR1806573.sra Read 310603 spots for ERR1806573.sra Written 310603 spots for ERR1806573.sra Read 310603 spots for ERR1806573.sra Written 310603 spots for ERR1806573.sra Read 310603 spots for ERR1806573.sra Written 310603 spots for ERR1806573.sra Read 310603 spots for ERR1806573.sra Written 310603 spots for ERR1806573.sra Read 310603 spots for ERR1806573.sra Written 310603 spots for ERR1806573.sra Read 310603 spots for ERR1806573.sra Written 310603 spots for ERR1806573.sra Read 310614 spots for ERR1806573.sra Written 310614 spots for ERR1806573.sra Read 310603 spots for ERR1806573.sra Written 310603 spots for ERR1806573.sra Read 310603 spots for ERR1806573.sra Written 310603 spots for ERR1806573.sra Read 310603 spots for ERR1806573.sra Written 310603 spots for ERR1806573.sra Read 310603 spots for ERR1806573.sra Written 310603 spots for ERR1806573.sra Read 310603 spots for ERR1806573.sra Written 310603 spots for ERR1806573.sra Read 310603 spots for ERR1806573.sra Written 310603 spots for ERR1806573.sra Read 310603 spots for ERR1806573.sra Written 310603 spots for ERR1806573.sra Read 310603 spots for ERR1806573.sra Written 310603 spots for ERR1806573.sra Read 310603 spots for ERR1806573.sra Written 310603 spots for ERR1806573.sra SRR ids: ['ERR1806573.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_105hru7v ERR1806573.sra spots: 6212071 blocks: [[1, 310603], [310604, 621206], [621207, 931809], [931810, 1242412], [1242413, 1553015], [1553016, 1863618], [1863619, 2174221], [2174222, 2484824], [2484825, 2795427], [2795428, 3106030], [3106031, 3416633], [3416634, 3727236], [3727237, 4037839], [4037840, 4348442], [4348443, 4659045], [4659046, 4969648], [4969649, 5280251], [5280252, 5590854], [5590855, 5901457], [5901458, 6212071]] ERR1806573 file size 1313916 ERR1806573 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1806573 ERR1806573_1.fastq Input file: ERR1806573_1.fastq trimmed: ERR1806573-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 16:57:03 2024 >> started Mon Dec 9 16:57:06 2024 >> done (3.360s) 6212071 reads processed; of these: 154722 ( 2.49%) short reads filtered out after trimming by size control 6 ( 0.00%) empty reads filtered out after trimming by size control 6057343 (97.51%) reads available; of these: 96817 ( 1.60%) trimmed reads available after processing 5960526 (98.40%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 19552 0.32% 19 19847 0.33% 20 20046 0.33% 21 21171 0.35% 22 21127 0.35% 23 20858 0.34% 24 23323 0.39% 25 22327 0.37% 26 23441 0.39% 27 24372 0.40% 28 25369 0.42% 29 24831 0.41% 30 26952 0.44% 31 26717 0.44% 32 27031 0.45% 33 29622 0.49% 34 30180 0.50% 35 28791 0.48% 36 30934 0.51% 37 30058 0.50% 38 30645 0.51% 39 33724 0.56% 40 33019 0.55% 41 33547 0.55% 42 36822 0.61% 43 35728 0.59% 44 36575 0.60% 45 39153 0.65% 46 38860 0.64% 47 38830 0.64% 48 41216 0.68% 49 40980 0.68% 50 41557 0.69% 51 43684 0.72% 52 44020 0.73% 53 43928 0.73% 54 46628 0.77% 55 46703 0.77% 56 47622 0.79% 57 49180 0.81% 58 48696 0.80% 59 50000 0.83% 60 54404 0.90% 61 52722 0.87% 62 51300 0.85% 63 54972 0.91% 64 53416 0.88% 65 53202 0.88% 66 55249 0.91% 67 55433 0.92% 68 57100 0.94% 69 58692 0.97% 70 57118 0.94% 71 56772 0.94% 72 59940 0.99% 73 58128 0.96% 74 60095 0.99% 75 60088 0.99% 76 61701 1.02% 77 66171 1.09% 78 69831 1.15% 79 62276 1.03% 80 61072 1.01% 81 61517 1.02% 82 65986 1.09% 83 63154 1.04% 84 62903 1.04% 85 62199 1.03% 86 61025 1.01% 87 61997 1.02% 88 61502 1.02% 89 60817 1.00% 90 64879 1.07% 91 61928 1.02% 92 60918 1.01% 93 65242 1.08% 94 60958 1.01% 95 59110 0.98% 96 59487 0.98% 97 58377 0.96% 98 58058 0.96% 99 58091 0.96% 100 58215 0.96% 101 57277 0.95% 102 57589 0.95% 103 58130 0.96% 104 55025 0.91% 105 54339 0.90% 106 52560 0.87% 107 53034 0.88% 108 52597 0.87% 109 53592 0.88% 110 50051 0.83% 111 49488 0.82% 112 49490 0.82% 113 47174 0.78% 114 46835 0.77% 115 46714 0.77% 116 45143 0.75% 117 44464 0.73% 118 43438 0.72% 119 41729 0.69% 120 42101 0.70% 121 40078 0.66% 122 39422 0.65% 123 38692 0.64% 124 37306 0.62% 125 36671 0.61% 126 35906 0.59% 127 34863 0.58% 128 33889 0.56% 129 33496 0.55% 130 32679 0.54% 131 31340 0.52% 132 31223 0.52% 133 30347 0.50% 134 29268 0.48% 135 28192 0.47% 136 26737 0.44% 137 25927 0.43% 138 26325 0.43% 139 24945 0.41% 140 23763 0.39% 141 23512 0.39% 142 22110 0.37% 143 21358 0.35% 144 20696 0.34% 145 20814 0.34% 146 19692 0.33% 147 20108 0.33% 148 18438 0.30% 149 17667 0.29% 150 17306 0.29% 151 16606 0.27% 152 15919 0.26% 153 15092 0.25% 154 14938 0.25% 155 14499 0.24% 156 14376 0.24% 157 13358 0.22% 158 12512 0.21% 159 12115 0.20% 160 11703 0.19% 161 11244 0.19% 162 10903 0.18% 163 10520 0.17% 164 10167 0.17% 165 9550 0.16% 166 8924 0.15% 167 9000 0.15% 168 8360 0.14% 169 8139 0.13% 170 7760 0.13% 171 7348 0.12% 172 7115 0.12% 173 6640 0.11% 174 6566 0.11% 175 6002 0.10% 176 5763 0.10% 177 5657 0.09% 178 5356 0.09% 179 5023 0.08% 180 4999 0.08% 181 4569 0.08% 182 4252 0.07% 183 4105 0.07% 184 3927 0.06% 185 3606 0.06% 186 3473 0.06% 187 3320 0.05% 188 3102 0.05% 189 2927 0.05% 190 2760 0.05% 191 2622 0.04% 192 2497 0.04% 193 2344 0.04% 194 2130 0.04% 195 2116 0.03% 196 1962 0.03% 197 1785 0.03% 198 1709 0.03% 199 1593 0.03% 200 1469 0.02% 201 1292 0.02% 202 1332 0.02% 203 1249 0.02% 204 1129 0.02% 205 983 0.02% 206 1007 0.02% 207 898 0.01% 208 863 0.01% 209 760 0.01% 210 766 0.01% 211 709 0.01% 212 596 0.01% 213 552 0.01% 214 566 0.01% 215 446 0.01% 216 422 0.01% 217 401 0.01% 218 359 0.01% 219 315 0.01% 220 308 0.01% 221 267 0.00% 222 237 0.00% 223 221 0.00% 224 213 0.00% 225 181 0.00% 226 156 0.00% 227 148 0.00% 228 138 0.00% 229 127 0.00% 230 116 0.00% 231 99 0.00% 232 86 0.00% 233 77 0.00% 234 86 0.00% 235 64 0.00% 236 57 0.00% 237 46 0.00% 238 39 0.00% 239 55 0.00% 240 34 0.00% 241 36 0.00% 242 24 0.00% 243 25 0.00% 244 25 0.00% 245 19 0.00% 246 21 0.00% 247 21 0.00% 248 13 0.00% 249 11 0.00% 250 12 0.00% 251 4 0.00% 252 5 0.00% 253 2 0.00% 254 3 0.00% 255 7 0.00% 256 7 0.00% 257 4 0.00% 258 6 0.00% 259 5 0.00% 260 4 0.00% 261 2 0.00% 262 1 0.00% 263 3 0.00% 264 2 0.00% 265 1 0.00% 266 0 0.00% 267 1 0.00% 268 0 0.00% 269 0 0.00% 270 1 0.00% 271 0 0.00% 272 0 0.00% 273 1 0.00% 274 1 0.00% 275 0 0.00% 276 1 0.00% 277 0 0.00% 278 1 0.00% 279 0 0.00% 280 0 0.00% 281 0 0.00% 282 0 0.00% 283 0 0.00% 284 0 0.00% 285 1 0.00% 6057343 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=4.18 fanout-score-rank=24 prefix-density=0.28 prefix-fanout=3.2 sequence=AAGATCCAGGACAAGGAGGGCAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=101.22 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=9.8 sequence=AGAAGATTGTGATCAAGACCTGTGGGACTACCATGCTCCTGCTCACCATTCCAAGGATTCTTGAGCTTGCTGAAGAGCTGTGCATGCCGCTTGCTGCTGTGAAGTACTCTCGAGGGATGTTCATCTTCCCTGGCGCACAGCCAGCTCCCCACAGGAGCTTCTCTGAGGAGGTTGATGTCCTTAACCGCTACTTTGGTGGCCTGAAATCTGGTGGCAATGCTTATGTGATTGGAGATCCAGCCAAGCCAGGCCAGAAGTGGCACATCTATTATGCCACTGAGCAACCTGAGAAACCTATGGTCACACTGGAGATGTGCATGACTGGGCTGGACAAGAAGAAAGCCTCTGTCTTCTTCAAGACTTCTGCTGATGGACACATCTCATGTGCTAAGGAGATGACAAAGGTCTCTGGTATCTCTGAAATCATCCCGGAGATGGAGGTCTGTGACTTCGACTTTGAGCCCTGCGGCTACTCCATGAACGCCATCCATGGATCTGCGTTCTCTACAAT Started job on | Dec 09 16:57:26 Started mapping on | Dec 09 16:57:26 Finished on | Dec 09 16:57:38 Mapping speed, Million of reads per hour | 1817.20 Number of input reads | 6057343 Average input read length | 89 UNIQUE READS: Uniquely mapped reads number | 4945267 Uniquely mapped reads % | 81.64% Average mapped length | 83.07 Number of splices: Total | 1411424 Number of splices: Annotated (sjdb) | 1331545 Number of splices: GT/AG | 1380962 Number of splices: GC/AG | 16357 Number of splices: AT/AC | 1174 Number of splices: Non-canonical | 12931 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.15% Deletion average length | 1.09 Insertion rate per base | 0.17% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 170434 % of reads mapped to multiple loci | 2.81% Number of reads mapped to too many loci | 55832 % of reads mapped to too many loci | 0.92% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 14.42% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 941642 941642 941642 N_multimapping 170434 170434 170434 N_noFeature 142544 183337 4844863 N_ambiguous 69085 9883 522 UnstrandedReadsAssigned:4733638 PositiveStrandReadsAssigned:4752047 NegativeStrandReadsAssigned:99882 Dataset is classified positive stranded MeadianReadLen=87 20thPercentileLength=55 echo kmer=51 ERR1806573 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR1806573-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,057,343 reads, 4,829,875 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,012 rounds 52973 ERR1806573.ke.tsv 35125 ERR1806573.se.tsv 88098 total ==> ERR1806573.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 88.2385 34.5359 PNS24247 1044 945 11.6667 4.04439 PNS24249 1928 1829 63.818 11.4306 PNS24246 1044 945 11.6667 4.04439 PNS24248 1044 945 11.6667 4.04439 PNS24244 1471 1372 18.9435 4.52317 PNS24243 293 194 0 0 KQK14069 1603 1504 827.744 180.296 KQK14071 474 375 51.1822 44.7121 ==> ERR1806573.se.tsv <== BRADI_1g14170v3 900 BRADI_1g53295v3 31 BRADI_1g59795v3 73 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 582 BRADI_1g74790v3 80 BRADI_1g09890v3 0 BRADI_1g77505v3 95 BRADI_1g48960v3 0 ERR1806573 completed mapping pipeline successfully