Starting /dee2/code/volunteer_pipeline.sh ERR1806579 current disk space = 1523715981312 free memory = 1583360424 ERR1806579 SRAfilesize ab112fa81e2f4be2a5d7f22f600a6dd7 ERR1806579.sra ERR1806579.sra file validated ERR1806579 is single end ERR1806579 is conventional basespace ERR1806579 read1 length is 8-244 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1806579_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 8-244 %GC 51 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.76875 25.0 21.0 27.0 18.0 28.0 2 23.643 25.0 21.0 27.0 16.0 28.0 3 23.2805 25.0 20.0 27.0 16.0 28.0 4 23.4495 25.0 21.0 27.0 16.0 28.0 5 23.25175 25.0 20.0 27.0 16.0 28.0 6 23.32875 25.0 20.0 27.0 16.0 28.0 7 23.228 25.0 20.0 27.0 16.0 28.0 8 23.16675 25.0 20.0 27.0 15.0 28.0 9 23.274937343358395 25.0 20.0 27.0 16.0 28.0 10-14 23.371324208438214 25.0 20.8 27.0 16.0 28.0 15-19 23.59126723022838 25.0 21.0 27.0 17.0 28.0 20-24 23.789133445728783 25.0 21.0 27.0 18.0 28.0 25-29 23.886546060590046 25.0 21.0 27.0 18.0 28.0 30-34 23.81542245232235 25.0 21.0 27.0 18.0 28.0 35-39 23.82581629615524 25.0 21.0 27.0 18.0 28.0 40-44 23.89325015673415 25.0 21.2 27.0 18.0 28.0 45-49 23.863118458863127 25.0 21.0 27.0 18.0 28.0 50-54 23.906421756268095 25.0 21.0 27.0 18.0 28.0 55-59 23.874847418981894 25.0 21.0 27.0 18.0 28.0 60-64 23.873494100088116 25.0 21.2 27.0 18.0 28.0 65-69 23.897232477728842 25.2 21.0 27.0 18.0 28.0 70-74 23.91692782080827 25.0 21.2 27.0 18.0 28.0 75-79 23.78530743675797 25.0 21.2 27.0 18.0 28.0 80-84 23.727639237611495 25.0 21.0 27.0 18.2 27.8 85-89 23.740015428400852 25.0 21.0 27.0 17.8 28.0 90-94 23.62577467089311 25.0 21.0 26.6 18.0 27.6 95-99 23.50233573209926 25.0 21.0 26.2 17.4 27.0 100-104 23.394179359054604 25.0 20.6 26.2 17.2 27.0 105-109 23.462648520022313 25.0 21.0 26.2 17.2 27.2 110-114 23.321418110468535 24.8 20.8 26.0 17.8 27.0 115-119 23.159139500557927 24.4 20.4 26.0 16.8 27.0 120-124 23.413601961048066 25.0 20.4 26.0 17.8 27.2 125-129 23.150416368771385 24.0 20.0 26.0 17.4 27.0 130-134 22.835046330029435 24.2 20.2 26.0 16.0 27.2 135-139 22.258494128060608 23.4 19.2 25.8 14.8 27.0 140-144 22.150652509374304 22.8 19.8 25.8 15.8 26.8 145-149 22.486629568989805 23.2 19.8 26.0 15.0 27.0 150-154 21.989614159724333 23.0 19.333333333333332 25.666666666666668 14.0 27.0 155-159 22.410770108059143 NaN NaN NaN NaN NaN 160-164 22.11156780201556 NaN NaN NaN NaN NaN 165-169 22.11445894919813 NaN NaN NaN NaN NaN 170-174 21.661625229985376 NaN NaN NaN NaN NaN 175-179 21.235294117647058 NaN NaN NaN NaN NaN 180-184 20.896342431761788 NaN NaN NaN NaN NaN 185-189 21.556374741200823 NaN NaN NaN NaN NaN 190-194 21.03099415204678 NaN NaN NaN NaN NaN 195-199 21.614297385620915 NaN NaN NaN NaN NaN 200-204 20.60571428571429 NaN NaN NaN NaN NaN 205-209 20.971794871794874 NaN NaN NaN NaN NaN 210-214 18.686868686868685 NaN NaN NaN NaN NaN 215-219 17.957142857142856 NaN NaN NaN NaN NaN 220-224 17.6 NaN NaN NaN NaN NaN 225-229 20.01666666666667 NaN NaN NaN NaN NaN 230-234 19.933333333333334 NaN NaN NaN NaN NaN 235-239 18.533333333333335 NaN NaN NaN NaN NaN 240-244 17.6 NaN NaN NaN NaN NaN >>END_MODULE >>Per sequence quality scores warn #Quality Count 10 1.0 11 10.0 12 12.0 13 19.0 14 20.0 15 45.0 16 74.0 17 123.0 18 123.0 19 102.0 20 135.0 21 238.0 22 316.0 23 509.0 24 901.0 25 1076.0 26 277.0 27 18.0 28 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.099999999999998 42.975 18.625 14.299999999999999 2 39.800000000000004 36.075 6.800000000000001 17.325 3 31.025000000000002 30.95 19.825 18.2 4 36.95 26.85 15.950000000000001 20.25 5 28.275 28.449999999999996 16.825000000000003 26.450000000000003 6 26.25 26.8 22.0 24.95 7 24.775 27.900000000000002 24.6 22.725 8 24.099999999999998 27.725 22.8 25.374999999999996 9 25.03759398496241 22.882205513784463 23.834586466165415 28.24561403508772 10-14 26.755343453317764 24.83119256739605 24.00873229425801 24.404731685028178 15-19 28.704905268621854 24.339475733194913 22.79781988061251 24.157799117570725 20-24 27.470775770456964 24.415515409139214 22.82146652497343 25.292242295430395 25-29 26.933115823817293 24.937466014138117 23.48558999456226 24.643828167482326 30-34 27.13584653134062 24.82154807048851 22.61320544278385 25.429399955387016 35-39 27.069015304649145 24.088940225238233 23.95033208200982 24.891712388102803 40-44 26.962332928311056 24.890643985419196 23.02551640340219 25.121506682867555 45-49 26.921576277799453 24.365977370269214 24.385485758876317 24.326960593055013 50-54 27.061490507225844 24.41909889487107 23.682346273731937 24.837064324171156 55-59 26.53917910447761 24.51026119402985 23.96610696517413 24.984452736318406 60-64 26.810961773433412 24.210158840984462 24.297434107174027 24.6814452784081 65-69 27.082304120146233 24.938247208773838 23.15976682146033 24.819681849619602 70-74 27.072450601862368 24.142630024982967 24.96025437201908 23.82466500113559 75-79 26.46673651126244 24.685699319015193 24.279727606076477 24.567836563645887 80-84 25.92880460127468 24.70076169749728 24.047878128400434 25.32255557282761 85-89 26.87175685693106 25.3891771682728 24.054855448480357 23.684210526315788 90-94 25.615870939611945 24.416830172225858 25.15805537388271 24.809243514279487 95-99 25.05891594658288 23.98533647551715 25.006546216286985 25.94920136161299 100-104 26.145216578373326 24.74291056403864 24.368962293549394 24.74291056403864 105-109 26.146960089518835 24.43118239462887 24.61767997016039 24.804177545691903 110-114 26.974865350089765 23.47396768402154 24.461400359066428 25.089766606822263 115-119 25.40210759844703 25.45757071547421 24.73655019412091 24.403771491957848 120-124 26.797385620915033 23.79084967320261 23.660130718954246 25.751633986928102 125-129 26.218097447795824 23.047177107501934 25.52204176334107 25.212683681361174 130-134 22.05607476635514 25.04672897196262 26.448598130841123 26.448598130841123 135-139 27.50845546786922 24.126268320180383 24.91544532130778 23.449830890642616 140-144 24.90118577075099 23.847167325428195 27.536231884057973 23.715415019762844 145-149 26.978998384491113 23.909531502423263 24.878836833602584 24.232633279483036 150-154 26.693227091633464 24.701195219123505 24.900398406374503 23.705179282868528 155-159 24.739583333333336 21.614583333333336 25.0 28.645833333333332 160-164 24.316109422492403 24.924012158054712 23.404255319148938 27.35562310030395 165-169 24.418604651162788 21.31782945736434 23.643410852713178 30.620155038759687 170-174 27.230046948356808 25.352112676056336 22.065727699530516 25.352112676056336 175-179 26.55367231638418 25.423728813559322 25.423728813559322 22.598870056497177 180-184 24.113475177304963 24.822695035460992 24.113475177304963 26.95035460992908 185-189 25.64102564102564 30.76923076923077 22.22222222222222 21.367521367521366 190-194 23.0 23.0 27.0 27.0 195-199 25.882352941176475 23.52941176470588 23.52941176470588 27.058823529411764 200-204 27.77777777777778 25.0 27.77777777777778 19.444444444444446 205-209 22.58064516129032 32.25806451612903 19.35483870967742 25.806451612903224 210-214 26.41509433962264 24.528301886792452 20.754716981132077 28.30188679245283 215-219 17.94871794871795 25.64102564102564 23.076923076923077 33.33333333333333 220-224 33.33333333333333 23.333333333333332 23.333333333333332 20.0 225-229 18.75 25.0 37.5 18.75 230-234 13.333333333333334 26.666666666666668 33.33333333333333 26.666666666666668 235-239 44.44444444444444 0.0 55.55555555555556 0.0 240-244 40.0 0.0 40.0 20.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 1.0 9 1.0 10 1.0 11 1.0 12 1.0 13 1.0 14 1.5 15 2.5 16 3.5 17 3.5 18 3.0 19 4.0 20 5.0 21 6.0 22 7.0 23 9.5 24 12.5 25 14.5 26 16.0 27 16.5 28 19.5 29 25.0 30 29.0 31 33.0 32 40.0 33 51.0 34 63.5 35 69.0 36 77.5 37 91.33333333333333 38 112.33333333333333 39 144.5 40 172.33333333333334 41 199.83333333333331 42 224.16666666666666 43 240.0 44 251.83333333333334 45 253.50000000000003 46 263.83333333333337 47 276.83333333333337 48 290.5 49 283.33333333333337 50 276.83333333333337 51 281.83333333333337 52 260.5 53 260.6666666666667 54 271.1666666666667 55 266.83333333333337 56 248.0 57 228.5 58 209.33333333333331 59 194.0 60 192.0 61 187.33333333333334 62 181.5 63 170.5 64 155.0 65 141.5 66 137.5 67 144.5 68 135.0 69 109.5 70 85.0 71 76.0 72 74.5 73 61.5 74 46.5 75 30.0 76 21.5 77 21.0 78 18.0 79 14.0 80 11.5 81 11.5 82 10.5 83 7.5 84 5.5 85 5.5 86 6.0 87 5.5 88 3.5 89 1.5 90 1.0 91 1.0 92 1.0 93 1.0 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-159 0.0 160-164 0.0 165-169 0.0 170-174 0.0 175-179 0.0 180-184 0.0 185-189 0.0 190-194 0.0 195-199 0.0 200-204 0.0 205-209 0.0 210-214 0.0 215-219 0.0 220-224 0.0 225-229 0.0 230-234 0.0 235-239 0.0 240-244 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 5-9 23.0 10-14 88.0 15-19 84.0 20-24 89.0 25-29 83.0 30-34 117.0 35-39 154.0 40-44 195.0 45-49 242.0 50-54 256.0 55-59 259.0 60-64 289.0 65-69 245.0 70-74 252.0 75-79 251.0 80-84 222.0 85-89 169.0 90-94 167.0 95-99 131.0 100-104 111.0 105-109 90.0 110-114 93.0 115-119 63.0 120-124 49.0 125-129 48.0 130-134 36.0 135-139 34.0 140-144 24.0 145-149 27.0 150-154 27.0 155-159 10.0 160-164 18.0 165-169 7.0 170-174 10.0 175-179 6.0 180-184 6.0 185-189 4.0 190-194 3.0 195-199 3.0 200-204 2.0 205-209 1.0 210-214 4.0 215-219 2.0 220-224 2.0 225-229 1.0 230-234 0.0 235-239 2.0 240-244 1.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.475 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11144960649911 97.6 2 0.6854531607006854 1.35 3 0.07616146230007616 0.22499999999999998 4 0.05077430820005078 0.2 5 0.05077430820005078 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02538715410002539 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACTCCAAGATCATCAACGACAGGGAGACTGGCCGTTCCCGCGGGTTCGGC 15 0.375 No Hit ATGGGGGCCGGCGATGCGTCCTGGCCGTATGCGGAACGGCTTTTGCTGGT 5 0.125 No Hit GCGGATTGCTCGAGCTGCTCACGCGGCGAGAGCGGGTCGCCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.0 0.0 0.0 0.0 0.0 80-84 0.0 0.0 0.0 0.0 0.0 85-89 0.0 0.0 0.0 0.0 0.0 90-94 0.0 0.0 0.0 0.0 0.0 95-99 0.0 0.0 0.0 0.0 0.0 100-104 0.0 0.0 0.0 0.0 0.0 105-109 0.0 0.0 0.0 0.0 0.0 110-114 0.0 0.0 0.0 0.0 0.0 115-119 0.0 0.0 0.0 0.0 0.0 120-124 0.0 0.0 0.0 0.0 0.0 125-129 0.0 0.0 0.0 0.0 0.0 130-134 0.0 0.0 0.0 0.0 0.0 135-139 0.0 0.0 0.0 0.0 0.0 140-144 0.0 0.0 0.0 0.0 0.0 145-149 0.0 0.0 0.0 0.0 0.0 150-154 0.0 0.0 0.0 0.0 0.0 155-159 0.0 0.0 0.0 0.0 0.0 160-164 0.0 0.0 0.0 0.0 0.0 165-169 0.0 0.0 0.0 0.0 0.0 170-174 0.0 0.0 0.0 0.0 0.0 175-179 0.0 0.0 0.0 0.0 0.0 180-184 0.0 0.0 0.0 0.0 0.0 185-189 0.0 0.0 0.0 0.0 0.0 190-194 0.0 0.0 0.0 0.0 0.0 195-199 0.0 0.0 0.0 0.0 0.0 200-204 0.0 0.0 0.0 0.0 0.0 205-209 0.0 0.0 0.0 0.0 0.0 210-214 0.0 0.0 0.0 0.0 0.0 215-219 0.0 0.0 0.0 0.0 0.0 220-224 0.0 0.0 0.0 0.0 0.0 225-229 0.0 0.0 0.0 0.0 0.0 230-232 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCTTGC 10 0.0 2599.5 150 TGCGAAG 10 0.0024246012 1299.75 135-139 TCATTCC 5 0.003635969 1299.75 115-119 AAGAGCT 5 0.006059171 1039.8 145-149 GAGCTTG 5 0.006059171 1039.8 145-149 GAAGAAA 5 0.006059171 1039.8 140-144 AGAGCTT 5 0.006059171 1039.8 145-149 AGAAAGA 5 0.006059171 1039.8 140-144 TGAAGAA 5 0.006059171 1039.8 140-144 AAGAAAG 5 0.006059171 1039.8 140-144 AAAGAGC 5 0.006059171 1039.8 145-149 GAAAGAG 5 0.006059171 1039.8 145-149 CGACAGC 15 0.005455352 866.50006 125-129 AGGGGTT 5 0.009087591 866.49994 135-139 GTTGAAG 5 0.009087591 866.49994 135-139 GGTTGAA 5 0.009087591 866.49994 135-139 GGGTTGA 5 0.009087591 866.49994 135-139 GGGGTTG 5 0.009087591 866.49994 135-139 >>END_MODULE Read 163404 spots for ERR1806579.sra Written 163404 spots for ERR1806579.sra Read 163404 spots for ERR1806579.sra Written 163404 spots for ERR1806579.sra Read 163404 spots for ERR1806579.sra Written 163404 spots for ERR1806579.sra Read 163404 spots for ERR1806579.sra Written 163404 spots for ERR1806579.sra Read 163404 spots for ERR1806579.sra Written 163404 spots for ERR1806579.sra Read 163404 spots for ERR1806579.sra Written 163404 spots for ERR1806579.sra Read 163404 spots for ERR1806579.sra Written 163404 spots for ERR1806579.sra Read 163404 spots for ERR1806579.sra Written 163404 spots for ERR1806579.sra Read 163404 spots for ERR1806579.sra Written 163404 spots for ERR1806579.sra Read 163404 spots for ERR1806579.sra Written 163404 spots for ERR1806579.sra Read 163404 spots for ERR1806579.sra Written 163404 spots for ERR1806579.sra Read 163404 spots for ERR1806579.sra Written 163404 spots for ERR1806579.sra Read 163404 spots for ERR1806579.sra Written 163404 spots for ERR1806579.sra Read 163404 spots for ERR1806579.sra Written 163404 spots for ERR1806579.sra Read 163404 spots for ERR1806579.sra Written 163404 spots for ERR1806579.sra Read 163408 spots for ERR1806579.sra Written 163408 spots for ERR1806579.sra Read 163404 spots for ERR1806579.sra Written 163404 spots for ERR1806579.sra Read 163404 spots for ERR1806579.sra Written 163404 spots for ERR1806579.sra Read 163404 spots for ERR1806579.sra Written 163404 spots for ERR1806579.sra Read 163404 spots for ERR1806579.sra Written 163404 spots for ERR1806579.sra SRR ids: ['ERR1806579.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5gyofs_7 ERR1806579.sra spots: 3268084 blocks: [[1, 163404], [163405, 326808], [326809, 490212], [490213, 653616], [653617, 817020], [817021, 980424], [980425, 1143828], [1143829, 1307232], [1307233, 1470636], [1470637, 1634040], [1634041, 1797444], [1797445, 1960848], [1960849, 2124252], [2124253, 2287656], [2287657, 2451060], [2451061, 2614464], [2614465, 2777868], [2777869, 2941272], [2941273, 3104676], [3104677, 3268084]] ERR1806579 file size 579541 ERR1806579 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1806579 ERR1806579_1.fastq Input file: ERR1806579_1.fastq trimmed: ERR1806579-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 17:05:02 2024 >> started Mon Dec 9 17:05:04 2024 >> done (2.031s) 3268084 reads processed; of these: 153316 ( 4.69%) short reads filtered out after trimming by size control 21 ( 0.00%) empty reads filtered out after trimming by size control 3114747 (95.31%) reads available; of these: 44023 ( 1.41%) trimmed reads available after processing 3070724 (98.59%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 11735 0.38% 19 11477 0.37% 20 11346 0.36% 21 11701 0.38% 22 11695 0.38% 23 12001 0.39% 24 13456 0.43% 25 13180 0.42% 26 13859 0.44% 27 14749 0.47% 28 15684 0.50% 29 15638 0.50% 30 17746 0.57% 31 17635 0.57% 32 18584 0.60% 33 20702 0.66% 34 21460 0.69% 35 21428 0.69% 36 23402 0.75% 37 23277 0.75% 38 24776 0.80% 39 29630 0.95% 40 27958 0.90% 41 28543 0.92% 42 37752 1.21% 43 31826 1.02% 44 32689 1.05% 45 37052 1.19% 46 35888 1.15% 47 36435 1.17% 48 39187 1.26% 49 39282 1.26% 50 39747 1.28% 51 42760 1.37% 52 42590 1.37% 53 42213 1.36% 54 44927 1.44% 55 44660 1.43% 56 44536 1.43% 57 46456 1.49% 58 45618 1.46% 59 47155 1.51% 60 50080 1.61% 61 48199 1.55% 62 46802 1.50% 63 48902 1.57% 64 46231 1.48% 65 44853 1.44% 66 44375 1.42% 67 44303 1.42% 68 43692 1.40% 69 44347 1.42% 70 43841 1.41% 71 42377 1.36% 72 43288 1.39% 73 40016 1.28% 74 40476 1.30% 75 39682 1.27% 76 39021 1.25% 77 41214 1.32% 78 40427 1.30% 79 36134 1.16% 80 34370 1.10% 81 33888 1.09% 82 35397 1.14% 83 33627 1.08% 84 31959 1.03% 85 30523 0.98% 86 28669 0.92% 87 28540 0.92% 88 27735 0.89% 89 26789 0.86% 90 27976 0.90% 91 24807 0.80% 92 24541 0.79% 93 25332 0.81% 94 22934 0.74% 95 22025 0.71% 96 22153 0.71% 97 20656 0.66% 98 20014 0.64% 99 19711 0.63% 100 19299 0.62% 101 18720 0.60% 102 17726 0.57% 103 17867 0.57% 104 16848 0.54% 105 16249 0.52% 106 15184 0.49% 107 14976 0.48% 108 14421 0.46% 109 14389 0.46% 110 13160 0.42% 111 13489 0.43% 112 12825 0.41% 113 11834 0.38% 114 12345 0.40% 115 11478 0.37% 116 11007 0.35% 117 10550 0.34% 118 10137 0.33% 119 10068 0.32% 120 9772 0.31% 121 9162 0.29% 122 8673 0.28% 123 8390 0.27% 124 8209 0.26% 125 7955 0.26% 126 7745 0.25% 127 7319 0.23% 128 7108 0.23% 129 7023 0.23% 130 6665 0.21% 131 6415 0.21% 132 6217 0.20% 133 6019 0.19% 134 5857 0.19% 135 5614 0.18% 136 5374 0.17% 137 5070 0.16% 138 5004 0.16% 139 4881 0.16% 140 4875 0.16% 141 4496 0.14% 142 4193 0.13% 143 4043 0.13% 144 3991 0.13% 145 3797 0.12% 146 3730 0.12% 147 3690 0.12% 148 3370 0.11% 149 3250 0.10% 150 3234 0.10% 151 3087 0.10% 152 2993 0.10% 153 2937 0.09% 154 2800 0.09% 155 2633 0.08% 156 2681 0.09% 157 2446 0.08% 158 2375 0.08% 159 2335 0.07% 160 2244 0.07% 161 2129 0.07% 162 2172 0.07% 163 2023 0.06% 164 1946 0.06% 165 1869 0.06% 166 1787 0.06% 167 1688 0.05% 168 1643 0.05% 169 1611 0.05% 170 1503 0.05% 171 1483 0.05% 172 1391 0.04% 173 1328 0.04% 174 1321 0.04% 175 1245 0.04% 176 1244 0.04% 177 1170 0.04% 178 1103 0.04% 179 1025 0.03% 180 1024 0.03% 181 966 0.03% 182 948 0.03% 183 889 0.03% 184 893 0.03% 185 837 0.03% 186 823 0.03% 187 806 0.03% 188 733 0.02% 189 708 0.02% 190 644 0.02% 191 658 0.02% 192 654 0.02% 193 610 0.02% 194 608 0.02% 195 559 0.02% 196 546 0.02% 197 510 0.02% 198 490 0.02% 199 455 0.01% 200 463 0.01% 201 435 0.01% 202 428 0.01% 203 374 0.01% 204 385 0.01% 205 367 0.01% 206 319 0.01% 207 320 0.01% 208 335 0.01% 209 294 0.01% 210 267 0.01% 211 269 0.01% 212 260 0.01% 213 245 0.01% 214 223 0.01% 215 204 0.01% 216 215 0.01% 217 197 0.01% 218 169 0.01% 219 177 0.01% 220 150 0.00% 221 147 0.00% 222 133 0.00% 223 127 0.00% 224 122 0.00% 225 122 0.00% 226 109 0.00% 227 88 0.00% 228 92 0.00% 229 86 0.00% 230 98 0.00% 231 78 0.00% 232 67 0.00% 233 61 0.00% 234 66 0.00% 235 49 0.00% 236 39 0.00% 237 45 0.00% 238 49 0.00% 239 40 0.00% 240 43 0.00% 241 35 0.00% 242 27 0.00% 243 32 0.00% 244 32 0.00% 245 23 0.00% 246 22 0.00% 247 16 0.00% 248 24 0.00% 249 13 0.00% 250 13 0.00% 251 9 0.00% 252 12 0.00% 253 9 0.00% 254 13 0.00% 255 9 0.00% 256 13 0.00% 257 10 0.00% 258 6 0.00% 259 6 0.00% 260 4 0.00% 261 0 0.00% 262 3 0.00% 263 4 0.00% 264 5 0.00% 265 5 0.00% 266 2 0.00% 267 1 0.00% 268 3 0.00% 269 0 0.00% 270 1 0.00% 271 2 0.00% 272 0 0.00% 273 1 0.00% 274 2 0.00% 275 1 0.00% 276 1 0.00% 277 1 0.00% 278 1 0.00% 279 0 0.00% 280 0 0.00% 281 1 0.00% 282 0 0.00% 283 0 0.00% 284 0 0.00% 285 0 0.00% 286 0 0.00% 287 0 0.00% 288 0 0.00% 289 0 0.00% 290 0 0.00% 291 0 0.00% 292 0 0.00% 293 0 0.00% 294 0 0.00% 295 0 0.00% 296 0 0.00% 297 0 0.00% 298 0 0.00% 299 0 0.00% 300 0 0.00% 301 0 0.00% 302 0 0.00% 303 0 0.00% 304 0 0.00% 305 0 0.00% 306 0 0.00% 307 0 0.00% 308 0 0.00% 309 0 0.00% 310 1 0.00% 3114747 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=40 prefix-density=0.00 prefix-fanout=1.0 sequence=GCGGATTGCTCGAGCTGCTCACGCGGCGAGAGCGGGTCGCCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=234.16 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=15.1 sequence=GCAGCAGCAGAGAGCCGGAGCGCCACCAGCCATCCGATCAAAACACACAGATCAATCCGATGGCTCTCGCTCTCTCCGGTTCCTCGGCTGCTGCCCGCGCGCTGGCCCAGCTGCTGGCCCCGTCCACCA Started job on | Dec 09 17:05:22 Started mapping on | Dec 09 17:05:22 Finished on | Dec 09 17:05:29 Mapping speed, Million of reads per hour | 1601.87 Number of input reads | 3114747 Average input read length | 72 UNIQUE READS: Uniquely mapped reads number | 2554230 Uniquely mapped reads % | 82.00% Average mapped length | 69.67 Number of splices: Total | 571466 Number of splices: Annotated (sjdb) | 537938 Number of splices: GT/AG | 560196 Number of splices: GC/AG | 6363 Number of splices: AT/AC | 447 Number of splices: Non-canonical | 4460 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.11% Deletion average length | 1.08 Insertion rate per base | 0.12% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 101782 % of reads mapped to multiple loci | 3.27% Number of reads mapped to too many loci | 92363 % of reads mapped to too many loci | 2.97% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.41% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 458735 458735 458735 N_multimapping 101782 101782 101782 N_noFeature 79687 101549 2500729 N_ambiguous 35895 4421 252 UnstrandedReadsAssigned:2438648 PositiveStrandReadsAssigned:2448260 NegativeStrandReadsAssigned:53249 Dataset is classified positive stranded MeadianReadLen=68 20thPercentileLength=47 echo kmer=43 ERR1806579 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR1806579-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,114,747 reads, 2,421,217 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 953 rounds 52973 ERR1806579.ke.tsv 35125 ERR1806579.se.tsv 88098 total ==> ERR1806579.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 33.8089 24.9571 PNS24247 1044 945 10.0944 6.59989 PNS24249 1928 1829 13.9615 4.71634 PNS24246 1044 945 10.0944 6.59989 PNS24248 1044 945 10.0944 6.59989 PNS24244 1471 1372 40.9465 18.4396 PNS24243 293 194 0 0 KQK14069 1603 1504 686.264 281.924 KQK14071 474 375 38.7709 63.8797 ==> ERR1806579.se.tsv <== BRADI_1g14170v3 752 BRADI_1g53295v3 24 BRADI_1g59795v3 30 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 266 BRADI_1g74790v3 29 BRADI_1g09890v3 0 BRADI_1g77505v3 44 BRADI_1g48960v3 0 ERR1806579 completed mapping pipeline successfully