Starting /dee2/code/volunteer_pipeline.sh ERR1806580 current disk space = 1523714277376 free memory = 1581795360 ERR1806580 SRAfilesize 7ead7024391678cafc65a664e00d927f ERR1806580.sra ERR1806580.sra file validated ERR1806580 is single end ERR1806580 is conventional basespace ERR1806580 read1 length is 8-253 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1806580_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 8-253 %GC 49 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.41225 25.0 22.0 27.0 20.0 28.0 2 24.05975 25.0 21.0 27.0 18.0 28.0 3 23.94875 25.0 21.0 27.0 18.0 28.0 4 24.05975 25.0 21.0 27.0 18.0 28.0 5 23.947 25.0 21.0 27.0 18.0 29.0 6 24.02075 25.0 21.0 27.0 18.0 29.0 7 23.874 25.0 21.0 27.0 17.0 29.0 8 23.7835 25.0 21.0 27.0 17.0 28.0 9 23.79264632316158 25.0 21.0 27.0 17.0 28.0 10-14 23.653656419117745 25.0 21.0 27.0 17.2 28.0 15-19 23.810153650895987 25.0 21.0 27.0 17.8 28.0 20-24 23.935690579307252 25.0 21.0 27.0 18.0 28.0 25-29 23.87872962438788 25.0 21.0 27.0 18.0 28.0 30-34 23.88759126676137 25.0 21.0 27.0 18.0 28.0 35-39 23.843506996253574 25.0 21.0 27.0 18.0 28.0 40-44 23.834015055345226 25.0 21.0 27.0 18.0 28.0 45-49 23.758819021069833 25.0 21.0 27.0 18.0 28.0 50-54 23.828677619553833 25.0 21.0 27.0 18.0 28.0 55-59 23.769404670555502 25.0 21.0 27.0 18.0 28.0 60-64 23.76149051534728 25.0 21.0 27.0 18.0 28.0 65-69 23.78221789726893 25.0 21.0 27.0 18.0 28.0 70-74 23.798962927153845 25.0 21.0 27.0 18.0 28.0 75-79 23.819511949758542 25.0 21.0 27.0 18.0 28.0 80-84 23.78440018416095 25.0 21.2 27.0 18.0 28.0 85-89 23.739374232827195 25.0 21.0 27.0 18.0 28.0 90-94 23.66172588775398 25.0 21.0 26.8 18.0 28.0 95-99 23.591431914139083 25.0 21.0 26.2 18.0 27.8 100-104 23.4733111924198 25.0 21.0 26.2 17.2 27.8 105-109 23.334851279538814 24.8 20.8 26.0 17.2 27.2 110-114 23.12792007864289 24.2 20.2 26.0 17.0 27.0 115-119 23.075246583482755 24.2 20.2 26.0 17.0 27.0 120-124 22.929914109962585 24.0 20.2 26.0 16.8 27.0 125-129 22.768143134691215 24.0 20.0 26.0 16.2 27.0 130-134 22.879307017657645 24.0 20.0 26.0 16.8 27.0 135-139 22.652578810738145 23.8 20.0 26.0 16.6 27.0 140-144 22.43515047352656 23.2 20.0 25.8 16.0 27.0 145-149 22.457319881102407 23.4 20.0 25.4 16.6 27.0 150-154 22.2340497377286 23.2 19.6 25.6 15.8 27.0 155-159 21.87969038705047 23.0 19.0 25.2 14.6 26.8 160-164 21.77442769014932 22.8 19.0 25.2 15.0 26.6 165-169 21.853319184713104 22.6 19.4 25.0 15.8 26.4 170-174 21.5139617996415 22.0 18.8 25.0 15.0 26.4 175-179 20.724297336072453 21.4 18.0 24.2 13.8 25.6 180-184 20.267871674721494 NaN NaN NaN NaN NaN 185-189 19.794444345984875 NaN NaN NaN NaN NaN 190-194 19.556788494616054 NaN NaN NaN NaN NaN 195-199 19.372142303593918 NaN NaN NaN NaN NaN 200-204 18.119618643005737 NaN NaN NaN NaN NaN 205-209 18.41042655658755 NaN NaN NaN NaN NaN 210-214 18.41238095238095 NaN NaN NaN NaN NaN 215-219 19.601666666666667 NaN NaN NaN NaN NaN 220-224 18.433333333333334 NaN NaN NaN NaN NaN 225-229 17.32 NaN NaN NaN NaN NaN 230-234 18.4 NaN NaN NaN NaN NaN 235-239 18.1 NaN NaN NaN NaN NaN 240-244 20.2 NaN NaN NaN NaN NaN 245-249 22.8 NaN NaN NaN NaN NaN 250-253 21.25 NaN NaN NaN NaN NaN >>END_MODULE >>Per sequence quality scores warn #Quality Count 11 2.0 12 7.0 13 3.0 14 13.0 15 11.0 16 39.0 17 78.0 18 101.0 19 142.0 20 161.0 21 215.0 22 320.0 23 581.0 24 995.0 25 1154.0 26 175.0 27 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.35 44.525 20.3 12.825000000000001 2 42.875 33.775 6.65 16.7 3 32.1 30.125 20.525 17.25 4 35.0 28.65 17.025000000000002 19.325 5 28.199999999999996 26.05 19.3 26.450000000000003 6 24.975 27.900000000000002 21.65 25.474999999999998 7 22.125 31.974999999999998 25.8 20.1 8 22.8 28.050000000000004 25.974999999999998 23.175 9 24.412206103051524 24.562281140570285 25.18759379689845 25.83791895947974 10-14 26.314469195263896 24.538430664258478 25.90307043949428 23.244029700983344 15-19 26.662962775897775 25.274003737562502 24.541643517349364 23.521389969190363 20-24 26.74347781951071 25.195411633336718 24.06862247487565 23.992488072276927 25-29 25.761758691206545 25.37321063394683 24.994887525562373 23.870143149284253 30-34 26.323363141124474 25.60386473429952 24.355021071024773 23.71775105355124 35-39 26.166286543645036 25.450964130209414 24.9533485382542 23.429400787891357 40-44 25.642639806945756 25.128527961389153 25.71083831707061 23.51799391459448 45-49 25.82654528030666 25.102486290794868 25.00665495394772 24.06431347495075 50-54 26.238671514625278 25.082758994953057 24.919954414717534 23.758615075704128 55-59 24.98326639892905 25.67492190986167 25.613565372601517 23.728246318607766 60-64 26.257208765859286 24.99423298731257 25.236447520184548 23.5121107266436 65-69 25.57011159631247 24.836244541484717 25.13949539058709 24.45414847161572 70-74 25.636880900038793 25.067890857364546 25.042027673606622 24.253200568990042 75-79 25.32167832167832 26.055944055944057 24.818181818181817 23.804195804195803 80-84 25.376228501228503 25.11517199017199 25.644963144963146 23.863636363636363 85-89 24.818577648766325 24.801502603944336 26.099206010415777 24.28071373687356 90-94 26.02398081534772 24.402877697841728 25.90887290167866 23.664268585131897 95-99 25.359887433704948 24.515640220803117 26.225782011040156 23.898690334451782 100-104 25.73419611747138 25.423096067695372 25.261324041811843 23.581383773021404 105-109 25.4410263886864 24.814112844437965 25.659717159935852 24.085143606939788 110-114 25.947622329427983 25.206753962784283 25.223983459682977 23.621640248104754 115-119 24.950298210735586 25.725646123260436 25.487077534791254 23.836978131212724 120-124 25.0 25.48431734317343 25.20756457564576 24.30811808118081 125-129 25.871857258718574 26.520681265206814 24.19572857529062 23.411732900783996 130-134 25.41348600508906 24.650127226463102 25.44529262086514 24.491094147582697 135-139 25.50486163051608 25.24308152580404 25.355272999252055 23.896783844427823 140-144 25.57928214447978 24.443434802362564 25.98818718764198 23.989095865515676 145-149 24.065040650406505 26.12466124661247 26.72086720867209 23.089430894308943 150-154 25.146962769431745 24.885695623775312 26.3879817112998 23.57935989549314 155-159 24.50748620961387 25.768321513002363 25.847123719464143 23.87706855791962 160-164 24.669187145557654 26.27599243856333 25.330812854442343 23.72400756143667 165-169 22.727272727272727 28.349282296650717 25.11961722488038 23.80382775119617 170-174 25.38940809968847 26.947040498442366 25.85669781931464 21.806853582554517 175-179 24.862888482632542 23.948811700182816 24.862888482632542 26.3254113345521 180-184 23.937360178970916 24.161073825503358 27.069351230425053 24.832214765100673 185-189 23.391812865497073 27.485380116959064 23.099415204678362 26.023391812865498 190-194 27.459016393442624 21.311475409836063 25.81967213114754 25.40983606557377 195-199 23.42857142857143 25.71428571428571 26.285714285714285 24.571428571428573 200-204 21.53846153846154 20.0 32.30769230769231 26.153846153846157 205-209 26.373626373626376 26.373626373626376 27.472527472527474 19.78021978021978 210-214 20.54794520547945 27.397260273972602 27.397260273972602 24.65753424657534 215-219 27.450980392156865 19.607843137254903 35.294117647058826 17.647058823529413 220-224 16.129032258064516 12.903225806451612 25.806451612903224 45.16129032258064 225-229 23.809523809523807 19.047619047619047 23.809523809523807 33.33333333333333 230-234 30.0 40.0 10.0 20.0 235-239 28.57142857142857 14.285714285714285 14.285714285714285 42.857142857142854 240-244 40.0 60.0 0.0 0.0 245-249 60.0 0.0 20.0 20.0 250-253 25.0 0.0 50.0 25.0 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.5 9 2.0 10 2.5 11 3.0 12 2.5 13 2.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 3.0 21 3.5 22 4.0 23 4.0 24 5.5 25 8.0 26 10.0 27 10.5 28 9.5 29 8.0 30 14.5 31 23.0 32 24.5 33 29.5 34 40.5 35 51.5 36 63.833333333333336 37 79.33333333333334 38 100.5 39 128.83333333333334 40 149.66666666666669 41 161.33333333333334 42 186.16666666666666 43 214.0 44 229.83333333333334 45 237.83333333333334 46 245.0 47 239.50000000000003 48 222.50000000000003 49 218.5 50 225.33333333333334 51 222.83333333333331 52 197.16666666666669 53 172.5 54 161.0 55 161.0 56 145.83333333333334 57 127.83333333333333 58 126.83333333333333 59 114.16666666666666 60 101.99999999999999 61 101.0 62 102.33333333333334 63 94.33333333333334 64 80.33333333333334 65 64.33333333333334 66 62.5 67 70.0 68 61.0 69 49.5 70 41.0 71 29.0 72 21.5 73 20.0 74 17.5 75 11.5 76 9.5 77 8.0 78 4.0 79 3.5 80 5.0 81 5.0 82 4.0 83 3.0 84 3.0 85 3.0 86 2.5 87 2.0 88 1.5 89 1.0 90 1.0 91 1.0 92 1.0 93 1.0 94 1.0 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-159 0.0 160-164 0.0 165-169 0.0 170-174 0.0 175-179 0.0 180-184 0.0 185-189 0.0 190-194 0.0 195-199 0.0 200-204 0.0 205-209 0.0 210-214 0.0 215-219 0.0 220-224 0.0 225-229 0.0 230-234 0.0 235-239 0.0 240-244 0.0 245-249 0.0 250-253 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 5-9 3.0 10-14 27.0 15-19 20.0 20-24 27.0 25-29 23.0 30-34 20.0 35-39 50.0 40-44 53.0 45-49 53.0 50-54 96.0 55-59 106.0 60-64 151.0 65-69 190.0 70-74 222.0 75-79 253.0 80-84 268.0 85-89 260.0 90-94 228.0 95-99 248.0 100-104 244.0 105-109 225.0 110-114 170.0 115-119 138.0 120-124 136.0 125-129 119.0 130-134 98.0 135-139 89.0 140-144 92.0 145-149 56.0 150-154 62.0 155-159 44.0 160-164 43.0 165-169 47.0 170-174 22.0 175-179 20.0 180-184 20.0 185-189 21.0 190-194 17.0 195-199 8.0 200-204 11.0 205-209 5.0 210-214 3.0 215-219 5.0 220-224 2.0 225-229 3.0 230-234 0.0 235-239 1.0 240-244 0.0 245-249 0.0 250-254 1.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11459650898053 97.95 2 0.7336200354161396 1.4500000000000002 3 0.10118897040222614 0.3 4 0.025297242600556536 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025297242600556536 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACTCCAAGATCATCAACGACAGGGAGACTGGCCGTTCCCGCGGGTTCGGC 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.0 0.0 0.0 0.0 0.0 80-84 0.0 0.0 0.0 0.0 0.0 85-89 0.0 0.0 0.0 0.0 0.0 90-94 0.0 0.0 0.0 0.0 0.0 95-99 0.0 0.0 0.0 0.0 0.0 100-104 0.0 0.0 0.0 0.0 0.0 105-109 0.0 0.0 0.0 0.0 0.0 110-114 0.0 0.0 0.0 0.0 0.0 115-119 0.0 0.0 0.0 0.0 0.0 120-124 0.0 0.0 0.0 0.0 0.0 125-129 0.0 0.0 0.0 0.0 0.0 130-134 0.0 0.0 0.0 0.0 0.0 135-139 0.0 0.0 0.0 0.0 0.0 140-144 0.0 0.0 0.0 0.0 0.0 145-149 0.0 0.0 0.0 0.0 0.0 150-154 0.0 0.0 0.0 0.0 0.0 155-159 0.0 0.0 0.0 0.0 0.0 160-164 0.0 0.0 0.0 0.0 0.0 165-169 0.0 0.0 0.0 0.0 0.0 170-174 0.0 0.0 0.0 0.0 0.0 175-179 0.0 0.0 0.0 0.0 0.0 180-184 0.0 0.0 0.0 0.0 0.0 185-189 0.0 0.0 0.0 0.0 0.0 190-194 0.0 0.0 0.0 0.0 0.0 195-199 0.0 0.0 0.0 0.0 0.0 200-204 0.0 0.0 0.0 0.0 0.0 205-209 0.0 0.0 0.0 0.0 0.0 210-214 0.0 0.0 0.0 0.0 0.0 215-219 0.0 0.0 0.0 0.0 0.0 220-224 0.0 0.0 0.0 0.0 0.0 225-229 0.0 0.0 0.0 0.0 0.0 230-234 0.0 0.0 0.0 0.0 0.0 235-239 0.0 0.0 0.0 0.0 0.0 240-241 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCACCGC 5 2.862116E-4 3783.0002 190-191 TCCACCG 5 2.862116E-4 3783.0002 190-191 ACTTTGC 10 0.003433934 1261.0 180-184 GAGAAGG 10 0.0068666576 945.75006 170-174 ACTGTCC 15 0.007725671 840.6667 180-184 >>END_MODULE Read 332143 spots for ERR1806580.sra Written 332143 spots for ERR1806580.sra Read 332143 spots for ERR1806580.sra Written 332143 spots for ERR1806580.sra Read 332143 spots for ERR1806580.sra Written 332143 spots for ERR1806580.sra Read 332143 spots for ERR1806580.sra Written 332143 spots for ERR1806580.sra Read 332143 spots for ERR1806580.sra Written 332143 spots for ERR1806580.sra Read 332143 spots for ERR1806580.sra Written 332143 spots for ERR1806580.sra Read 332143 spots for ERR1806580.sra Written 332143 spots for ERR1806580.sra Read 332143 spots for ERR1806580.sra Written 332143 spots for ERR1806580.sra Read 332148 spots for ERR1806580.sra Written 332148 spots for ERR1806580.sra Read 332143 spots for ERR1806580.sra Written 332143 spots for ERR1806580.sra Read 332143 spots for ERR1806580.sra Written 332143 spots for ERR1806580.sra Read 332143 spots for ERR1806580.sra Written 332143 spots for ERR1806580.sra Read 332143 spots for ERR1806580.sra Written 332143 spots for ERR1806580.sra Read 332143 spots for ERR1806580.sra Written 332143 spots for ERR1806580.sra Read 332143 spots for ERR1806580.sra Written 332143 spots for ERR1806580.sra Read 332143 spots for ERR1806580.sra Written 332143 spots for ERR1806580.sra Read 332143 spots for ERR1806580.sra Written 332143 spots for ERR1806580.sra Read 332143 spots for ERR1806580.sra Written 332143 spots for ERR1806580.sra Read 332143 spots for ERR1806580.sra Written 332143 spots for ERR1806580.sra Read 332143 spots for ERR1806580.sra Written 332143 spots for ERR1806580.sra SRR ids: ['ERR1806580.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r9tfxsif ERR1806580.sra spots: 6642865 blocks: [[1, 332143], [332144, 664286], [664287, 996429], [996430, 1328572], [1328573, 1660715], [1660716, 1992858], [1992859, 2325001], [2325002, 2657144], [2657145, 2989287], [2989288, 3321430], [3321431, 3653573], [3653574, 3985716], [3985717, 4317859], [4317860, 4650002], [4650003, 4982145], [4982146, 5314288], [5314289, 5646431], [5646432, 5978574], [5978575, 6310717], [6310718, 6642865]] ERR1806580 file size 1518771 ERR1806580 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1806580 ERR1806580_1.fastq Input file: ERR1806580_1.fastq trimmed: ERR1806580-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 17:05:38 2024 >> started Mon Dec 9 17:05:48 2024 >> done (10.496s) 6642865 reads processed; of these: 91612 ( 1.38%) short reads filtered out after trimming by size control 6 ( 0.00%) empty reads filtered out after trimming by size control 6551247 (98.62%) reads available; of these: 95075 ( 1.45%) trimmed reads available after processing 6456172 (98.55%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 8327 0.13% 19 8118 0.12% 20 7718 0.12% 21 7899 0.12% 22 7608 0.12% 23 7608 0.12% 24 8257 0.13% 25 8077 0.12% 26 8159 0.12% 27 8560 0.13% 28 8563 0.13% 29 8827 0.13% 30 9359 0.14% 31 9361 0.14% 32 9476 0.14% 33 10463 0.16% 34 10859 0.17% 35 10984 0.17% 36 12130 0.19% 37 11668 0.18% 38 12575 0.19% 39 13701 0.21% 40 13801 0.21% 41 14719 0.22% 42 16422 0.25% 43 16568 0.25% 44 17663 0.27% 45 19645 0.30% 46 19961 0.30% 47 20784 0.32% 48 23891 0.36% 49 24526 0.37% 50 25749 0.39% 51 29061 0.44% 52 29836 0.46% 53 31182 0.48% 54 34400 0.53% 55 36367 0.56% 56 38336 0.59% 57 42128 0.64% 58 43318 0.66% 59 46171 0.70% 60 50564 0.77% 61 53151 0.81% 62 52787 0.81% 63 60405 0.92% 64 59278 0.90% 65 60011 0.92% 66 63886 0.98% 67 63783 0.97% 68 66369 1.01% 69 70087 1.07% 70 72221 1.10% 71 72905 1.11% 72 77176 1.18% 73 75288 1.15% 74 77703 1.19% 75 79087 1.21% 76 79941 1.22% 77 85564 1.31% 78 85528 1.31% 79 82421 1.26% 80 84087 1.28% 81 84492 1.29% 82 89880 1.37% 83 85326 1.30% 84 86333 1.32% 85 87153 1.33% 86 83195 1.27% 87 84413 1.29% 88 83852 1.28% 89 84461 1.29% 90 85370 1.30% 91 82978 1.27% 92 82383 1.26% 93 85476 1.30% 94 80598 1.23% 95 78811 1.20% 96 81705 1.25% 97 76359 1.17% 98 75730 1.16% 99 76199 1.16% 100 75412 1.15% 101 73169 1.12% 102 73508 1.12% 103 73587 1.12% 104 69583 1.06% 105 68087 1.04% 106 65715 1.00% 107 64017 0.98% 108 65079 0.99% 109 65441 1.00% 110 60525 0.92% 111 59537 0.91% 112 60086 0.92% 113 55827 0.85% 114 56649 0.86% 115 54471 0.83% 116 52636 0.80% 117 52532 0.80% 118 50142 0.77% 119 48313 0.74% 120 47806 0.73% 121 46478 0.71% 122 44892 0.69% 123 43706 0.67% 124 42209 0.64% 125 41215 0.63% 126 39850 0.61% 127 39070 0.60% 128 37691 0.58% 129 37194 0.57% 130 36179 0.55% 131 34804 0.53% 132 34218 0.52% 133 33059 0.50% 134 32770 0.50% 135 31810 0.49% 136 30184 0.46% 137 29100 0.44% 138 29194 0.45% 139 27676 0.42% 140 27684 0.42% 141 25911 0.40% 142 24555 0.37% 143 23732 0.36% 144 23357 0.36% 145 22652 0.35% 146 21765 0.33% 147 21516 0.33% 148 20276 0.31% 149 19663 0.30% 150 19878 0.30% 151 18976 0.29% 152 18135 0.28% 153 17460 0.27% 154 17110 0.26% 155 17341 0.26% 156 16052 0.25% 157 15599 0.24% 158 14661 0.22% 159 14212 0.22% 160 14040 0.21% 161 13662 0.21% 162 12899 0.20% 163 12830 0.20% 164 12403 0.19% 165 11749 0.18% 166 11349 0.17% 167 11064 0.17% 168 10794 0.16% 169 10573 0.16% 170 9971 0.15% 171 9660 0.15% 172 9347 0.14% 173 8996 0.14% 174 8603 0.13% 175 8134 0.12% 176 8084 0.12% 177 7790 0.12% 178 7412 0.11% 179 7208 0.11% 180 7132 0.11% 181 6828 0.10% 182 6564 0.10% 183 6261 0.10% 184 6047 0.09% 185 5709 0.09% 186 5677 0.09% 187 5508 0.08% 188 5144 0.08% 189 5092 0.08% 190 4826 0.07% 191 4591 0.07% 192 4440 0.07% 193 4263 0.07% 194 4137 0.06% 195 3976 0.06% 196 3806 0.06% 197 3654 0.06% 198 3461 0.05% 199 3313 0.05% 200 3166 0.05% 201 3028 0.05% 202 3002 0.05% 203 2883 0.04% 204 2657 0.04% 205 2572 0.04% 206 2463 0.04% 207 2394 0.04% 208 2188 0.03% 209 2117 0.03% 210 2007 0.03% 211 1984 0.03% 212 1828 0.03% 213 1770 0.03% 214 1568 0.02% 215 1560 0.02% 216 1537 0.02% 217 1451 0.02% 218 1333 0.02% 219 1306 0.02% 220 1215 0.02% 221 1203 0.02% 222 1093 0.02% 223 985 0.02% 224 974 0.01% 225 896 0.01% 226 838 0.01% 227 831 0.01% 228 761 0.01% 229 696 0.01% 230 635 0.01% 231 582 0.01% 232 537 0.01% 233 489 0.01% 234 538 0.01% 235 457 0.01% 236 421 0.01% 237 422 0.01% 238 356 0.01% 239 343 0.01% 240 302 0.00% 241 280 0.00% 242 287 0.00% 243 230 0.00% 244 251 0.00% 245 199 0.00% 246 183 0.00% 247 165 0.00% 248 175 0.00% 249 135 0.00% 250 126 0.00% 251 119 0.00% 252 113 0.00% 253 96 0.00% 254 78 0.00% 255 66 0.00% 256 75 0.00% 257 66 0.00% 258 66 0.00% 259 44 0.00% 260 43 0.00% 261 32 0.00% 262 44 0.00% 263 36 0.00% 264 29 0.00% 265 33 0.00% 266 15 0.00% 267 17 0.00% 268 16 0.00% 269 10 0.00% 270 16 0.00% 271 11 0.00% 272 11 0.00% 273 6 0.00% 274 7 0.00% 275 7 0.00% 276 3 0.00% 277 7 0.00% 278 2 0.00% 279 2 0.00% 280 2 0.00% 281 3 0.00% 282 1 0.00% 283 0 0.00% 284 3 0.00% 285 3 0.00% 286 3 0.00% 287 2 0.00% 288 0 0.00% 289 1 0.00% 290 0 0.00% 291 0 0.00% 292 1 0.00% 293 1 0.00% 294 0 0.00% 295 0 0.00% 296 0 0.00% 297 0 0.00% 298 0 0.00% 299 1 0.00% 300 1 0.00% 301 1 0.00% 302 0 0.00% 303 0 0.00% 304 0 0.00% 305 0 0.00% 306 0 0.00% 307 0 0.00% 308 0 0.00% 309 0 0.00% 310 0 0.00% 311 0 0.00% 312 0 0.00% 313 0 0.00% 314 0 0.00% 315 0 0.00% 316 0 0.00% 317 0 0.00% 318 0 0.00% 319 0 0.00% 320 0 0.00% 321 0 0.00% 322 0 0.00% 323 0 0.00% 324 0 0.00% 325 0 0.00% 326 0 0.00% 327 0 0.00% 328 0 0.00% 329 0 0.00% 330 0 0.00% 331 0 0.00% 332 0 0.00% 333 0 0.00% 334 0 0.00% 335 0 0.00% 336 0 0.00% 337 1 0.00% 6551247 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=6.83 fanout-score-rank=21 prefix-density=0.21 prefix-fanout=4.7 sequence=GGCAAGACCATCAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=334.37 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=15.7 sequence=CAGCAGCAGAGAGCCGGAGCGCCACCAGCCATCCGATCAAAACACACAGATCAATCCGATGGCTCTCGCTCTCTCCGGTTCCTCGGCTGCTGCCCGCGCGCTGGCCCAGCTGCTGGCCCCGTCCACCA Started job on | Dec 09 17:06:14 Started mapping on | Dec 09 17:06:14 Finished on | Dec 09 17:06:26 Mapping speed, Million of reads per hour | 1965.37 Number of input reads | 6551247 Average input read length | 97 UNIQUE READS: Uniquely mapped reads number | 5200393 Uniquely mapped reads % | 79.38% Average mapped length | 90.21 Number of splices: Total | 1513100 Number of splices: Annotated (sjdb) | 1423840 Number of splices: GT/AG | 1479783 Number of splices: GC/AG | 16517 Number of splices: AT/AC | 1200 Number of splices: Non-canonical | 15600 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.15% Deletion average length | 1.10 Insertion rate per base | 0.13% Insertion average length | 1.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 145995 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 85964 % of reads mapped to too many loci | 1.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 16.82% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1204859 1204859 1204859 N_multimapping 145995 145995 145995 N_noFeature 209876 256320 5081521 N_ambiguous 82979 11040 532 UnstrandedReadsAssigned:4907538 PositiveStrandReadsAssigned:4933033 NegativeStrandReadsAssigned:118340 Dataset is classified positive stranded MeadianReadLen=93 20thPercentileLength=69 echo kmer=65 ERR1806580 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR1806580-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,551,247 reads, 5,255,847 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,018 rounds 52973 ERR1806580.ke.tsv 35125 ERR1806580.se.tsv 88098 total ==> ERR1806580.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 71.1061 25.2116 PNS24247 1044 945 15.6382 4.91104 PNS24249 1928 1829 31.0556 5.039 PNS24246 1044 945 15.6382 4.91104 PNS24248 1044 945 15.6382 4.91104 PNS24244 1471 1372 96.9238 20.965 PNS24243 293 194 0 0 KQK14069 1603 1504 1646.72 324.932 KQK14071 474 375 42.568 33.6877 ==> ERR1806580.se.tsv <== BRADI_1g14170v3 1746 BRADI_1g53295v3 45 BRADI_1g59795v3 147 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 525 BRADI_1g74790v3 92 BRADI_1g09890v3 0 BRADI_1g77505v3 154 BRADI_1g48960v3 0 ERR1806580 completed mapping pipeline successfully