Starting /dee2/code/volunteer_pipeline.sh ERR1806577 current disk space = 1523715112960 free memory = 1580384016 ERR1806577 SRAfilesize fcf4d92fde4ab8f552955bff551f682d ERR1806577.sra ERR1806577.sra file validated ERR1806577 is single end ERR1806577 is conventional basespace ERR1806577 read1 length is 8-230 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1806577_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 8-230 %GC 51 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.3195 24.0 21.0 26.0 18.0 27.0 2 23.236 25.0 20.0 26.0 16.0 28.0 3 23.00225 24.0 20.0 26.0 16.0 28.0 4 23.15075 24.0 20.0 27.0 16.0 28.0 5 23.035 24.0 20.0 26.0 16.0 28.0 6 23.12575 24.0 20.0 27.0 16.0 28.0 7 23.17475 24.0 20.0 27.0 16.0 28.0 8 23.1075 25.0 20.0 27.0 16.0 28.0 9 23.246623311655828 25.0 20.0 27.0 16.0 28.0 10-14 23.299936575304223 24.8 20.8 27.0 16.2 28.0 15-19 23.58323681808879 25.0 21.0 27.0 17.0 28.0 20-24 23.70042272331792 25.0 21.0 27.0 17.4 28.0 25-29 23.78134403411906 25.0 21.0 27.0 18.0 28.0 30-34 23.734747313039236 25.0 21.0 27.0 18.0 28.0 35-39 23.74960709244619 25.0 21.0 27.0 18.0 28.0 40-44 23.740956120260076 25.0 21.0 27.0 17.6 28.0 45-49 23.752507176899254 25.0 21.0 27.0 18.0 28.0 50-54 23.663585733577435 25.0 21.0 27.0 17.6 28.0 55-59 23.67962826556501 25.0 21.0 27.0 17.8 28.0 60-64 23.710741655422403 25.0 21.0 27.0 18.0 28.0 65-69 23.656163346253965 25.0 21.0 27.0 17.8 28.0 70-74 23.69408140803039 25.0 21.0 27.0 18.0 28.0 75-79 23.567886541417902 25.0 21.0 26.8 17.6 28.0 80-84 23.541247041843175 25.0 21.0 26.6 17.4 28.0 85-89 23.5649895746363 25.0 21.0 26.0 17.4 27.8 90-94 23.518241098229957 25.0 21.0 26.2 18.0 27.8 95-99 23.50089372493104 25.0 21.0 26.0 17.6 27.6 100-104 23.179885661563397 24.8 20.4 26.0 17.0 27.0 105-109 23.184417001783633 24.0 20.4 26.0 17.4 27.4 110-114 23.08295163142985 24.2 20.4 26.0 17.2 27.0 115-119 22.848885730884092 24.0 20.0 26.0 16.6 27.0 120-124 23.039067887274665 24.0 20.6 26.0 17.2 27.0 125-129 22.78994887750585 23.8 20.2 26.0 16.6 27.0 130-134 22.84463934211817 23.8 20.2 26.0 16.6 27.0 135-139 22.73291187317807 24.0 20.2 26.0 16.4 27.0 140-144 22.443916444276006 23.4 20.0 25.6 16.2 26.8 145-149 22.41575517335074 23.4 20.2 25.2 16.0 27.0 150-154 22.144826209856983 22.6 19.6 25.2 15.0 27.0 155-159 21.459401911658 22.2 18.6 25.2 13.2 26.6 160-164 21.927098578223188 22.333333333333332 19.0 25.333333333333332 14.666666666666666 26.0 165-169 21.721357843143988 NaN NaN NaN NaN NaN 170-174 21.769214611739745 NaN NaN NaN NaN NaN 175-179 21.016429817821255 NaN NaN NaN NaN NaN 180-184 20.300558610589007 NaN NaN NaN NaN NaN 185-189 19.767760527475897 NaN NaN NaN NaN NaN 190-194 19.201843144084524 NaN NaN NaN NaN NaN 195-199 19.670401672630778 NaN NaN NaN NaN NaN 200-204 18.64935574229692 NaN NaN NaN NaN NaN 205-209 18.69179154179154 NaN NaN NaN NaN NaN 210-214 18.375555555555557 NaN NaN NaN NaN NaN 215-219 18.948809523809523 NaN NaN NaN NaN NaN 220-224 20.06 NaN NaN NaN NaN NaN 225-229 16.3 NaN NaN NaN NaN NaN 230 13.0 NaN NaN NaN NaN NaN >>END_MODULE >>Per sequence quality scores warn #Quality Count 10 1.0 11 2.0 12 6.0 13 6.0 14 10.0 15 28.0 16 57.0 17 90.0 18 97.0 19 141.0 20 182.0 21 256.0 22 339.0 23 602.0 24 927.0 25 957.0 26 279.0 27 16.0 28 4.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.374999999999996 42.199999999999996 19.25 13.175 2 41.925000000000004 35.725 5.625 16.725 3 31.05 32.25 20.525 16.175 4 38.375 27.525 15.225 18.875 5 30.025000000000002 26.875 17.2 25.900000000000002 6 26.125 28.95 19.7 25.224999999999998 7 24.775 29.15 23.025000000000002 23.05 8 24.025 26.775 23.275000000000002 25.924999999999997 9 26.063031515757878 22.11105552776388 24.987493746873437 26.8384192096048 10-14 26.922302737520127 24.627616747181964 24.134460547504023 24.315619967793882 15-19 27.659683450289403 24.9295702504738 23.080469190185934 24.33027710905086 20-24 26.779998950627 24.555328191405636 23.574164436749044 25.09050842121832 25-29 27.335752586253587 24.784704544223583 23.771868060445215 24.107674809077615 30-34 27.07733965137925 24.88858802955943 23.54036215941784 24.49371015964348 35-39 27.679309937374452 24.54803261254874 23.17145220371027 24.601205246366536 40-44 26.8377253814147 23.912495271718573 24.284453410667002 24.965325936199722 45-49 26.235326235326234 24.18099918099918 24.610974610974612 24.97269997269997 50-54 26.80011951000896 25.04481625336122 24.028981177173588 24.12608305945623 55-59 25.945059450594503 24.239442394423943 24.378843788437884 25.436654366543664 60-64 27.383237364043506 24.129421442281327 24.54985833104835 23.937482862626815 65-69 26.795438199938353 23.88780437686222 23.71314086098839 25.603616562211034 70-74 27.211280736510897 23.913296818552617 24.297867381424076 24.57755506351241 75-79 26.048536006330785 24.637298865734635 24.729622790820365 24.584542337114218 80-84 25.091074681238617 23.98299939283546 25.652701882210078 25.273224043715846 85-89 25.348631950573697 24.97793468667255 24.783759929390996 24.889673433362756 90-94 26.040816326530614 24.775510204081634 25.30612244897959 23.877551020408163 95-99 26.101452726839725 24.743986663491306 24.482019528459155 24.67254108120981 100-104 25.383970957833007 24.37866517732477 25.691147724099412 24.54621614074281 105-109 25.154371140721484 25.901852453688655 25.186870328241795 23.756906077348066 110-114 26.88296639629201 26.26496716879104 24.10196987253766 22.750096562379298 115-119 26.40144665461121 24.50271247739602 25.0 24.095840867992766 120-124 24.523305084745765 23.358050847457626 25.37076271186441 26.7478813559322 125-129 25.812619502868067 24.219247928616955 24.920331421287443 25.04780114722753 130-134 24.284666177549525 27.51283932501834 24.43140132061629 23.771093176815846 135-139 26.596675415573053 23.53455818022747 25.109361329833767 24.759405074365702 140-144 26.68112798264642 26.572668112798265 23.318872017353577 23.427331887201735 145-149 25.0 26.82926829268293 21.463414634146343 26.707317073170735 150-154 24.825662482566248 27.05718270571827 23.84937238493724 24.267782426778243 155-159 26.182432432432435 26.52027027027027 22.635135135135133 24.66216216216216 160-164 27.308447937131632 26.91552062868369 19.44990176817289 26.326129666011788 165-169 27.49391727493917 24.330900243309003 22.871046228710462 25.304136253041364 170-174 27.9874213836478 27.044025157232703 24.21383647798742 20.754716981132077 175-179 28.89733840304182 25.475285171102662 23.193916349809886 22.433460076045627 180-184 25.229357798165136 25.229357798165136 26.605504587155966 22.93577981651376 185-189 26.82926829268293 25.609756097560975 25.0 22.5609756097561 190-194 29.838709677419356 27.419354838709676 23.387096774193548 19.35483870967742 195-199 26.262626262626267 24.242424242424242 23.232323232323232 26.262626262626267 200-204 23.376623376623375 22.07792207792208 23.376623376623375 31.16883116883117 205-209 35.9375 28.125 14.0625 21.875 210-214 24.444444444444443 37.77777777777778 22.22222222222222 15.555555555555555 215-219 38.88888888888889 19.444444444444446 36.11111111111111 5.555555555555555 220-224 50.0 12.5 12.5 25.0 225-229 44.44444444444444 22.22222222222222 0.0 33.33333333333333 230 0.0 0.0 0.0 100.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 2.0 21 2.0 22 3.0 23 3.5 24 2.5 25 2.5 26 2.0 27 4.0 28 9.0 29 13.0 30 16.5 31 22.5 32 27.5 33 32.5 34 44.0 35 61.0 36 76.0 37 88.5 38 121.5 39 158.0 40 172.5 41 186.83333333333331 42 209.00000000000003 43 230.0 44 231.0 45 252.16666666666666 46 290.1666666666667 47 311.16666666666663 48 326.33333333333337 49 325.1666666666667 50 305.83333333333337 51 285.83333333333337 52 286.33333333333337 53 291.83333333333337 54 273.5 55 251.0 56 237.33333333333331 57 218.83333333333331 58 207.5 59 202.5 60 193.5 61 177.5 62 160.5 63 144.33333333333334 64 130.5 65 131.5 66 133.0 67 122.5 68 108.5 69 96.0 70 85.0 71 87.5 72 91.5 73 75.0 74 55.0 75 38.5 76 29.0 77 26.0 78 22.0 79 17.0 80 13.0 81 11.0 82 10.0 83 10.5 84 10.5 85 9.5 86 7.0 87 5.0 88 3.0 89 1.5 90 1.5 91 1.0 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-159 0.0 160-164 0.0 165-169 0.0 170-174 0.0 175-179 0.0 180-184 0.0 185-189 0.0 190-194 0.0 195-199 0.0 200-204 0.0 205-209 0.0 210-214 0.0 215-219 0.0 220-224 0.0 225-229 0.0 230 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 5-9 6.0 10-14 62.0 15-19 80.0 20-24 110.0 25-29 123.0 30-34 169.0 35-39 179.0 40-44 241.0 45-49 256.0 50-54 243.0 55-59 239.0 60-64 254.0 65-69 229.0 70-74 215.0 75-79 197.0 80-84 199.0 85-89 157.0 90-94 149.0 95-99 128.0 100-104 113.0 105-109 98.0 110-114 84.0 115-119 67.0 120-124 65.0 125-129 49.0 130-134 40.0 135-139 46.0 140-144 32.0 145-149 19.0 150-154 23.0 155-159 21.0 160-164 17.0 165-169 19.0 170-174 14.0 175-179 8.0 180-184 13.0 185-189 7.0 190-194 7.0 195-199 5.0 200-204 3.0 205-209 4.0 210-214 2.0 215-219 3.0 220-224 3.0 225-229 1.0 230-231 1.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21697398332913 98.2 2 0.6062136903258398 1.2 3 0.1262945188178833 0.375 4 0.025258903763576663 0.1 5 0.025258903763576663 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGAAGAAGCTCACTGCCGAGGCTTATGACTGCAACAATACGGTTGAGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.0 0.0 0.0 0.0 0.0 80-84 0.0 0.0 0.0 0.0 0.0 85-89 0.0 0.0 0.0 0.0 0.0 90-94 0.0 0.0 0.0 0.0 0.0 95-99 0.0 0.0 0.0 0.0 0.0 100-104 0.0 0.0 0.0 0.0 0.0 105-109 0.0 0.0 0.0 0.0 0.0 110-114 0.0 0.0 0.0 0.0 0.0 115-119 0.0 0.0 0.0 0.0 0.0 120-124 0.0 0.0 0.0 0.0 0.0 125-129 0.0 0.0 0.0 0.0 0.0 130-134 0.0 0.0 0.0 0.0 0.0 135-139 0.0 0.0 0.0 0.0 0.0 140-144 0.0 0.0 0.0 0.0 0.0 145-149 0.0 0.0 0.0 0.0 0.0 150-154 0.0 0.0 0.0 0.0 0.0 155-159 0.0 0.0 0.0 0.0 0.0 160-164 0.0 0.0 0.0 0.0 0.0 165-169 0.0 0.0 0.0 0.0 0.0 170-174 0.0 0.0 0.0 0.0 0.0 175-179 0.0 0.0 0.0 0.0 0.0 180-184 0.0 0.0 0.0 0.0 0.0 185-189 0.0 0.0 0.0 0.0 0.0 190-194 0.0 0.0 0.0 0.0 0.0 195-199 0.0 0.0 0.0 0.0 0.0 200-204 0.0 0.0 0.0 0.0 0.0 205-209 0.0 0.0 0.0 0.0 0.0 210-214 0.0 0.0 0.0 0.0 0.0 215-218 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGAGG 10 0.0 2531.0 200-204 TGTCCAA 10 0.0 2531.0 175-179 GGTGGGT 10 0.0 2531.0 210-214 ATCAAGG 5 0.0019179606 1687.3335 150-154 GTGGGTG 10 0.0025576176 1265.5 210-214 TGAGCAA 10 0.0025576176 1265.5 195-199 GAGGTAT 5 0.0063915183 1012.4 190-194 GAGCGGT 5 0.0063915183 1012.4 205-209 AGCTCGC 5 0.0063915183 1012.4 180-184 GCAAGAG 5 0.0063915183 1012.4 195-199 GGCGTAC 5 0.0063915183 1012.4 160-164 AGAGGTA 5 0.0063915183 1012.4 185-189 GCAGGCG 5 0.0063915183 1012.4 160-164 AAGAGGA 5 0.0063915183 1012.4 200-204 GCGGTGT 5 0.0063915183 1012.4 170-174 CGCCAGA 5 0.0063915183 1012.4 185-189 AGGCGTA 5 0.0063915183 1012.4 160-164 TATGAGC 5 0.0063915183 1012.4 190-194 CGGACCA 5 0.0063915183 1012.4 220-224 GCGGACC 5 0.0063915183 1012.4 220-224 >>END_MODULE Read 581158 spots for ERR1806577.sra Written 581158 spots for ERR1806577.sra Read 581158 spots for ERR1806577.sra Written 581158 spots for ERR1806577.sra Read 581162 spots for ERR1806577.sra Written 581162 spots for ERR1806577.sra Read 581158 spots for ERR1806577.sra Written 581158 spots for ERR1806577.sra Read 581158 spots for ERR1806577.sra Written 581158 spots for ERR1806577.sra Read 581158 spots for ERR1806577.sra Written 581158 spots for ERR1806577.sra Read 581158 spots for ERR1806577.sra Written 581158 spots for ERR1806577.sra Read 581158 spots for ERR1806577.sra Written 581158 spots for ERR1806577.sra Read 581158 spots for ERR1806577.sra Written 581158 spots for ERR1806577.sra Read 581158 spots for ERR1806577.sra Written 581158 spots for ERR1806577.sra Read 581158 spots for ERR1806577.sra Written 581158 spots for ERR1806577.sra Read 581158 spots for ERR1806577.sra Written 581158 spots for ERR1806577.sra Read 581158 spots for ERR1806577.sra Written 581158 spots for ERR1806577.sra Read 581158 spots for ERR1806577.sra Written 581158 spots for ERR1806577.sra Read 581158 spots for ERR1806577.sra Written 581158 spots for ERR1806577.sra Read 581158 spots for ERR1806577.sra Written 581158 spots for ERR1806577.sra Read 581158 spots for ERR1806577.sra Written 581158 spots for ERR1806577.sra Read 581158 spots for ERR1806577.sra Written 581158 spots for ERR1806577.sra Read 581158 spots for ERR1806577.sra Written 581158 spots for ERR1806577.sra Read 581158 spots for ERR1806577.sra Written 581158 spots for ERR1806577.sra SRR ids: ['ERR1806577.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_48jpv8bz ERR1806577.sra spots: 11623164 blocks: [[1, 581158], [581159, 1162316], [1162317, 1743474], [1743475, 2324632], [2324633, 2905790], [2905791, 3486948], [3486949, 4068106], [4068107, 4649264], [4649265, 5230422], [5230423, 5811580], [5811581, 6392738], [6392739, 6973896], [6973897, 7555054], [7555055, 8136212], [8136213, 8717370], [8717371, 9298528], [9298529, 9879686], [9879687, 10460844], [10460845, 11042002], [11042003, 11623164]] ERR1806577 file size 2072232 ERR1806577 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1806577 ERR1806577_1.fastq Input file: ERR1806577_1.fastq trimmed: ERR1806577-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 17:04:53 2024 >> started Mon Dec 9 17:04:59 2024 >> done (5.927s) 11623164 reads processed; of these: 376988 ( 3.24%) short reads filtered out after trimming by size control 21 ( 0.00%) empty reads filtered out after trimming by size control 11246155 (96.76%) reads available; of these: 143945 ( 1.28%) trimmed reads available after processing 11102210 (98.72%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 51203 0.46% 19 52161 0.46% 20 54792 0.49% 21 59926 0.53% 22 60460 0.54% 23 62599 0.56% 24 70736 0.63% 25 68966 0.61% 26 73885 0.66% 27 80547 0.72% 28 81067 0.72% 29 82564 0.73% 30 92987 0.83% 31 90351 0.80% 32 92718 0.82% 33 103969 0.92% 34 108171 0.96% 35 104389 0.93% 36 113014 1.00% 37 107643 0.96% 38 112277 1.00% 39 126647 1.13% 40 118671 1.06% 41 123353 1.10% 42 143782 1.28% 43 129255 1.15% 44 132144 1.18% 45 141332 1.26% 46 136980 1.22% 47 138125 1.23% 48 146801 1.31% 49 143840 1.28% 50 142524 1.27% 51 149652 1.33% 52 145483 1.29% 53 144864 1.29% 54 151655 1.35% 55 149611 1.33% 56 147364 1.31% 57 151188 1.34% 58 146436 1.30% 59 149720 1.33% 60 159063 1.41% 61 149354 1.33% 62 144755 1.29% 63 151024 1.34% 64 144355 1.28% 65 140341 1.25% 66 138984 1.24% 67 136816 1.22% 68 134970 1.20% 69 138496 1.23% 70 135857 1.21% 71 129813 1.15% 72 130871 1.16% 73 122666 1.09% 74 121426 1.08% 75 120944 1.08% 76 116401 1.04% 77 123544 1.10% 78 119210 1.06% 79 110096 0.98% 80 108658 0.97% 81 105079 0.93% 82 109171 0.97% 83 102300 0.91% 84 99302 0.88% 85 97208 0.86% 86 91833 0.82% 87 91322 0.81% 88 90125 0.80% 89 87257 0.78% 90 90608 0.81% 91 82512 0.73% 92 80840 0.72% 93 83733 0.74% 94 76614 0.68% 95 74150 0.66% 96 72762 0.65% 97 70013 0.62% 98 68797 0.61% 99 68483 0.61% 100 66745 0.59% 101 64897 0.58% 102 63365 0.56% 103 64161 0.57% 104 59052 0.53% 105 58331 0.52% 106 55664 0.49% 107 54390 0.48% 108 52926 0.47% 109 52964 0.47% 110 49811 0.44% 111 49003 0.44% 112 47843 0.43% 113 45137 0.40% 114 45163 0.40% 115 43804 0.39% 116 42004 0.37% 117 41059 0.37% 118 39243 0.35% 119 38340 0.34% 120 38228 0.34% 121 35526 0.32% 122 34700 0.31% 123 33914 0.30% 124 32829 0.29% 125 31393 0.28% 126 31119 0.28% 127 30141 0.27% 128 28690 0.26% 129 28200 0.25% 130 27711 0.25% 131 26248 0.23% 132 25557 0.23% 133 24871 0.22% 134 24123 0.21% 135 23166 0.21% 136 21688 0.19% 137 21651 0.19% 138 21586 0.19% 139 20651 0.18% 140 19622 0.17% 141 19029 0.17% 142 18132 0.16% 143 17370 0.15% 144 17235 0.15% 145 16510 0.15% 146 16061 0.14% 147 15851 0.14% 148 14922 0.13% 149 14294 0.13% 150 14197 0.13% 151 13378 0.12% 152 13093 0.12% 153 12639 0.11% 154 12524 0.11% 155 12000 0.11% 156 11703 0.10% 157 11255 0.10% 158 10532 0.09% 159 10332 0.09% 160 10053 0.09% 161 9670 0.09% 162 9240 0.08% 163 9097 0.08% 164 8778 0.08% 165 8606 0.08% 166 8084 0.07% 167 8026 0.07% 168 7606 0.07% 169 7315 0.07% 170 7222 0.06% 171 6687 0.06% 172 6809 0.06% 173 6495 0.06% 174 6145 0.05% 175 5772 0.05% 176 5720 0.05% 177 5374 0.05% 178 5154 0.05% 179 4970 0.04% 180 4913 0.04% 181 4546 0.04% 182 4551 0.04% 183 4388 0.04% 184 4188 0.04% 185 4049 0.04% 186 3837 0.03% 187 3748 0.03% 188 3565 0.03% 189 3517 0.03% 190 3318 0.03% 191 3124 0.03% 192 3094 0.03% 193 2900 0.03% 194 2833 0.03% 195 2606 0.02% 196 2499 0.02% 197 2449 0.02% 198 2334 0.02% 199 2275 0.02% 200 2178 0.02% 201 2126 0.02% 202 2035 0.02% 203 1856 0.02% 204 1816 0.02% 205 1744 0.02% 206 1670 0.01% 207 1615 0.01% 208 1519 0.01% 209 1482 0.01% 210 1402 0.01% 211 1290 0.01% 212 1186 0.01% 213 1066 0.01% 214 1133 0.01% 215 1106 0.01% 216 994 0.01% 217 955 0.01% 218 957 0.01% 219 833 0.01% 220 793 0.01% 221 784 0.01% 222 729 0.01% 223 682 0.01% 224 594 0.01% 225 584 0.01% 226 557 0.00% 227 545 0.00% 228 464 0.00% 229 467 0.00% 230 434 0.00% 231 380 0.00% 232 326 0.00% 233 362 0.00% 234 296 0.00% 235 297 0.00% 236 273 0.00% 237 279 0.00% 238 237 0.00% 239 224 0.00% 240 198 0.00% 241 184 0.00% 242 150 0.00% 243 155 0.00% 244 160 0.00% 245 112 0.00% 246 139 0.00% 247 109 0.00% 248 96 0.00% 249 83 0.00% 250 72 0.00% 251 76 0.00% 252 60 0.00% 253 56 0.00% 254 65 0.00% 255 46 0.00% 256 45 0.00% 257 41 0.00% 258 36 0.00% 259 27 0.00% 260 30 0.00% 261 23 0.00% 262 30 0.00% 263 22 0.00% 264 16 0.00% 265 22 0.00% 266 20 0.00% 267 9 0.00% 268 7 0.00% 269 7 0.00% 270 6 0.00% 271 8 0.00% 272 9 0.00% 273 4 0.00% 274 2 0.00% 275 6 0.00% 276 2 0.00% 277 2 0.00% 278 3 0.00% 279 3 0.00% 280 4 0.00% 281 0 0.00% 282 2 0.00% 283 2 0.00% 284 0 0.00% 285 0 0.00% 286 1 0.00% 11246155 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=39.29 fanout-score-rank=3 prefix-density=0.55 prefix-fanout=25.3 sequence=ATCACCGACTGCCCATAGAGAGGCTGAGACTGCCAAGGCACACAGGGGATAGG criterion=fanout-score sequence-density=0.05 sequence-density-rank=14 fanout-score=116.45 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=13.1 sequence=AGAAGAAGGACCCAACCGGCGCCAAGGTCACCAAGCGGCTGCCAAGA Started job on | Dec 09 17:05:16 Started mapping on | Dec 09 17:05:16 Finished on | Dec 09 17:05:38 Mapping speed, Million of reads per hour | 1840.28 Number of input reads | 11246155 Average input read length | 72 UNIQUE READS: Uniquely mapped reads number | 9300244 Uniquely mapped reads % | 82.70% Average mapped length | 67.76 Number of splices: Total | 2007597 Number of splices: Annotated (sjdb) | 1894530 Number of splices: GT/AG | 1966504 Number of splices: GC/AG | 22942 Number of splices: AT/AC | 1695 Number of splices: Non-canonical | 16456 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.12% Deletion average length | 1.09 Insertion rate per base | 0.11% Insertion average length | 1.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 354330 % of reads mapped to multiple loci | 3.15% Number of reads mapped to too many loci | 313240 % of reads mapped to too many loci | 2.79% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.00% % of reads unmapped: other | 0.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1591581 1591581 1591581 N_multimapping 354330 354330 354330 N_noFeature 305717 381386 9103741 N_ambiguous 137098 16965 874 UnstrandedReadsAssigned:8857429 PositiveStrandReadsAssigned:8901893 NegativeStrandReadsAssigned:195629 Dataset is classified positive stranded MeadianReadLen=66 20thPercentileLength=43 echo kmer=39 ERR1806577 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR1806577-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,246,155 reads, 8,558,046 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,013 rounds 52973 ERR1806577.ke.tsv 35125 ERR1806577.se.tsv 88098 total ==> ERR1806577.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 138.591 29.9777 PNS24247 1044 945 23.3333 4.47027 PNS24249 1928 1829 115.673 11.45 PNS24246 1044 945 23.3333 4.47027 PNS24248 1044 945 23.3333 4.47027 PNS24244 1471 1372 82.7356 10.9176 PNS24243 293 194 1 0.933226 KQK14069 1603 1504 2070.31 249.216 KQK14071 474 375 208.577 100.699 ==> ERR1806577.se.tsv <== BRADI_1g14170v3 2459 BRADI_1g53295v3 87 BRADI_1g59795v3 160 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 1051 BRADI_1g74790v3 170 BRADI_1g09890v3 0 BRADI_1g77505v3 190 BRADI_1g48960v3 0 ERR1806577 completed mapping pipeline successfully