Starting /dee2/code/volunteer_pipeline.sh ERR1806575 current disk space = 1523747368960 free memory = 1583474620 ERR1806575 SRAfilesize d729cddd1329351359952622bbe6197f ERR1806575.sra ERR1806575.sra file validated ERR1806575 is single end ERR1806575 is conventional basespace ERR1806575 read1 length is 8-234 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1806575_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 8-234 %GC 51 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.49575 24.0 21.0 26.0 18.0 27.0 2 23.37525 25.0 21.0 27.0 17.0 28.0 3 23.10875 24.0 21.0 27.0 16.0 28.0 4 23.366 25.0 21.0 27.0 16.0 28.0 5 23.18525 24.0 20.0 27.0 16.0 28.0 6 23.3555 25.0 21.0 27.0 16.0 28.0 7 23.264 25.0 20.0 27.0 16.0 28.0 8 23.28375 25.0 20.0 27.0 17.0 28.0 9 23.25850850850851 25.0 21.0 27.0 16.0 28.0 10-14 23.414993660291408 25.0 21.0 27.0 16.6 28.0 15-19 23.630958337672688 25.0 21.0 27.0 17.4 28.0 20-24 23.760960220871304 25.0 21.0 27.0 17.4 28.0 25-29 23.8106462492901 25.0 21.0 27.0 18.0 28.0 30-34 23.840668358618935 25.0 21.0 27.0 18.0 28.0 35-39 23.851802953638806 25.0 21.0 27.0 18.0 28.0 40-44 23.83166922415771 25.0 21.0 27.0 18.0 28.0 45-49 23.788986077031097 25.0 21.0 27.0 18.0 28.0 50-54 23.7926517184908 25.0 21.0 27.0 18.0 28.0 55-59 23.72157824222475 25.0 21.0 27.0 17.8 28.0 60-64 23.63759303392775 25.0 21.0 27.0 17.4 28.0 65-69 23.606137160157004 25.0 21.0 26.6 17.8 28.0 70-74 23.704048070720322 25.0 21.0 27.0 18.0 28.0 75-79 23.58426858726735 25.0 21.0 26.8 17.4 28.0 80-84 23.522354039945764 25.0 21.0 26.8 17.4 28.0 85-89 23.539573938325976 25.0 21.0 26.6 17.6 28.0 90-94 23.593824132798936 25.0 21.0 26.0 18.0 28.0 95-99 23.482806086346887 25.0 21.0 26.0 17.8 27.8 100-104 23.45645550433821 24.8 21.0 26.2 17.4 27.4 105-109 23.352623332795634 24.8 21.0 26.0 17.6 27.2 110-114 23.162781208003672 24.6 20.2 26.0 17.0 27.0 115-119 23.12080474609998 24.0 20.4 26.0 17.0 27.0 120-124 23.082543087142646 24.0 20.4 26.0 17.2 27.0 125-129 22.67117371854184 23.8 20.0 26.0 16.0 27.0 130-134 22.5540256674341 23.6 20.0 26.0 16.2 27.0 135-139 22.483825784581107 24.0 20.0 26.0 15.6 27.0 140-144 22.39889253407031 23.2 20.0 26.0 15.6 27.0 145-149 22.31283389896342 23.4 19.8 26.0 15.4 27.0 150-154 21.772868075562403 22.8 18.8 25.6 14.2 26.8 155-159 21.405140692205038 22.4 18.6 25.0 14.0 26.2 160-164 21.214310966810963 21.8 17.8 24.8 13.8 26.2 165-169 20.92850191371578 21.2 18.0 24.8 13.8 26.0 170-174 21.538168364663598 NaN NaN NaN NaN NaN 175-179 21.19592323774029 NaN NaN NaN NaN NaN 180-184 20.561420215666228 NaN NaN NaN NaN NaN 185-189 20.613089259946403 NaN NaN NaN NaN NaN 190-194 20.72549362131141 NaN NaN NaN NaN NaN 195-199 20.4335960591133 NaN NaN NaN NaN NaN 200-204 19.81123188405797 NaN NaN NaN NaN NaN 205-209 19.81716322892793 NaN NaN NaN NaN NaN 210-214 19.29 NaN NaN NaN NaN NaN 215-219 21.546666666666667 NaN NaN NaN NaN NaN 220-224 20.916666666666664 NaN NaN NaN NaN NaN 225-229 16.9 NaN NaN NaN NaN NaN 230-234 21.3 NaN NaN NaN NaN NaN >>END_MODULE >>Per sequence quality scores warn #Quality Count 11 1.0 12 5.0 13 7.0 14 12.0 15 24.0 16 45.0 17 86.0 18 91.0 19 138.0 20 177.0 21 280.0 22 359.0 23 642.0 24 1026.0 25 936.0 26 166.0 27 5.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.074999999999996 42.85 17.65 14.424999999999999 2 41.525 35.075 6.5 16.900000000000002 3 32.225 30.725 18.55 18.5 4 36.25 28.825 15.325 19.6 5 28.549999999999997 25.874999999999996 18.224999999999998 27.35 6 26.575 29.25 19.950000000000003 24.224999999999998 7 23.25 30.4 24.725 21.625 8 25.924999999999997 26.174999999999997 23.05 24.85 9 25.875875875875877 23.623623623623622 23.7987987987988 26.7017017017017 10-14 26.479750778816197 25.86172243995578 23.96241583760426 23.696110943623758 15-19 27.97443959833655 25.083679886398215 22.918145856577745 24.02373465868749 20-24 28.24024208852644 24.193465661383804 22.818895214648407 24.74739703544135 25-29 26.89737346526447 25.047920012433302 23.623270994145987 24.431435528156246 30-34 27.725987221116583 24.599350581334452 23.138158583848327 24.53650361370064 35-39 26.834437086092716 24.52450331125828 23.263576158940396 25.37748344370861 40-44 27.121562718613784 24.414787709196577 24.070386912769738 24.3932626594199 45-49 26.837812688160273 24.25967485905085 24.24325359899283 24.659258853796047 50-54 26.79573512906846 24.315375982042646 24.085297418630752 24.803591470258137 55-59 26.11487072705188 24.25241483023888 24.154086413326393 25.478628029382843 60-64 26.980212906717988 23.43778192097191 24.827088470559932 24.754916701750165 65-69 26.716588399543088 23.97512374666836 23.994161695646657 25.314126158141896 70-74 26.381789681728346 23.6761398487017 24.936959040414365 25.00511142915559 75-79 26.57280474249722 24.20896628380882 24.631344942571324 24.58688403112264 80-84 26.637305276894217 24.166054971046407 24.4596688687709 24.736970883288475 85-89 26.049880799559876 24.243535668439392 25.508894186686227 24.197689345314505 90-94 27.122715404699736 24.45953002610966 24.54308093994778 23.87467362924282 95-99 25.611217641418982 25.575263662511983 24.70038350910834 24.11313518696069 100-104 26.528599605522686 24.44350521273598 25.06339814032122 23.964497041420117 105-109 26.634742404227215 24.322985468956407 25.924702774108322 23.11756935270806 110-114 26.4967168791039 23.368095789880265 25.62765546543067 24.507531865585168 115-119 26.17558489691916 24.73940236275191 24.785730831596016 24.299281908732915 120-124 24.733595064498036 23.920358945597307 27.285473920358942 24.06057206954571 125-129 26.385224274406333 24.34036939313984 24.901055408970976 24.37335092348285 130-134 26.44694533762058 23.914790996784564 25.482315112540192 24.155948553054664 135-139 23.870967741935484 24.714640198511166 26.84863523573201 24.56575682382134 140-144 26.31578947368421 24.06015037593985 24.24812030075188 25.375939849624064 145-149 25.4871395167576 23.22681215900234 27.74746687451286 23.538581449727204 150-154 26.552053486150907 22.540592168099334 26.93409742120344 23.973256924546323 155-159 27.339901477832512 24.261083743842367 26.354679802955665 22.04433497536946 160-164 25.51622418879056 21.976401179941004 29.941002949852507 22.566371681415927 165-169 24.014336917562723 27.24014336917563 22.939068100358423 25.806451612903224 170-174 23.542116630669547 25.26997840172786 27.429805615550755 23.758099352051836 175-179 27.105263157894736 25.526315789473685 24.210526315789473 23.157894736842106 180-184 24.149659863945576 23.12925170068027 26.190476190476193 26.53061224489796 185-189 29.565217391304348 23.91304347826087 28.695652173913043 17.82608695652174 190-194 30.319148936170215 23.93617021276596 23.404255319148938 22.340425531914892 195-199 22.602739726027394 27.397260273972602 26.027397260273972 23.972602739726025 200-204 35.65217391304348 22.608695652173914 19.130434782608695 22.608695652173914 205-209 37.5 29.166666666666668 12.5 20.833333333333336 210-214 32.5 30.0 20.0 17.5 215-219 26.923076923076923 19.230769230769234 30.76923076923077 23.076923076923077 220-224 41.17647058823529 17.647058823529413 35.294117647058826 5.88235294117647 225-229 10.0 10.0 30.0 50.0 230-234 25.0 12.5 37.5 25.0 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 1.0 19 2.5 20 5.0 21 5.0 22 3.5 23 5.0 24 7.5 25 7.0 26 5.0 27 4.0 28 5.0 29 8.0 30 13.0 31 19.5 32 24.0 33 28.0 34 38.0 35 54.0 36 65.5 37 81.0 38 95.5 39 99.0 40 102.16666666666667 41 122.33333333333333 42 158.0 43 176.16666666666669 44 194.0 45 213.5 46 230.5 47 234.33333333333334 48 240.5 49 237.66666666666666 50 210.83333333333337 51 214.16666666666666 52 217.83333333333331 53 222.66666666666669 54 226.66666666666666 55 204.83333333333331 56 180.83333333333334 57 164.83333333333331 58 158.83333333333331 59 161.33333333333334 60 159.33333333333334 61 151.83333333333334 62 134.33333333333331 63 110.0 64 108.0 65 110.83333333333333 66 97.5 67 85.5 68 73.0 69 63.0 70 63.0 71 51.5 72 34.5 73 24.0 74 14.5 75 8.5 76 6.0 77 4.0 78 2.0 79 1.5 80 2.5 81 3.5 82 3.5 83 2.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-159 0.0 160-164 0.0 165-169 0.0 170-174 0.0 175-179 0.0 180-184 0.0 185-189 0.0 190-194 0.0 195-199 0.0 200-204 0.0 205-209 0.0 210-214 0.0 215-219 0.0 220-224 0.0 225-229 0.0 230-234 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 5-9 8.0 10-14 32.0 15-19 45.0 20-24 36.0 25-29 42.0 30-34 43.0 35-39 56.0 40-44 55.0 45-49 78.0 50-54 99.0 55-59 114.0 60-64 165.0 65-69 199.0 70-74 236.0 75-79 238.0 80-84 258.0 85-89 280.0 90-94 244.0 95-99 253.0 100-104 230.0 105-109 186.0 110-114 171.0 115-119 164.0 120-124 119.0 125-129 109.0 130-134 102.0 135-139 91.0 140-144 63.0 145-149 57.0 150-154 48.0 155-159 35.0 160-164 22.0 165-169 22.0 170-174 16.0 175-179 17.0 180-184 17.0 185-189 9.0 190-194 11.0 195-199 2.0 200-204 10.0 205-209 8.0 210-214 4.0 215-219 2.0 220-224 2.0 225-229 0.0 230-234 2.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.125 #Duplication Level Percentage of deduplicated Percentage of total 1 98.90445859872612 97.05 2 0.8662420382165605 1.7000000000000002 3 0.1019108280254777 0.3 4 0.05095541401273885 0.2 5 0.0 0.0 6 0.025477707006369425 0.15 7 0.0 0.0 8 0.025477707006369425 0.2 9 0.0 0.0 >10 0.025477707006369425 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACTCCAAGATCATCAACGACAGGGAGACTGGCCGTTCCCGCGGGTTCGGC 16 0.4 No Hit GGGAAGAAGCTCACTGCCGAGGCTTATGACTGCAACAATACGGTTGAGCA 8 0.2 No Hit GGGGAAGAAGCTCACTGCCGAGGCTTATGACTGCAACAATACGGTTGAGC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.0 0.0 0.0 0.0 0.0 80-84 0.0 0.0 0.0 0.0 0.0 85-89 0.0 0.0 0.0 0.0 0.0 90-94 0.0 0.0 0.0 0.0 0.0 95-99 0.0 0.0 0.0 0.0 0.0 100-104 0.0 0.0 0.0 0.0 0.0 105-109 0.0 0.0 0.0 0.0 0.0 110-114 0.0 0.0 0.0 0.0 0.0 115-119 0.0 0.0 0.0 0.0 0.0 120-124 0.0 0.0 0.0 0.0 0.0 125-129 0.0 0.0 0.0 0.0 0.0 130-134 0.0 0.0 0.0 0.0 0.0 135-139 0.0 0.0 0.0 0.0 0.0 140-144 0.0 0.0 0.0 0.0 0.0 145-149 0.0 0.0 0.0 0.0 0.0 150-154 0.0 0.0 0.0 0.0 0.0 155-159 0.0 0.0 0.0 0.0 0.0 160-164 0.0 0.0 0.0 0.0 0.0 165-169 0.0 0.0 0.0 0.0 0.0 170-174 0.0 0.0 0.0 0.0 0.0 175-179 0.0 0.0 0.0 0.0 0.0 180-184 0.0 0.0 0.0 0.0 0.0 185-189 0.0 0.0 0.0 0.0 0.0 190-194 0.0 0.0 0.0 0.0 0.0 195-199 0.0 0.0 0.0 0.0 0.0 200-204 0.0 0.0 0.0 0.0 0.0 205-209 0.0 0.0 0.0 0.0 0.0 210-214 0.0 0.0 0.0 0.0 0.0 215-219 0.0 0.0 0.0 0.0 0.0 220-222 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTATTGG 5 0.0 7255.0 200 ATTGGCC 5 9.3374104E-4 2418.3333 175-179 ACATGAG 10 0.0012451025 1813.75 180-184 GTTATTT 10 0.0012451025 1813.75 195-199 GTGGAGT 10 0.0012451025 1813.75 190-194 AGATTGT 10 0.0012451025 1813.75 185-189 GTTCGCC 5 0.0018673105 1813.75 170-174 CCCACTA 5 0.004667418 1209.1666 165-169 AATGCAC 10 0.003734621 1209.1666 175-179 CATGAGA 10 0.007467869 906.875 180-184 GATTGTG 10 0.007467869 906.875 185-189 GTGATGA 10 0.007467869 906.875 170-174 TGCTAAA 10 0.007467869 906.875 170-174 CTTTGTT 15 2.3147139E-5 806.11115 150-154 >>END_MODULE Read 356993 spots for ERR1806575.sra Written 356993 spots for ERR1806575.sra Read 356993 spots for ERR1806575.sra Written 356993 spots for ERR1806575.sra Read 356993 spots for ERR1806575.sra Written 356993 spots for ERR1806575.sra Read 356993 spots for ERR1806575.sra Written 356993 spots for ERR1806575.sra Read 356993 spots for ERR1806575.sra Written 356993 spots for ERR1806575.sra Read 356993 spots for ERR1806575.sra Written 356993 spots for ERR1806575.sra Read 356993 spots for ERR1806575.sra Written 356993 spots for ERR1806575.sra Read 356993 spots for ERR1806575.sra Written 356993 spots for ERR1806575.sra Read 356993 spots for ERR1806575.sra Written 356993 spots for ERR1806575.sra Read 356993 spots for ERR1806575.sra Written 356993 spots for ERR1806575.sra Read 356993 spots for ERR1806575.sra Written 356993 spots for ERR1806575.sra Read 356993 spots for ERR1806575.sra Written 356993 spots for ERR1806575.sra Read 356993 spots for ERR1806575.sra Written 356993 spots for ERR1806575.sra Read 356993 spots for ERR1806575.sra Written 356993 spots for ERR1806575.sra Read 356993 spots for ERR1806575.sra Written 356993 spots for ERR1806575.sra Read 356993 spots for ERR1806575.sra Written 356993 spots for ERR1806575.sra Read 356993 spots for ERR1806575.sra Written 356993 spots for ERR1806575.sra Read 357002 spots for ERR1806575.sra Written 357002 spots for ERR1806575.sra Read 356993 spots for ERR1806575.sra Written 356993 spots for ERR1806575.sra Read 356993 spots for ERR1806575.sra Written 356993 spots for ERR1806575.sra SRR ids: ['ERR1806575.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f9ag7l26 ERR1806575.sra spots: 7139869 blocks: [[1, 356993], [356994, 713986], [713987, 1070979], [1070980, 1427972], [1427973, 1784965], [1784966, 2141958], [2141959, 2498951], [2498952, 2855944], [2855945, 3212937], [3212938, 3569930], [3569931, 3926923], [3926924, 4283916], [4283917, 4640909], [4640910, 4997902], [4997903, 5354895], [5354896, 5711888], [5711889, 6068881], [6068882, 6425874], [6425875, 6782867], [6782868, 7139869]] ERR1806575 file size 1585418 ERR1806575 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1806575 ERR1806575_1.fastq Input file: ERR1806575_1.fastq trimmed: ERR1806575-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 17:02:37 2024 >> started Mon Dec 9 17:02:41 2024 >> done (3.660s) 7139869 reads processed; of these: 122450 ( 1.72%) short reads filtered out after trimming by size control 7 ( 0.00%) empty reads filtered out after trimming by size control 7017412 (98.28%) reads available; of these: 107157 ( 1.53%) trimmed reads available after processing 6910255 (98.47%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 12553 0.18% 19 12405 0.18% 20 12221 0.17% 21 12495 0.18% 22 12278 0.17% 23 12205 0.17% 24 14504 0.21% 25 12804 0.18% 26 13081 0.19% 27 13852 0.20% 28 13696 0.20% 29 14194 0.20% 30 15105 0.22% 31 14971 0.21% 32 15539 0.22% 33 16523 0.24% 34 16840 0.24% 35 16655 0.24% 36 18332 0.26% 37 17843 0.25% 38 18254 0.26% 39 20613 0.29% 40 20044 0.29% 41 20944 0.30% 42 23808 0.34% 43 23255 0.33% 44 24176 0.34% 45 26846 0.38% 46 27040 0.39% 47 28064 0.40% 48 31204 0.44% 49 31388 0.45% 50 32799 0.47% 51 35967 0.51% 52 37212 0.53% 53 37963 0.54% 54 42065 0.60% 55 43251 0.62% 56 44560 0.63% 57 47825 0.68% 58 49241 0.70% 59 53008 0.76% 60 58841 0.84% 61 58031 0.83% 62 58644 0.84% 63 64770 0.92% 64 63338 0.90% 65 64898 0.92% 66 68344 0.97% 67 69830 1.00% 68 71583 1.02% 69 75057 1.07% 70 76125 1.08% 71 77322 1.10% 72 82700 1.18% 73 79200 1.13% 74 83223 1.19% 75 84492 1.20% 76 84780 1.21% 77 94420 1.35% 78 94584 1.35% 79 87221 1.24% 80 87163 1.24% 81 88149 1.26% 82 96465 1.37% 83 92680 1.32% 84 89685 1.28% 85 88615 1.26% 86 87119 1.24% 87 88808 1.27% 88 88725 1.26% 89 87840 1.25% 90 89470 1.27% 91 85540 1.22% 92 85521 1.22% 93 90264 1.29% 94 84462 1.20% 95 83095 1.18% 96 83968 1.20% 97 79738 1.14% 98 80278 1.14% 99 80702 1.15% 100 79215 1.13% 101 78339 1.12% 102 76479 1.09% 103 79598 1.13% 104 73304 1.04% 105 72132 1.03% 106 68560 0.98% 107 68087 0.97% 108 67368 0.96% 109 67021 0.96% 110 64379 0.92% 111 63927 0.91% 112 62643 0.89% 113 59227 0.84% 114 60900 0.87% 115 57726 0.82% 116 55596 0.79% 117 55074 0.78% 118 52438 0.75% 119 51073 0.73% 120 50391 0.72% 121 48753 0.69% 122 46659 0.66% 123 44852 0.64% 124 43886 0.63% 125 42569 0.61% 126 41826 0.60% 127 39980 0.57% 128 38022 0.54% 129 38356 0.55% 130 36119 0.51% 131 34909 0.50% 132 34836 0.50% 133 33658 0.48% 134 32948 0.47% 135 31627 0.45% 136 29401 0.42% 137 28343 0.40% 138 28858 0.41% 139 27468 0.39% 140 26964 0.38% 141 25235 0.36% 142 23851 0.34% 143 23341 0.33% 144 23071 0.33% 145 22562 0.32% 146 21511 0.31% 147 21643 0.31% 148 20068 0.29% 149 18852 0.27% 150 18650 0.27% 151 18013 0.26% 152 17260 0.25% 153 16883 0.24% 154 16470 0.23% 155 16061 0.23% 156 15234 0.22% 157 14895 0.21% 158 13659 0.19% 159 13544 0.19% 160 12791 0.18% 161 12333 0.18% 162 12104 0.17% 163 11799 0.17% 164 11288 0.16% 165 10755 0.15% 166 10352 0.15% 167 10226 0.15% 168 9520 0.14% 169 9322 0.13% 170 9057 0.13% 171 8756 0.12% 172 8391 0.12% 173 8084 0.12% 174 7738 0.11% 175 7252 0.10% 176 7151 0.10% 177 6885 0.10% 178 6589 0.09% 179 6282 0.09% 180 6156 0.09% 181 5955 0.08% 182 5646 0.08% 183 5463 0.08% 184 5118 0.07% 185 4987 0.07% 186 4850 0.07% 187 4623 0.07% 188 4415 0.06% 189 4286 0.06% 190 3991 0.06% 191 3857 0.05% 192 3737 0.05% 193 3677 0.05% 194 3430 0.05% 195 3168 0.05% 196 3196 0.05% 197 3023 0.04% 198 2842 0.04% 199 2783 0.04% 200 2658 0.04% 201 2556 0.04% 202 2307 0.03% 203 2256 0.03% 204 2189 0.03% 205 2176 0.03% 206 2041 0.03% 207 1903 0.03% 208 1846 0.03% 209 1727 0.02% 210 1728 0.02% 211 1529 0.02% 212 1453 0.02% 213 1337 0.02% 214 1325 0.02% 215 1195 0.02% 216 1146 0.02% 217 1109 0.02% 218 1088 0.02% 219 1043 0.01% 220 963 0.01% 221 868 0.01% 222 815 0.01% 223 796 0.01% 224 725 0.01% 225 662 0.01% 226 629 0.01% 227 588 0.01% 228 567 0.01% 229 522 0.01% 230 507 0.01% 231 465 0.01% 232 456 0.01% 233 408 0.01% 234 378 0.01% 235 344 0.00% 236 333 0.00% 237 304 0.00% 238 257 0.00% 239 253 0.00% 240 237 0.00% 241 209 0.00% 242 188 0.00% 243 190 0.00% 244 149 0.00% 245 144 0.00% 246 131 0.00% 247 120 0.00% 248 109 0.00% 249 97 0.00% 250 98 0.00% 251 83 0.00% 252 77 0.00% 253 74 0.00% 254 53 0.00% 255 60 0.00% 256 52 0.00% 257 43 0.00% 258 41 0.00% 259 34 0.00% 260 37 0.00% 261 34 0.00% 262 28 0.00% 263 14 0.00% 264 25 0.00% 265 23 0.00% 266 17 0.00% 267 15 0.00% 268 11 0.00% 269 6 0.00% 270 5 0.00% 271 5 0.00% 272 9 0.00% 273 7 0.00% 274 1 0.00% 275 9 0.00% 276 3 0.00% 277 2 0.00% 278 2 0.00% 279 3 0.00% 280 0 0.00% 281 0 0.00% 282 3 0.00% 283 0 0.00% 284 0 0.00% 285 3 0.00% 286 0 0.00% 287 1 0.00% 288 1 0.00% 289 0 0.00% 290 0 0.00% 291 0 0.00% 292 0 0.00% 293 0 0.00% 294 0 0.00% 295 0 0.00% 296 0 0.00% 297 0 0.00% 298 0 0.00% 299 0 0.00% 300 0 0.00% 301 0 0.00% 302 0 0.00% 303 0 0.00% 304 0 0.00% 305 0 0.00% 306 0 0.00% 307 0 0.00% 308 0 0.00% 309 0 0.00% 310 0 0.00% 311 0 0.00% 312 0 0.00% 313 1 0.00% 314 0 0.00% 315 0 0.00% 316 0 0.00% 317 1 0.00% 7017412 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=5.70 fanout-score-rank=22 prefix-density=0.29 prefix-fanout=4.3 sequence=GGCAAGACCATCACCCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=123.45 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=9.4 sequence=AGAAGATTGTGATCAAGACCTGTGGGACTACCATGCTCCTGCTCACCATTCCAAGGATTCTTGAGCTTGCTGAAGAGCTGTGCATGCCGCTTGCTGCTGTGAAGTACTCTCGAGGGATGTTCATCTTCCCTGGCGCACAGCCAGCTCCCCACAGGAGCTTCTCTGAGGAGGTTGATGTCCTTAACCGCTACTTTGGTGGCCTGAAATCTGGTGGCAATGCTTATGTGATTGGAGATCCAGCCAAGCCAGGCCAGAAGTGGCACATCTATTATGCCACTGAGCAACCTGAGAAACCTATGGTCACACTGGAGATGTGCATGACTGGGCTGGACAAGAAGAAAGCCTCTGTCTTCTTCAAGACTTCTGCTGATGGACACATCTCATGTGCTAAGGAGATGACAAAGGTCTCTGGTATCTCTGAAATCATCCCGGAGATGGAGGTCTGTGACTTCGACTTTGAGCCCTGCGGCTACTCCATGAACGCCATCCATGGATCTGCGTTCTCTACAAT Started job on | Dec 09 17:03:14 Started mapping on | Dec 09 17:03:14 Finished on | Dec 09 17:03:25 Mapping speed, Million of reads per hour | 2296.61 Number of input reads | 7017412 Average input read length | 94 UNIQUE READS: Uniquely mapped reads number | 5837992 Uniquely mapped reads % | 83.19% Average mapped length | 89.31 Number of splices: Total | 1599060 Number of splices: Annotated (sjdb) | 1504582 Number of splices: GT/AG | 1564348 Number of splices: GC/AG | 17588 Number of splices: AT/AC | 1387 Number of splices: Non-canonical | 15737 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.14% Deletion average length | 1.10 Insertion rate per base | 0.14% Insertion average length | 1.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 172253 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 107603 % of reads mapped to too many loci | 1.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.54% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1007167 1007167 1007167 N_multimapping 172253 172253 172253 N_noFeature 153327 206958 5694231 N_ambiguous 101188 11801 456 UnstrandedReadsAssigned:5583477 PositiveStrandReadsAssigned:5619233 NegativeStrandReadsAssigned:143305 Dataset is classified positive stranded MeadianReadLen=91 20thPercentileLength=66 echo kmer=61 ERR1806575 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR1806575-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,017,412 reads, 5,796,644 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,003 rounds 52973 ERR1806575.ke.tsv 35125 ERR1806575.se.tsv 88098 total ==> ERR1806575.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 83.681 25.2246 PNS24247 1044 945 14.5833 3.89357 PNS24249 1928 1829 41.9038 5.78046 PNS24246 1044 945 14.5833 3.89357 PNS24248 1044 945 14.5833 3.89357 PNS24244 1471 1372 118.665 21.8219 PNS24243 293 194 0 0 KQK14069 1603 1504 1327.01 222.613 KQK14071 474 375 29.0655 19.5555 ==> ERR1806575.se.tsv <== BRADI_1g14170v3 1375 BRADI_1g53295v3 58 BRADI_1g59795v3 68 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 657 BRADI_1g74790v3 131 BRADI_1g09890v3 0 BRADI_1g77505v3 160 BRADI_1g48960v3 0 ERR1806575 completed mapping pipeline successfully