Starting /dee2/code/volunteer_pipeline.sh ERR1806578 current disk space = 1523716071424 free memory = 1580803452 ERR1806578 SRAfilesize 532de73f8458f04133971eea4411c721 ERR1806578.sra ERR1806578.sra file validated ERR1806578 is single end ERR1806578 is conventional basespace ERR1806578 read1 length is 8-240 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1806578_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 8-240 %GC 51 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.56625 23.0 20.0 26.0 17.0 27.0 2 22.6915 24.0 20.0 26.0 16.0 27.0 3 22.47625 24.0 20.0 26.0 15.0 27.0 4 22.69725 24.0 20.0 26.0 15.0 27.0 5 22.765 24.0 20.0 26.0 16.0 27.0 6 22.78575 24.0 20.0 26.0 15.0 28.0 7 22.8135 24.0 20.0 26.0 16.0 28.0 8 22.8185 24.0 20.0 26.0 15.0 28.0 9 22.89554108216433 24.0 20.0 26.0 16.0 28.0 10-14 22.908693069187002 24.0 20.0 26.0 15.8 28.0 15-19 23.18849306410393 24.4 20.4 26.6 16.4 28.0 20-24 23.425300905269353 25.0 21.0 27.0 17.0 28.0 25-29 23.508350054742447 25.0 21.0 27.0 17.2 28.0 30-34 23.471029457971575 25.0 21.0 26.6 17.0 28.0 35-39 23.520757019795177 25.0 21.0 27.0 17.6 28.0 40-44 23.53321085654561 25.0 21.0 27.0 17.0 28.0 45-49 23.546057279755665 25.0 21.0 27.0 17.2 28.0 50-54 23.470771519233686 25.0 21.0 27.0 17.0 28.0 55-59 23.59216072999388 25.0 21.0 27.0 17.8 28.0 60-64 23.673542676980304 25.0 21.0 27.0 18.0 28.0 65-69 23.640932245344878 25.0 21.0 27.0 17.6 28.0 70-74 23.65928451503799 25.0 21.0 27.0 18.0 28.0 75-79 23.60948214373543 25.0 21.0 26.6 17.8 28.0 80-84 23.57331468000129 25.0 21.0 26.6 17.8 28.0 85-89 23.681819980748035 25.0 21.0 27.0 18.0 28.0 90-94 23.60572427164299 25.0 21.0 26.8 18.0 28.0 95-99 23.62865213482231 25.0 21.0 26.4 18.0 27.8 100-104 23.576255305670244 25.0 21.0 26.4 17.8 27.6 105-109 23.557820514857752 25.0 21.0 26.2 18.0 27.4 110-114 23.487371941188535 25.0 21.0 26.0 17.6 27.2 115-119 23.42160411074778 25.0 21.0 26.0 17.6 27.2 120-124 23.21393562300033 24.8 20.6 26.0 17.2 27.0 125-129 23.31209517223633 24.8 21.0 26.0 17.6 27.0 130-134 23.023452161213136 24.4 20.2 26.0 16.6 27.0 135-139 22.990330181094418 24.2 20.4 26.0 16.6 27.0 140-144 22.83149237793696 24.0 20.2 26.0 16.6 27.0 145-149 22.85547753552934 24.0 20.2 26.0 17.0 27.0 150-154 22.801221629820894 23.8 20.0 26.0 17.2 27.0 155-159 22.323247979369857 23.0 20.0 26.0 15.6 27.0 160-164 22.09388419874518 23.0 19.4 25.4 14.6 27.0 165-169 21.377077774494563 22.2 18.6 25.0 13.8 26.6 170-174 20.881696489541092 21.4 18.0 24.6 13.4 26.0 175-179 20.61830224267114 21.5 17.5 24.0 13.0 25.5 180-184 20.784569325875772 NaN NaN NaN NaN NaN 185-189 21.328431065763205 NaN NaN NaN NaN NaN 190-194 20.81860589871541 NaN NaN NaN NaN NaN 195-199 19.413736003209685 NaN NaN NaN NaN NaN 200-204 18.626162464985995 NaN NaN NaN NaN NaN 205-209 17.680652651696132 NaN NaN NaN NaN NaN 210-214 19.461666666666666 NaN NaN NaN NaN NaN 215-219 18.676190476190477 NaN NaN NaN NaN NaN 220-224 18.522727272727273 NaN NaN NaN NaN NaN 225-229 16.492857142857144 NaN NaN NaN NaN NaN 230-234 18.0 NaN NaN NaN NaN NaN 235-239 14.6 NaN NaN NaN NaN NaN 240 16.0 NaN NaN NaN NaN NaN >>END_MODULE >>Per sequence quality scores warn #Quality Count 10 1.0 11 7.0 12 13.0 13 16.0 14 14.0 15 34.0 16 74.0 17 90.0 18 130.0 19 176.0 20 197.0 21 243.0 22 389.0 23 682.0 24 1038.0 25 809.0 26 85.0 27 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.349999999999998 45.175 16.900000000000002 13.575000000000001 2 41.625 34.849999999999994 6.25 17.275 3 30.725 31.900000000000002 19.025 18.35 4 37.15 27.825 16.2 18.825 5 28.4 27.325 17.424999999999997 26.85 6 26.325 28.175 20.25 25.25 7 22.925 29.675 23.875 23.525 8 24.925 25.724999999999998 23.575 25.775 9 25.80160320641283 23.872745490981963 22.57014028056112 27.75551102204409 10-14 26.559427159497755 24.940749331854168 23.91205688064142 24.58776662800666 15-19 28.0244002460529 24.595037933155627 22.370309616567564 25.01025220422391 20-24 27.769118869492935 24.44929343308396 22.812759767248544 24.968827930174562 25-29 26.854864099066013 24.708783712876485 23.265820128030224 25.170532060027284 30-34 27.641153662293515 24.225845859669622 22.935146332394964 25.197854145641895 35-39 26.72182228430214 24.15386268400129 23.8691307617922 25.255184269904372 40-44 26.49046321525886 23.885558583106267 24.16893732970027 25.455040871934603 45-49 26.16791354945968 24.84898863951233 23.618730950401773 25.364366860626212 50-54 27.486570540005655 24.30308170766186 23.40966921119593 24.800678541136556 55-59 26.2598699489085 24.14653971202973 23.49047840222945 26.10311193683233 60-64 26.43582089552239 23.77910447761194 24.155223880597017 25.629850746268655 65-69 27.277252364360375 23.288949726231955 23.90492782478845 25.528870084619214 70-74 26.459220438912546 23.714379299050115 23.956763838847035 25.869636423190308 75-79 27.067142757123854 24.042568087936708 23.67849891479381 25.211790240145625 80-84 25.619212527290518 24.407136941955883 24.38455168260182 25.589098848151774 85-89 26.549110085695453 23.92056690837179 23.821687541199736 25.708635464733025 90-94 26.61372241204174 24.5082648443993 23.686397635977468 25.191615107581494 95-99 26.38382153653706 23.725633274262485 24.298967997498174 25.59157719170228 100-104 25.772949743344874 25.03282798137758 24.32851856273129 24.865703712546257 105-109 26.858710562414267 23.333333333333332 24.156378600823043 25.65157750342936 110-114 26.40431609013012 23.94477943509997 24.32561091716915 25.325293557600766 115-119 26.783060921248143 24.814264487369986 23.272659732540863 25.130014858841008 120-124 27.02526132404181 23.911149825783973 24.455574912891986 24.60801393728223 125-129 25.44516129032258 24.954838709677418 24.825806451612902 24.774193548387096 130-134 26.34191746819733 25.193918709277067 23.890784982935152 24.573378839590443 135-139 25.287783141477902 25.584849610100257 23.69105087263275 25.43631637578908 140-144 26.102449888641427 24.053452115812917 25.077951002227174 24.766146993318486 145-149 25.851063829787236 25.851063829787236 22.819148936170215 25.47872340425532 150-154 27.50478621569879 23.93107849393746 24.058710912571794 24.50542437779196 155-159 25.925925925925924 25.523349436392916 23.832528180354267 24.71819645732689 160-164 27.36943907156673 24.46808510638298 24.274661508704064 23.88781431334623 165-169 28.042959427207638 21.479713603818613 24.3436754176611 26.13365155131265 170-174 27.575277337559427 25.198098256735342 21.870047543581617 25.356576862123614 175-179 23.90852390852391 28.06652806652807 23.90852390852391 24.116424116424117 180-184 35.36895674300254 20.610687022900763 21.882951653944023 22.137404580152673 185-189 23.46938775510204 27.2108843537415 24.149659863945576 25.170068027210885 190-194 27.004219409282697 23.628691983122362 28.270042194092827 21.09704641350211 195-199 26.842105263157894 20.0 28.421052631578945 24.736842105263158 200-204 34.5679012345679 14.814814814814813 22.22222222222222 28.39506172839506 205-209 33.91304347826087 25.217391304347824 22.608695652173914 18.26086956521739 210-214 32.467532467532465 35.064935064935064 20.77922077922078 11.688311688311687 215-219 30.0 37.142857142857146 15.714285714285714 17.142857142857142 220-224 27.659574468085108 25.53191489361702 21.27659574468085 25.53191489361702 225-229 25.0 35.714285714285715 10.714285714285714 28.57142857142857 230-234 25.0 8.333333333333332 25.0 41.66666666666667 235-239 20.0 40.0 40.0 0.0 240 0.0 0.0 100.0 0.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 1.0 7 1.0 8 1.0 9 1.5 10 2.0 11 1.5 12 0.5 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 1.0 19 1.5 20 2.5 21 4.5 22 6.5 23 6.5 24 6.0 25 6.5 26 5.5 27 5.0 28 9.0 29 15.0 30 19.0 31 23.0 32 30.0 33 34.0 34 38.0 35 41.5 36 49.5 37 63.0 38 75.0 39 97.83333333333333 40 125.16666666666666 41 139.83333333333334 42 160.00000000000003 43 180.0 44 189.33333333333334 45 198.50000000000003 46 211.16666666666666 47 231.33333333333334 48 237.83333333333334 49 234.16666666666669 50 226.33333333333334 51 227.33333333333331 52 225.5 53 201.33333333333334 54 209.33333333333334 55 220.66666666666666 56 193.50000000000003 57 176.83333333333331 58 181.33333333333331 59 170.16666666666666 60 156.33333333333331 61 161.33333333333331 62 162.83333333333334 63 142.5 64 116.0 65 114.0 66 106.5 67 87.5 68 84.5 69 76.0 70 63.5 71 52.5 72 37.5 73 25.5 74 15.0 75 10.5 76 10.5 77 10.0 78 9.0 79 7.0 80 4.5 81 4.5 82 5.5 83 4.0 84 2.5 85 1.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-159 0.0 160-164 0.0 165-169 0.0 170-174 0.0 175-179 0.0 180-184 0.0 185-189 0.0 190-194 0.0 195-199 0.0 200-204 0.0 205-209 0.0 210-214 0.0 215-219 0.0 220-224 0.0 225-229 0.0 230-234 0.0 235-239 0.0 240 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 5-9 12.0 10-14 55.0 15-19 71.0 20-24 33.0 25-29 51.0 30-34 39.0 35-39 43.0 40-44 68.0 45-49 57.0 50-54 86.0 55-59 99.0 60-64 104.0 65-69 156.0 70-74 184.0 75-79 213.0 80-84 208.0 85-89 249.0 90-94 263.0 95-99 238.0 100-104 229.0 105-109 211.0 110-114 179.0 115-119 168.0 120-124 154.0 125-129 140.0 130-134 109.0 135-139 97.0 140-144 85.0 145-149 60.0 150-154 69.0 155-159 50.0 160-164 35.0 165-169 45.0 170-174 36.0 175-179 18.0 180-184 19.0 185-189 14.0 190-194 14.0 195-199 4.0 200-204 9.0 205-209 10.0 210-214 1.0 215-219 3.0 220-224 5.0 225-229 4.0 230-234 2.0 235-239 0.0 240-241 1.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.1 #Duplication Level Percentage of deduplicated Percentage of total 1 98.95514780835882 97.075 2 0.764525993883792 1.5 3 0.127420998980632 0.375 4 0.05096839959225281 0.2 5 0.025484199796126403 0.125 6 0.0 0.0 7 0.025484199796126403 0.17500000000000002 8 0.0 0.0 9 0.025484199796126403 0.22499999999999998 >10 0.025484199796126403 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACTCCAAGATCATCAACGACAGGGAGACTGGCCGTTCCCGCGGGTTCGGC 13 0.325 No Hit GGAGATGGAGGTCTGTGACTTCGACTTTGAGCCCTGCGGCTACTCCATGA 9 0.22499999999999998 No Hit GGGAAGAAGCTCACTGCCGAGGCTTATGACTGCAACAATACGGTTGAGCA 7 0.17500000000000002 No Hit GGATAATCATACCCCGTTCGAGGAGAGCAAGGCGATCGACATCAACCCGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.0 0.0 0.0 0.0 0.0 80-84 0.0 0.0 0.0 0.0 0.0 85-89 0.0 0.0 0.0 0.0 0.0 90-94 0.0 0.0 0.0 0.0 0.0 95-99 0.0 0.0 0.0 0.0 0.0 100-104 0.0 0.0 0.0 0.0 0.0 105-109 0.0 0.0 0.0 0.0 0.0 110-114 0.0 0.0 0.0 0.0 0.0 115-119 0.0 0.0 0.0 0.0 0.0 120-124 0.0 0.0 0.0 0.0 0.0 125-129 0.0 0.0 0.0 0.0 0.0 130-134 0.0 0.0 0.0 0.0 0.0 135-139 0.0 0.0 0.0 0.0 0.0 140-144 0.0 0.0 0.0 0.0 0.0 145-149 0.0 0.0 0.0 0.0 0.0 150-154 0.0 0.0 0.0 0.0 0.0 155-159 0.0 0.0 0.0 0.0 0.0 160-164 0.0 0.0 0.0 0.0 0.0 165-169 0.0 0.0 0.0 0.0 0.0 170-174 0.0 0.0 0.0 0.0 0.0 175-179 0.0 0.0 0.0 0.0 0.0 180-184 0.0 0.0 0.0 0.0 0.0 185-189 0.0 0.0 0.0 0.0 0.0 190-194 0.0 0.0 0.0 0.0 0.0 195-199 0.0 0.0 0.0 0.0 0.0 200-204 0.0 0.0 0.0 0.0 0.0 205-209 0.0 0.0 0.0 0.0 0.0 210-214 0.0 0.0 0.0 0.0 0.0 215-219 0.0 0.0 0.0 0.0 0.0 220-224 0.0 0.0 0.0 0.0 0.0 225-228 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCATTC 5 0.001950822 1774.5 150-153 GGGCATT 5 0.001950822 1774.5 150-153 GGGGCAT 5 0.001950822 1774.5 150-153 GCATTCG 5 0.001950822 1774.5 150-153 TCTCGTA 5 0.004876139 1183.0 145-149 CTCGTAT 5 0.004876139 1183.0 145-149 GTATCAC 10 0.001806851 221.8125 130-134 >>END_MODULE Read 302641 spots for ERR1806578.sra Written 302641 spots for ERR1806578.sra Read 302641 spots for ERR1806578.sra Written 302641 spots for ERR1806578.sra Read 302641 spots for ERR1806578.sra Written 302641 spots for ERR1806578.sra Read 302641 spots for ERR1806578.sra Written 302641 spots for ERR1806578.sra Read 302641 spots for ERR1806578.sra Written 302641 spots for ERR1806578.sra Read 302641 spots for ERR1806578.sra Written 302641 spots for ERR1806578.sra Read 302641 spots for ERR1806578.sra Written 302641 spots for ERR1806578.sra Read 302641 spots for ERR1806578.sra Written 302641 spots for ERR1806578.sra Read 302641 spots for ERR1806578.sra Written 302641 spots for ERR1806578.sra Read 302641 spots for ERR1806578.sra Written 302641 spots for ERR1806578.sra Read 302641 spots for ERR1806578.sra Written 302641 spots for ERR1806578.sra Read 302641 spots for ERR1806578.sra Written 302641 spots for ERR1806578.sra Read 302641 spots for ERR1806578.sra Written 302641 spots for ERR1806578.sra Read 302656 spots for ERR1806578.sra Written 302656 spots for ERR1806578.sra Read 302641 spots for ERR1806578.sra Written 302641 spots for ERR1806578.sra Read 302641 spots for ERR1806578.sra Written 302641 spots for ERR1806578.sra Read 302641 spots for ERR1806578.sra Written 302641 spots for ERR1806578.sra Read 302641 spots for ERR1806578.sra Written 302641 spots for ERR1806578.sra Read 302641 spots for ERR1806578.sra Written 302641 spots for ERR1806578.sra Read 302641 spots for ERR1806578.sra Written 302641 spots for ERR1806578.sra SRR ids: ['ERR1806578.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z4wagyt6 ERR1806578.sra spots: 6052835 blocks: [[1, 302641], [302642, 605282], [605283, 907923], [907924, 1210564], [1210565, 1513205], [1513206, 1815846], [1815847, 2118487], [2118488, 2421128], [2421129, 2723769], [2723770, 3026410], [3026411, 3329051], [3329052, 3631692], [3631693, 3934333], [3934334, 4236974], [4236975, 4539615], [4539616, 4842256], [4842257, 5144897], [5144898, 5447538], [5447539, 5750179], [5750180, 6052835]] ERR1806578 file size 1373069 ERR1806578 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1806578 ERR1806578_1.fastq Input file: ERR1806578_1.fastq trimmed: ERR1806578-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 17:05:09 2024 >> started Mon Dec 9 17:05:13 2024 >> done (3.323s) 6052835 reads processed; of these: 230907 ( 3.81%) short reads filtered out after trimming by size control 60 ( 0.00%) empty reads filtered out after trimming by size control 5821868 (96.18%) reads available; of these: 99633 ( 1.71%) trimmed reads available after processing 5722235 (98.29%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 15334 0.26% 19 14689 0.25% 20 13683 0.24% 21 13330 0.23% 22 13003 0.22% 23 12774 0.22% 24 13733 0.24% 25 12678 0.22% 26 12728 0.22% 27 12947 0.22% 28 12611 0.22% 29 12784 0.22% 30 13497 0.23% 31 13435 0.23% 32 13212 0.23% 33 13922 0.24% 34 13851 0.24% 35 13775 0.24% 36 14297 0.25% 37 14026 0.24% 38 14377 0.25% 39 15485 0.27% 40 14902 0.26% 41 15293 0.26% 42 17013 0.29% 43 16402 0.28% 44 16763 0.29% 45 18048 0.31% 46 18147 0.31% 47 18190 0.31% 48 19746 0.34% 49 20043 0.34% 50 20419 0.35% 51 21952 0.38% 52 22326 0.38% 53 23111 0.40% 54 24985 0.43% 55 25744 0.44% 56 26381 0.45% 57 28744 0.49% 58 29275 0.50% 59 30776 0.53% 60 34327 0.59% 61 34656 0.60% 62 35256 0.61% 63 39560 0.68% 64 39279 0.67% 65 40263 0.69% 66 42913 0.74% 67 43494 0.75% 68 46055 0.79% 69 49185 0.84% 70 50591 0.87% 71 51307 0.88% 72 56133 0.96% 73 54270 0.93% 74 57087 0.98% 75 59881 1.03% 76 61923 1.06% 77 71212 1.22% 78 72584 1.25% 79 64951 1.12% 80 65013 1.12% 81 68031 1.17% 82 73025 1.25% 83 70792 1.22% 84 71171 1.22% 85 71318 1.23% 86 70073 1.20% 87 72496 1.25% 88 72396 1.24% 89 72692 1.25% 90 75948 1.30% 91 72424 1.24% 92 72394 1.24% 93 78021 1.34% 94 72231 1.24% 95 72018 1.24% 96 73467 1.26% 97 69996 1.20% 98 70707 1.21% 99 71397 1.23% 100 69975 1.20% 101 69805 1.20% 102 68540 1.18% 103 71961 1.24% 104 66095 1.14% 105 64872 1.11% 106 62243 1.07% 107 62070 1.07% 108 61719 1.06% 109 61854 1.06% 110 59308 1.02% 111 59167 1.02% 112 58061 1.00% 113 55030 0.95% 114 55518 0.95% 115 53921 0.93% 116 51944 0.89% 117 51447 0.88% 118 49260 0.85% 119 48042 0.83% 120 47391 0.81% 121 45642 0.78% 122 44048 0.76% 123 43003 0.74% 124 41800 0.72% 125 41109 0.71% 126 40637 0.70% 127 38576 0.66% 128 37741 0.65% 129 36811 0.63% 130 35707 0.61% 131 33819 0.58% 132 34068 0.59% 133 32566 0.56% 134 31818 0.55% 135 30711 0.53% 136 29034 0.50% 137 28467 0.49% 138 28685 0.49% 139 26932 0.46% 140 26259 0.45% 141 24804 0.43% 142 23781 0.41% 143 23039 0.40% 144 22881 0.39% 145 21741 0.37% 146 21246 0.36% 147 21264 0.37% 148 20004 0.34% 149 18886 0.32% 150 18850 0.32% 151 18137 0.31% 152 17291 0.30% 153 17182 0.30% 154 16281 0.28% 155 16485 0.28% 156 15289 0.26% 157 14950 0.26% 158 14164 0.24% 159 13508 0.23% 160 13306 0.23% 161 12633 0.22% 162 12496 0.21% 163 12004 0.21% 164 11641 0.20% 165 11323 0.19% 166 10817 0.19% 167 10592 0.18% 168 10255 0.18% 169 9641 0.17% 170 9364 0.16% 171 9119 0.16% 172 8778 0.15% 173 8255 0.14% 174 7970 0.14% 175 7607 0.13% 176 7540 0.13% 177 7251 0.12% 178 7044 0.12% 179 6636 0.11% 180 6505 0.11% 181 6112 0.10% 182 6058 0.10% 183 5760 0.10% 184 5586 0.10% 185 5150 0.09% 186 5204 0.09% 187 4841 0.08% 188 4773 0.08% 189 4454 0.08% 190 4397 0.08% 191 4158 0.07% 192 3975 0.07% 193 3848 0.07% 194 3690 0.06% 195 3722 0.06% 196 3422 0.06% 197 3183 0.05% 198 3094 0.05% 199 2995 0.05% 200 2837 0.05% 201 2791 0.05% 202 2581 0.04% 203 2551 0.04% 204 2440 0.04% 205 2293 0.04% 206 2148 0.04% 207 2057 0.04% 208 1989 0.03% 209 1944 0.03% 210 1823 0.03% 211 1620 0.03% 212 1599 0.03% 213 1512 0.03% 214 1527 0.03% 215 1307 0.02% 216 1374 0.02% 217 1254 0.02% 218 1159 0.02% 219 1108 0.02% 220 1028 0.02% 221 966 0.02% 222 938 0.02% 223 844 0.01% 224 807 0.01% 225 791 0.01% 226 731 0.01% 227 667 0.01% 228 600 0.01% 229 529 0.01% 230 581 0.01% 231 495 0.01% 232 489 0.01% 233 404 0.01% 234 397 0.01% 235 395 0.01% 236 316 0.01% 237 304 0.01% 238 303 0.01% 239 262 0.00% 240 244 0.00% 241 198 0.00% 242 181 0.00% 243 181 0.00% 244 158 0.00% 245 168 0.00% 246 137 0.00% 247 134 0.00% 248 100 0.00% 249 101 0.00% 250 96 0.00% 251 87 0.00% 252 78 0.00% 253 81 0.00% 254 63 0.00% 255 60 0.00% 256 46 0.00% 257 39 0.00% 258 32 0.00% 259 34 0.00% 260 43 0.00% 261 29 0.00% 262 23 0.00% 263 27 0.00% 264 22 0.00% 265 14 0.00% 266 17 0.00% 267 15 0.00% 268 12 0.00% 269 14 0.00% 270 12 0.00% 271 8 0.00% 272 8 0.00% 273 8 0.00% 274 4 0.00% 275 3 0.00% 276 3 0.00% 277 5 0.00% 278 2 0.00% 279 2 0.00% 280 1 0.00% 281 2 0.00% 282 2 0.00% 283 0 0.00% 284 1 0.00% 285 1 0.00% 286 1 0.00% 287 1 0.00% 288 1 0.00% 289 0 0.00% 290 0 0.00% 291 0 0.00% 292 0 0.00% 293 1 0.00% 294 0 0.00% 295 0 0.00% 296 0 0.00% 297 0 0.00% 298 0 0.00% 299 0 0.00% 300 0 0.00% 301 0 0.00% 302 0 0.00% 303 0 0.00% 304 0 0.00% 305 0 0.00% 306 0 0.00% 307 0 0.00% 308 0 0.00% 309 0 0.00% 310 0 0.00% 311 0 0.00% 312 0 0.00% 313 0 0.00% 314 0 0.00% 315 0 0.00% 316 0 0.00% 317 0 0.00% 318 0 0.00% 319 0 0.00% 320 0 0.00% 321 0 0.00% 322 0 0.00% 323 0 0.00% 324 0 0.00% 325 0 0.00% 326 1 0.00% 5821868 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=5.17 fanout-score-rank=24 prefix-density=0.29 prefix-fanout=4.1 sequence=GGCAAGACCATCACCCTTGAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=51.22 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.8 sequence=AGCAGCAGAGAGCCGGAGCGCCACCAGCCATCCGATCAAAACACACAGATCAATCCGATGGCTCTCGCTCTCTCCGGTTCCTCGGCTGCTGCCCGCGCGCTGGCCCAGCTGCTGGCCCCGTCCACCAGAAG Started job on | Dec 09 17:05:32 Started mapping on | Dec 09 17:05:33 Finished on | Dec 09 17:05:44 Mapping speed, Million of reads per hour | 1905.34 Number of input reads | 5821868 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 4623249 Uniquely mapped reads % | 79.41% Average mapped length | 92.87 Number of splices: Total | 1393533 Number of splices: Annotated (sjdb) | 1309559 Number of splices: GT/AG | 1363858 Number of splices: GC/AG | 15020 Number of splices: AT/AC | 1145 Number of splices: Non-canonical | 13510 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.15% Deletion average length | 1.10 Insertion rate per base | 0.14% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 149799 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 78872 % of reads mapped to too many loci | 1.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 16.37% % of reads unmapped: other | 0.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1048820 1048820 1048820 N_multimapping 149799 149799 149799 N_noFeature 125012 164701 4522733 N_ambiguous 70005 9767 442 UnstrandedReadsAssigned:4428232 PositiveStrandReadsAssigned:4448781 NegativeStrandReadsAssigned:100074 Dataset is classified positive stranded MeadianReadLen=96 20thPercentileLength=70 echo kmer=65 ERR1806578 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR1806578-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,821,868 reads, 4,635,353 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,025 rounds 52973 ERR1806578.ke.tsv 35125 ERR1806578.se.tsv 88098 total ==> ERR1806578.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 40.439 15.5977 PNS24247 1044 945 14.5833 4.98206 PNS24249 1928 1829 45.7843 8.08141 PNS24246 1044 945 14.5833 4.98206 PNS24248 1044 945 14.5833 4.98206 PNS24244 1471 1372 44.0266 10.3597 PNS24243 293 194 0 0 KQK14069 1603 1504 1271.87 273.01 KQK14071 474 375 58.4556 50.3244 ==> ERR1806578.se.tsv <== BRADI_1g14170v3 1383 BRADI_1g53295v3 35 BRADI_1g59795v3 57 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 514 BRADI_1g74790v3 67 BRADI_1g09890v3 0 BRADI_1g77505v3 107 BRADI_1g48960v3 1 ERR1806578 completed mapping pipeline successfully