Starting /dee2/code/volunteer_pipeline.sh ERR1806574 current disk space = 1523739205632 free memory = 1605376796 ERR1806574 SRAfilesize 0cfeb4ac5ca72c805f89cc04a3098028 ERR1806574.sra ERR1806574.sra file validated ERR1806574 is single end ERR1806574 is conventional basespace ERR1806574 read1 length is 8-239 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1806574_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 8-239 %GC 50 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.425 26.0 22.0 27.0 19.0 28.0 2 24.28525 26.0 22.0 27.0 18.0 29.0 3 23.91875 25.0 21.0 27.0 17.0 29.0 4 24.2495 26.0 21.0 27.0 18.0 29.0 5 24.02225 26.0 21.0 27.0 17.0 29.0 6 24.01475 26.0 21.0 27.0 17.0 29.0 7 23.809 25.0 21.0 27.0 17.0 28.0 8 23.91225 25.0 21.0 27.0 17.0 28.0 9 23.817726589884828 25.0 21.0 27.0 17.0 28.0 10-14 23.771284615094963 25.0 21.0 27.0 17.4 28.0 15-19 23.914479476947328 25.2 21.0 27.0 18.0 28.0 20-24 23.98122330593916 25.4 21.0 27.0 18.0 28.0 25-29 23.929097115295974 25.2 21.0 27.0 18.0 28.0 30-34 23.980826939937167 25.0 21.0 27.0 18.0 28.0 35-39 23.923945906553648 25.0 21.0 27.0 18.0 28.0 40-44 23.877473819746392 25.0 21.0 27.0 18.0 28.0 45-49 23.891948638881708 25.0 21.0 27.0 18.0 28.0 50-54 23.91669707744138 25.0 21.0 27.0 18.0 28.0 55-59 23.81765173858543 25.0 21.0 27.0 18.0 28.0 60-64 23.96997048533645 25.0 21.2 27.0 18.0 28.0 65-69 23.870593728464666 25.0 21.0 27.0 18.0 28.0 70-74 23.856777587863803 25.0 21.0 27.0 18.0 28.0 75-79 23.809794997158697 25.0 21.0 27.0 18.0 28.0 80-84 23.803979316586616 25.0 21.0 27.0 17.8 28.0 85-89 23.692113217392155 25.0 21.0 27.0 18.0 27.8 90-94 23.579856667285004 25.0 21.0 26.6 17.8 27.6 95-99 23.549680982049885 25.0 21.0 26.4 17.8 27.6 100-104 23.490042229417877 25.0 21.0 26.4 17.6 27.6 105-109 23.334784963208893 25.0 21.0 26.0 17.0 27.0 110-114 23.34128757083041 25.0 20.8 26.0 17.0 27.0 115-119 23.351294296047534 25.0 20.6 26.0 17.4 27.0 120-124 23.247520293551208 25.0 20.4 26.0 16.8 27.0 125-129 23.17046677909936 24.4 20.8 26.0 16.8 27.0 130-134 22.97110845795826 24.2 20.4 26.0 16.4 27.0 135-139 22.833037767118448 24.0 20.0 26.0 16.6 27.0 140-144 22.59589062559107 23.8 20.0 26.0 15.8 27.0 145-149 22.6681198216507 24.0 19.8 26.0 15.6 27.0 150-154 22.285923095893235 23.4 19.8 26.0 15.2 27.0 155-159 21.875473234294105 22.8 19.2 25.6 14.2 26.8 160-164 21.706307424459602 22.2 19.2 25.2 14.6 26.8 165-169 21.56991989530354 22.2 19.2 25.0 13.8 26.0 170-174 21.640375787967375 22.0 19.5 25.0 16.5 26.5 175-179 21.053007293275346 NaN NaN NaN NaN NaN 180-184 20.532157571685563 NaN NaN NaN NaN NaN 185-189 19.717169217863407 NaN NaN NaN NaN NaN 190-194 19.867342866265282 NaN NaN NaN NaN NaN 195-199 22.22234935163997 NaN NaN NaN NaN NaN 200-204 21.74107142857143 NaN NaN NaN NaN NaN 205-209 19.84871794871795 NaN NaN NaN NaN NaN 210-214 19.3002886002886 NaN NaN NaN NaN NaN 215-219 19.983333333333334 NaN NaN NaN NaN NaN 220-224 22.1 NaN NaN NaN NaN NaN 225-229 22.6 NaN NaN NaN NaN NaN 230-234 20.6 NaN NaN NaN NaN NaN 235-239 23.0 NaN NaN NaN NaN NaN >>END_MODULE >>Per sequence quality scores warn #Quality Count 10 1.0 11 2.0 12 2.0 13 14.0 14 16.0 15 19.0 16 49.0 17 75.0 18 114.0 19 135.0 20 150.0 21 193.0 22 278.0 23 478.0 24 971.0 25 1231.0 26 265.0 27 7.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 21.65 44.775 19.7 13.875000000000002 2 42.175000000000004 35.6 5.825 16.400000000000002 3 30.349999999999998 32.15 20.3 17.2 4 35.25 28.4 17.675 18.675 5 29.849999999999998 26.85 18.0 25.3 6 28.025 29.75 19.900000000000002 22.325 7 23.1 30.3 23.75 22.85 8 25.224999999999998 25.775 23.599999999999998 25.4 9 25.58838257386079 24.636955433149723 23.935903855783675 25.838758137205808 10-14 26.8257083899542 25.27052191856661 23.91162111832503 23.99214857315416 15-19 27.381860725367517 26.14578564525154 22.997100564626887 23.475253064754057 20-24 27.127768662838392 25.25635767022149 23.005537325676784 24.61033634126333 25-29 27.321668909825032 25.01294129827104 23.18562998239983 24.47975980950409 30-34 27.0582038451409 24.882802212272846 23.65025019752436 24.40874374506189 35-39 27.01599914098572 25.260388703962207 23.290024696660584 24.433587458391496 40-44 26.246632580130846 25.97723899059871 23.288800923635165 24.487327505635275 45-49 26.608387612844247 25.24282939092675 23.671580390812476 24.477202605416522 50-54 26.788825473115054 24.92039651547011 24.091318714328626 24.19945929708621 55-59 25.780701194201416 25.17402132958682 24.548183153458076 24.49709432275369 60-64 26.538171342341727 25.166335139584334 23.945400919130254 24.350092598943686 65-69 26.747492890285884 24.607094746295466 24.44244873521928 24.202963628199374 70-74 25.86774140483632 24.740911334101003 24.568185556835008 24.82316170422767 75-79 26.627164995442115 25.806745670009118 23.691886964448496 23.87420237010027 80-84 26.35272579332791 24.898291293734744 24.90846216436127 23.840520748576076 85-89 26.158940397350992 25.3939255537794 24.229276090431608 24.217857958438 90-94 25.95133316075589 25.45948744499094 25.472430753300547 23.11674864095263 95-99 25.444839857651246 26.082443653618032 24.392052194543297 24.080664294187425 100-104 25.157661496505877 26.12919720470428 24.799727288222257 23.913414010567582 105-109 25.457047375663457 25.103204246117556 25.319441714173387 24.120306664045607 110-114 26.123659593885467 26.192105863563768 23.70522473191878 23.979009810631986 115-119 25.954606141522028 26.275033377837115 25.233644859813083 22.53671562082777 120-124 26.13065326633166 25.282663316582916 24.309045226130653 24.27763819095477 125-129 25.091174325309996 26.258205689277897 24.47118891320204 24.17943107221007 130-134 26.94278394534586 25.61912894961571 25.27754056362084 22.16054654141759 135-139 26.223596084492527 24.008243173621842 25.090159711488923 24.678001030396704 140-144 25.402726146220573 25.960346964064435 24.03965303593556 24.59727385377943 145-149 26.269315673289185 27.225901398086826 22.958057395143488 23.5467255334805 150-154 26.33889376646181 25.7243195785777 23.52941176470588 24.40737489025461 155-159 25.13484358144552 26.860841423948216 22.54584681769148 25.458468176914778 160-164 25.979112271540473 29.634464751958223 21.801566579634464 22.58485639686684 165-169 23.404255319148938 26.841243862520457 24.386252045826513 25.368248772504092 170-174 24.746450304259636 24.94929006085193 24.137931034482758 26.16632860040568 175-179 24.62686567164179 31.094527363184078 21.890547263681594 22.388059701492537 180-184 25.165562913907287 22.185430463576157 29.47019867549669 23.178807947019866 185-189 23.557692307692307 25.48076923076923 21.153846153846153 29.807692307692307 190-194 29.45205479452055 30.82191780821918 18.493150684931507 21.232876712328768 195-199 29.629629629629626 22.22222222222222 30.555555555555557 17.59259259259259 200-204 27.027027027027028 31.08108108108108 21.62162162162162 20.27027027027027 205-209 26.666666666666668 18.333333333333332 36.666666666666664 18.333333333333332 210-214 30.952380952380953 26.190476190476193 23.809523809523807 19.047619047619047 215-219 16.666666666666664 16.666666666666664 50.0 16.666666666666664 220-224 18.181818181818183 18.181818181818183 18.181818181818183 45.45454545454545 225-229 10.0 40.0 40.0 10.0 230-234 44.44444444444444 11.11111111111111 22.22222222222222 22.22222222222222 235-239 40.0 0.0 20.0 40.0 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 2.0 18 1.5 19 1.5 20 3.0 21 4.0 22 5.0 23 6.0 24 5.0 25 6.0 26 8.0 27 8.5 28 9.0 29 13.5 30 25.0 31 33.0 32 37.0 33 39.5 34 43.5 35 56.0 36 65.5 37 87.5 38 105.33333333333334 39 119.33333333333334 40 152.5 41 185.0 42 205.5 43 211.33333333333334 44 228.33333333333334 45 234.66666666666669 46 228.33333333333334 47 241.33333333333331 48 244.83333333333331 49 233.83333333333334 50 220.0 51 216.33333333333331 52 218.0 53 213.16666666666666 54 207.16666666666666 55 198.83333333333331 56 185.5 57 171.16666666666669 58 164.5 59 149.83333333333334 60 136.0 61 136.0 62 136.5 63 138.0 64 125.5 65 108.5 66 105.5 67 101.0 68 83.5 69 74.5 70 69.0 71 56.0 72 47.0 73 37.0 74 27.5 75 20.0 76 17.5 77 13.5 78 10.5 79 9.5 80 6.5 81 4.5 82 3.5 83 2.5 84 2.0 85 2.0 86 2.0 87 2.0 88 2.0 89 2.0 90 2.0 91 2.0 92 2.0 93 2.0 94 1.5 95 0.5 96 0.5 97 1.0 98 1.0 99 1.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-159 0.0 160-164 0.0 165-169 0.0 170-174 0.0 175-179 0.0 180-184 0.0 185-189 0.0 190-194 0.0 195-199 0.0 200-204 0.0 205-209 0.0 210-214 0.0 215-219 0.0 220-224 0.0 225-229 0.0 230-234 0.0 235-239 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 5-9 10.0 10-14 39.0 15-19 40.0 20-24 28.0 25-29 59.0 30-34 68.0 35-39 83.0 40-44 112.0 45-49 158.0 50-54 193.0 55-59 213.0 60-64 229.0 65-69 239.0 70-74 244.0 75-79 236.0 80-84 205.0 85-89 213.0 90-94 214.0 95-99 182.0 100-104 156.0 105-109 149.0 110-114 135.0 115-119 120.0 120-124 95.0 125-129 75.0 130-134 90.0 135-139 71.0 140-144 59.0 145-149 35.0 150-154 48.0 155-159 37.0 160-164 30.0 165-169 28.0 170-174 18.0 175-179 19.0 180-184 21.0 185-189 17.0 190-194 6.0 195-199 10.0 200-204 3.0 205-209 2.0 210-214 6.0 215-219 2.0 220-224 1.0 225-229 0.0 230-234 1.0 235-239 1.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21677614957048 98.175 2 0.6063668519454269 1.2 3 0.07579585649317837 0.22499999999999998 4 0.1010611419909045 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.0 0.0 0.0 0.0 0.0 80-84 0.0 0.0 0.0 0.0 0.0 85-89 0.0 0.0 0.0 0.0 0.0 90-94 0.0 0.0 0.0 0.0 0.0 95-99 0.0 0.0 0.0 0.0 0.0 100-104 0.0 0.0 0.0 0.0 0.0 105-109 0.0 0.0 0.0 0.0 0.0 110-114 0.0 0.0 0.0 0.0 0.0 115-119 0.0 0.0 0.0 0.0 0.0 120-124 0.0 0.0 0.0 0.0 0.0 125-129 0.0 0.0 0.0 0.0 0.0 130-134 0.0 0.0 0.0 0.0 0.0 135-139 0.0 0.0 0.0 0.0 0.0 140-144 0.0 0.0 0.0 0.0 0.0 145-149 0.0 0.0 0.0 0.0 0.0 150-154 0.0 0.0 0.0 0.0 0.0 155-159 0.0 0.0 0.0 0.0 0.0 160-164 0.0 0.0 0.0 0.0 0.0 165-169 0.0 0.0 0.0 0.0 0.0 170-174 0.0 0.0 0.0 0.0 0.0 175-179 0.0 0.0 0.0 0.0 0.0 180-184 0.0 0.0 0.0 0.0 0.0 185-189 0.0 0.0 0.0 0.0 0.0 190-194 0.0 0.0 0.0 0.0 0.0 195-199 0.0 0.0 0.0 0.0 0.0 200-204 0.0 0.0 0.0 0.0 0.0 205-209 0.0 0.0 0.0 0.0 0.0 210-214 0.0 0.0 0.0 0.0 0.0 215-219 0.0 0.0 0.0 0.0 0.0 220-224 0.0 0.0 0.0 0.0 0.0 225-227 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAAGTA 10 0.0 3541.0 190 ATTCTTC 10 0.0013066765 1770.5 175-179 AATAATT 10 0.0013066765 1770.5 175-179 GCTCCAG 10 0.003919292 1180.3333 165-169 TCTTCGG 15 0.0029400224 1180.3333 180-184 AAGTTGG 5 0.0048981924 1180.3333 155-159 ACCTGTT 10 0.007837107 885.25 185-189 TTCTTCT 10 0.007837107 885.25 175-179 CTTCGGG 10 0.007837107 885.25 180-184 GACCAGC 10 0.007837107 885.25 160-164 CGCAACA 10 0.007837107 885.25 160-164 >>END_MODULE Read 349289 spots for ERR1806574.sra Written 349289 spots for ERR1806574.sra Read 349289 spots for ERR1806574.sra Written 349289 spots for ERR1806574.sra Read 349289 spots for ERR1806574.sra Written 349289 spots for ERR1806574.sra Read 349289 spots for ERR1806574.sra Written 349289 spots for ERR1806574.sra Read 349289 spots for ERR1806574.sra Written 349289 spots for ERR1806574.sra Read 349289 spots for ERR1806574.sra Written 349289 spots for ERR1806574.sra Read 349289 spots for ERR1806574.sra Written 349289 spots for ERR1806574.sra Read 349289 spots for ERR1806574.sra Written 349289 spots for ERR1806574.sra Read 349289 spots for ERR1806574.sra Written 349289 spots for ERR1806574.sra Read 349289 spots for ERR1806574.sra Written 349289 spots for ERR1806574.sra Read 349289 spots for ERR1806574.sra Written 349289 spots for ERR1806574.sra Read 349289 spots for ERR1806574.sra Written 349289 spots for ERR1806574.sra Read 349289 spots for ERR1806574.sra Written 349289 spots for ERR1806574.sra Read 349289 spots for ERR1806574.sra Written 349289 spots for ERR1806574.sra Read 349289 spots for ERR1806574.sra Written 349289 spots for ERR1806574.sra Read 349289 spots for ERR1806574.sra Written 349289 spots for ERR1806574.sra Read 349289 spots for ERR1806574.sra Written 349289 spots for ERR1806574.sra Read 349289 spots for ERR1806574.sra Written 349289 spots for ERR1806574.sra Read 349289 spots for ERR1806574.sra Written 349289 spots for ERR1806574.sra Read 349294 spots for ERR1806574.sra Written 349294 spots for ERR1806574.sra SRR ids: ['ERR1806574.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rcfspg2h ERR1806574.sra spots: 6985785 blocks: [[1, 349289], [349290, 698578], [698579, 1047867], [1047868, 1397156], [1397157, 1746445], [1746446, 2095734], [2095735, 2445023], [2445024, 2794312], [2794313, 3143601], [3143602, 3492890], [3492891, 3842179], [3842180, 4191468], [4191469, 4540757], [4540758, 4890046], [4890047, 5239335], [5239336, 5588624], [5588625, 5937913], [5937914, 6287202], [6287203, 6636491], [6636492, 6985785]] ERR1806574 file size 1437305 ERR1806574 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1806574 ERR1806574_1.fastq Input file: ERR1806574_1.fastq trimmed: ERR1806574-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 17:02:45 2024 >> started Mon Dec 9 17:02:48 2024 >> done (3.436s) 6985785 reads processed; of these: 171687 ( 2.46%) short reads filtered out after trimming by size control 36 ( 0.00%) empty reads filtered out after trimming by size control 6814062 (97.54%) reads available; of these: 89964 ( 1.32%) trimmed reads available after processing 6724098 (98.68%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 14311 0.21% 19 13915 0.20% 20 13524 0.20% 21 13973 0.21% 22 13824 0.20% 23 14238 0.21% 24 16296 0.24% 25 14970 0.22% 26 16022 0.24% 27 17468 0.26% 28 18351 0.27% 29 18494 0.27% 30 21192 0.31% 31 21359 0.31% 32 22250 0.33% 33 25021 0.37% 34 25907 0.38% 35 26777 0.39% 36 29454 0.43% 37 29430 0.43% 38 31666 0.46% 39 36193 0.53% 40 35158 0.52% 41 38536 0.57% 42 45681 0.67% 43 42978 0.63% 44 44910 0.66% 45 51100 0.75% 46 51275 0.75% 47 51956 0.76% 48 59577 0.87% 49 57104 0.84% 50 59014 0.87% 51 64927 0.95% 52 64634 0.95% 53 66203 0.97% 54 71528 1.05% 55 70324 1.03% 56 72389 1.06% 57 75471 1.11% 58 74674 1.10% 59 79092 1.16% 60 88240 1.29% 61 82966 1.22% 62 80099 1.18% 63 84639 1.24% 64 83126 1.22% 65 83020 1.22% 66 84223 1.24% 67 83462 1.22% 68 84191 1.24% 69 85461 1.25% 70 84904 1.25% 71 82884 1.22% 72 86543 1.27% 73 82522 1.21% 74 82802 1.22% 75 82869 1.22% 76 82775 1.21% 77 86223 1.27% 78 87580 1.29% 79 79025 1.16% 80 78120 1.15% 81 76933 1.13% 82 82248 1.21% 83 78060 1.15% 84 76604 1.12% 85 81270 1.19% 86 72890 1.07% 87 73085 1.07% 88 70878 1.04% 89 67769 0.99% 90 69618 1.02% 91 67860 1.00% 92 66638 0.98% 93 69878 1.03% 94 63678 0.93% 95 61755 0.91% 96 62495 0.92% 97 59744 0.88% 98 59934 0.88% 99 58704 0.86% 100 60323 0.89% 101 57413 0.84% 102 57007 0.84% 103 54800 0.80% 104 52417 0.77% 105 52121 0.76% 106 49847 0.73% 107 49872 0.73% 108 49704 0.73% 109 48285 0.71% 110 46693 0.69% 111 45509 0.67% 112 44659 0.66% 113 42247 0.62% 114 41727 0.61% 115 41010 0.60% 116 39638 0.58% 117 40160 0.59% 118 37827 0.56% 119 36547 0.54% 120 36982 0.54% 121 34860 0.51% 122 34550 0.51% 123 34770 0.51% 124 32133 0.47% 125 31560 0.46% 126 32246 0.47% 127 30020 0.44% 128 29055 0.43% 129 29063 0.43% 130 27522 0.40% 131 26808 0.39% 132 26962 0.40% 133 25902 0.38% 134 25228 0.37% 135 24279 0.36% 136 22964 0.34% 137 22161 0.33% 138 22911 0.34% 139 21516 0.32% 140 20642 0.30% 141 20559 0.30% 142 18959 0.28% 143 18591 0.27% 144 18288 0.27% 145 17647 0.26% 146 17416 0.26% 147 19026 0.28% 148 16894 0.25% 149 15439 0.23% 150 15289 0.22% 151 14412 0.21% 152 13807 0.20% 153 13894 0.20% 154 13077 0.19% 155 12670 0.19% 156 12672 0.19% 157 12084 0.18% 158 11578 0.17% 159 11129 0.16% 160 11002 0.16% 161 10326 0.15% 162 10236 0.15% 163 10237 0.15% 164 9633 0.14% 165 9221 0.14% 166 8640 0.13% 167 8677 0.13% 168 8545 0.13% 169 8091 0.12% 170 7855 0.12% 171 7480 0.11% 172 7149 0.10% 173 6607 0.10% 174 6337 0.09% 175 6153 0.09% 176 6186 0.09% 177 5817 0.09% 178 5576 0.08% 179 5370 0.08% 180 5359 0.08% 181 5334 0.08% 182 4951 0.07% 183 4511 0.07% 184 4495 0.07% 185 4336 0.06% 186 4151 0.06% 187 3984 0.06% 188 3899 0.06% 189 3733 0.05% 190 3428 0.05% 191 3384 0.05% 192 3250 0.05% 193 3070 0.05% 194 2973 0.04% 195 2870 0.04% 196 2720 0.04% 197 2603 0.04% 198 2515 0.04% 199 2320 0.03% 200 2178 0.03% 201 2132 0.03% 202 2094 0.03% 203 1979 0.03% 204 1905 0.03% 205 1812 0.03% 206 1817 0.03% 207 1625 0.02% 208 1677 0.02% 209 1462 0.02% 210 1377 0.02% 211 1267 0.02% 212 1256 0.02% 213 1165 0.02% 214 1154 0.02% 215 1184 0.02% 216 1058 0.02% 217 1008 0.01% 218 912 0.01% 219 841 0.01% 220 783 0.01% 221 759 0.01% 222 704 0.01% 223 676 0.01% 224 575 0.01% 225 577 0.01% 226 561 0.01% 227 499 0.01% 228 482 0.01% 229 443 0.01% 230 414 0.01% 231 362 0.01% 232 324 0.00% 233 334 0.00% 234 289 0.00% 235 292 0.00% 236 271 0.00% 237 260 0.00% 238 234 0.00% 239 182 0.00% 240 177 0.00% 241 173 0.00% 242 178 0.00% 243 140 0.00% 244 117 0.00% 245 117 0.00% 246 112 0.00% 247 74 0.00% 248 77 0.00% 249 73 0.00% 250 62 0.00% 251 63 0.00% 252 53 0.00% 253 62 0.00% 254 43 0.00% 255 37 0.00% 256 35 0.00% 257 37 0.00% 258 31 0.00% 259 19 0.00% 260 21 0.00% 261 14 0.00% 262 16 0.00% 263 17 0.00% 264 17 0.00% 265 8 0.00% 266 17 0.00% 267 14 0.00% 268 5 0.00% 269 7 0.00% 270 6 0.00% 271 5 0.00% 272 6 0.00% 273 7 0.00% 274 3 0.00% 275 5 0.00% 276 4 0.00% 277 1 0.00% 278 1 0.00% 279 0 0.00% 280 1 0.00% 281 1 0.00% 282 0 0.00% 283 1 0.00% 284 0 0.00% 285 0 0.00% 286 3 0.00% 287 0 0.00% 288 0 0.00% 289 0 0.00% 290 1 0.00% 291 0 0.00% 292 0 0.00% 293 0 0.00% 294 0 0.00% 295 0 0.00% 296 0 0.00% 297 0 0.00% 298 0 0.00% 299 0 0.00% 300 0 0.00% 301 0 0.00% 302 0 0.00% 303 0 0.00% 304 0 0.00% 305 0 0.00% 306 0 0.00% 307 0 0.00% 308 0 0.00% 309 0 0.00% 310 0 0.00% 311 0 0.00% 312 0 0.00% 313 0 0.00% 314 0 0.00% 315 0 0.00% 316 0 0.00% 317 0 0.00% 318 0 0.00% 319 0 0.00% 320 0 0.00% 321 0 0.00% 322 0 0.00% 323 0 0.00% 324 0 0.00% 325 0 0.00% 326 0 0.00% 327 0 0.00% 328 0 0.00% 329 0 0.00% 330 0 0.00% 331 0 0.00% 332 0 0.00% 333 0 0.00% 334 0 0.00% 335 0 0.00% 336 1 0.00% 6814062 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=32 prefix-density=0.36 prefix-fanout=2.0 sequence=CGAGCGCAGCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=326.54 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=17.0 sequence=GCAGCAGCAGAGAGCCGGAGCGCCACCAGCCATCCGATCAAAACACACAGATCAATCCGATGGCTCTCGCTCTCTCCGGTTCCTCGGCTGCTGCCCGCGCGCTGGCCCAGCTGCTGGCCCCGTCCACCA Started job on | Dec 09 17:03:40 Started mapping on | Dec 09 17:03:40 Finished on | Dec 09 17:03:51 Mapping speed, Million of reads per hour | 2230.06 Number of input reads | 6814062 Average input read length | 86 UNIQUE READS: Uniquely mapped reads number | 6137048 Uniquely mapped reads % | 90.06% Average mapped length | 85.28 Number of splices: Total | 1548508 Number of splices: Annotated (sjdb) | 1450647 Number of splices: GT/AG | 1513790 Number of splices: GC/AG | 17524 Number of splices: AT/AC | 1204 Number of splices: Non-canonical | 15990 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.15% Deletion average length | 1.11 Insertion rate per base | 0.12% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 182707 % of reads mapped to multiple loci | 2.68% Number of reads mapped to too many loci | 115584 % of reads mapped to too many loci | 1.70% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.28% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 494307 494307 494307 N_multimapping 182707 182707 182707 N_noFeature 264476 340541 5973266 N_ambiguous 97952 10461 663 UnstrandedReadsAssigned:5774620 PositiveStrandReadsAssigned:5786046 NegativeStrandReadsAssigned:163119 Dataset is classified positive stranded MeadianReadLen=81 20thPercentileLength=56 echo kmer=51 ERR1806574 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR1806574-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,814,062 reads, 5,721,629 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,044 rounds 52973 ERR1806574.ke.tsv 35125 ERR1806574.se.tsv 88098 total ==> ERR1806574.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 82.7438 27.1828 PNS24247 1044 945 5.83333 1.69734 PNS24249 1928 1829 60.9004 9.15569 PNS24246 1044 945 5.83333 1.69734 PNS24248 1044 945 5.83333 1.69734 PNS24244 1471 1372 76.8558 15.4031 PNS24243 293 194 0 0 KQK14069 1603 1504 1942.48 355.136 KQK14071 474 375 131.416 96.3609 ==> ERR1806574.se.tsv <== BRADI_1g14170v3 2390 BRADI_1g53295v3 142 BRADI_1g59795v3 97 BRADI_1g07683v3 0 BRADI_1g00485v3 46 BRADI_1g20270v3 480 BRADI_1g74790v3 67 BRADI_1g09890v3 0 BRADI_1g77505v3 90 BRADI_1g48960v3 0 ERR1806574 completed mapping pipeline successfully