Starting /dee2/code/volunteer_pipeline.sh ERR1806581 current disk space = 1523742834688 free memory = 1583224688 ERR1806581 SRAfilesize 515d47e5ea019116e8d4ddf5afadc5f4 ERR1806581.sra ERR1806581.sra file validated ERR1806581 is single end ERR1806581 is conventional basespace ERR1806581 read1 length is 8-220 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1806581_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 8-220 %GC 52 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.9275 25.0 22.0 27.0 19.0 28.0 2 23.7655 25.0 21.0 27.0 18.0 28.0 3 23.55825 25.0 21.0 27.0 17.0 28.0 4 23.6285 25.0 21.0 27.0 17.0 28.0 5 23.48075 25.0 21.0 27.0 17.0 28.0 6 23.551 25.0 21.0 27.0 17.0 28.0 7 23.4735 25.0 21.0 27.0 17.0 28.0 8 23.47875 25.0 21.0 27.0 17.0 28.0 9 23.634292866082603 25.0 21.0 27.0 17.0 28.0 10-14 23.528128794808293 25.0 21.0 27.0 17.0 28.0 15-19 23.59482984395953 25.0 21.0 27.0 17.4 28.0 20-24 23.619092074575555 25.0 21.0 27.0 18.0 28.0 25-29 23.650785667284232 25.0 21.0 27.0 18.0 28.0 30-34 23.695162018643213 25.0 21.0 27.0 18.0 28.0 35-39 23.646896037069702 25.0 21.0 26.8 18.0 28.0 40-44 23.566798352138704 25.0 21.0 26.8 17.4 28.0 45-49 23.518497727915157 25.0 21.0 27.0 17.2 28.0 50-54 23.527769458554513 25.0 21.0 26.4 17.6 28.0 55-59 23.52540336029612 25.0 21.0 26.2 17.6 28.0 60-64 23.569749343630736 25.0 21.0 26.6 17.8 28.0 65-69 23.551603639773266 25.0 21.0 26.0 17.8 28.0 70-74 23.583312918104447 25.0 21.0 26.0 18.0 27.8 75-79 23.44019737018923 25.0 21.0 26.0 17.6 28.0 80-84 23.39965784249477 25.0 21.0 26.0 17.4 27.4 85-89 23.309516611695365 25.0 21.0 26.0 17.0 27.2 90-94 23.192503406252577 24.8 20.8 26.0 17.0 27.0 95-99 23.131800535855273 24.2 20.6 26.0 16.8 27.0 100-104 23.1361140869481 24.4 20.4 26.0 16.8 27.0 105-109 22.97493331096424 24.2 20.2 26.0 16.4 27.0 110-114 22.98872656737361 24.0 20.2 26.0 16.6 27.0 115-119 22.828967094934587 24.0 20.0 26.0 16.8 27.0 120-124 22.486018038100788 23.8 20.0 26.0 15.8 27.0 125-129 22.208632597652688 23.0 19.8 25.8 15.0 27.0 130-134 22.30471117267792 23.6 20.0 25.8 16.0 27.0 135-139 21.972395416332127 23.0 19.4 25.6 14.6 27.0 140-144 21.876232729084176 23.0 19.2 25.0 14.6 26.6 145-149 21.517486714578336 22.4 18.8 25.0 14.2 26.6 150-154 21.40933175820236 22.0 18.8 25.0 14.2 26.0 155-159 21.462473163988196 22.6 18.6 25.0 14.4 26.2 160-164 21.129616728140583 22.0 18.8 24.6 13.8 25.6 165-169 20.369056353718292 21.0 17.0 24.2 13.2 25.4 170-174 20.384345841757607 NaN NaN NaN NaN NaN 175-179 20.80859565507271 NaN NaN NaN NaN NaN 180-184 20.327323820761002 NaN NaN NaN NaN NaN 185-189 19.344847088395476 NaN NaN NaN NaN NaN 190-194 19.755962703962705 NaN NaN NaN NaN NaN 195-199 18.320833333333333 NaN NaN NaN NaN NaN 200-204 18.0965367965368 NaN NaN NaN NaN NaN 205-209 21.005000000000003 NaN NaN NaN NaN NaN 210-214 19.43 NaN NaN NaN NaN NaN 215-219 15.1 NaN NaN NaN NaN NaN 220 16.0 NaN NaN NaN NaN NaN >>END_MODULE >>Per sequence quality scores warn #Quality Count 11 1.0 12 0.0 13 1.0 14 10.0 15 18.0 16 27.0 17 68.0 18 92.0 19 126.0 20 206.0 21 356.0 22 509.0 23 678.0 24 1018.0 25 789.0 26 100.0 27 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.025000000000002 45.225 17.349999999999998 14.399999999999999 2 43.325 33.675 6.3 16.7 3 32.0 31.525 18.525 17.95 4 34.55 28.000000000000004 16.45 21.0 5 28.625 26.174999999999997 17.849999999999998 27.35 6 26.200000000000003 27.700000000000003 20.0 26.1 7 21.85 30.5 23.45 24.2 8 25.05 26.35 23.150000000000002 25.45 9 26.933667083854818 23.729662077597 22.503128911138923 26.83354192740926 10-14 26.743952624711433 25.03763926528154 23.296195924922213 24.922212185084813 15-19 27.852196330182483 24.8192892887833 22.271647374007987 25.056867007026234 20-24 28.263966622570468 23.94932329296835 22.667141548794138 25.119568535667042 25-29 27.038648579472742 24.51497312515997 22.943434860506784 25.50294343486051 30-34 27.96968447102495 24.33491441534337 22.53041864301918 25.164982470612497 35-39 28.019549732231063 24.22399001715801 22.424998700150784 25.331461550460148 40-44 27.764976958525345 23.942186845412653 22.847716799329703 25.445119396732302 45-49 27.32991489136755 23.80927208331131 23.703547074060367 25.157265951260772 50-54 26.809966848465404 24.173885145973692 23.719388300716503 25.2967597048444 55-59 26.496052273346038 24.568472638170434 23.12006534168255 25.81540974680098 60-64 26.804641303135114 23.948454758451412 23.597009929711035 25.649894008702447 65-69 27.39332682478608 24.315166829380345 22.850743697237696 25.44076264859588 70-74 27.28362502996883 24.160872692399906 23.69935267321985 24.856149604411414 75-79 26.969984202211688 24.454976303317537 23.342812006319118 25.232227488151658 80-84 26.601586333129955 24.967798793302148 23.584841705647076 24.845773167920818 85-89 26.055259896478823 24.91069475832908 24.14522125829263 24.888824086899465 90-94 26.30695443645084 24.54036770583533 23.72501998401279 25.427657873701037 95-99 25.8378764858343 23.889534364107607 24.827956028242024 25.444633121816068 100-104 26.323161580790394 24.842421210605302 23.50175087543772 25.332666333166582 105-109 25.95471443055086 24.63670158837445 24.670496789455896 24.738087191618792 110-114 25.97892545856641 25.627683101339926 23.260049434109536 25.133342005984126 115-119 26.00370599135269 23.81099444101297 24.96911673872761 25.21618282890673 120-124 26.06608824072365 24.441572826287615 25.36459294812627 24.12774598486247 125-129 26.974865350089765 24.461400359066428 23.833034111310592 24.730700179533212 130-134 26.295264623955433 25.292479108635096 24.40111420612813 24.011142061281337 135-139 24.70308788598575 24.87275195113675 25.44960977265015 24.97455039022735 140-144 26.107127794179668 24.124841838886546 25.896246309574018 23.87178405735976 145-149 25.995694294940797 25.134553283100107 25.88805166846071 22.981700753498384 150-154 24.19127988748242 23.488045007032348 26.511954992967652 25.80872011251758 155-159 25.0 23.6013986013986 26.835664335664333 24.562937062937063 160-164 25.616921269095183 22.679200940070505 26.439482961222094 25.26439482961222 165-169 22.385620915032682 24.019607843137255 24.509803921568626 29.08496732026144 170-174 26.46370023419204 21.54566744730679 21.779859484777518 30.210772833723652 175-179 22.857142857142858 28.57142857142857 23.174603174603174 25.396825396825395 180-184 28.251121076233183 22.421524663677133 26.45739910313901 22.869955156950674 185-189 19.745222929936308 29.29936305732484 19.745222929936308 31.210191082802545 190-194 30.76923076923077 17.094017094017094 32.47863247863248 19.65811965811966 195-199 28.57142857142857 16.666666666666664 27.380952380952383 27.380952380952383 200-204 32.20338983050847 27.11864406779661 18.64406779661017 22.033898305084744 205-209 20.0 34.285714285714285 17.142857142857142 28.57142857142857 210-214 46.666666666666664 26.666666666666668 6.666666666666667 20.0 215-219 33.33333333333333 55.55555555555556 0.0 11.11111111111111 220 100.0 0.0 0.0 0.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.5 11 2.5 12 3.0 13 3.0 14 3.5 15 3.5 16 3.0 17 3.0 18 2.5 19 2.5 20 3.5 21 3.5 22 4.0 23 5.5 24 6.0 25 5.5 26 5.5 27 7.5 28 9.0 29 9.5 30 8.5 31 8.5 32 17.0 33 24.5 34 25.0 35 33.0 36 41.0 37 43.833333333333336 38 60.5 39 73.5 40 88.5 41 121.0 42 142.5 43 142.0 44 166.0 45 186.00000000000003 46 173.5 47 192.83333333333334 48 209.33333333333334 49 215.16666666666666 50 220.83333333333334 51 207.0 52 205.83333333333334 53 200.5 54 187.0 55 184.33333333333334 56 177.16666666666666 57 164.83333333333334 58 145.5 59 133.83333333333331 60 131.83333333333331 61 133.83333333333331 62 146.83333333333331 63 135.33333333333331 64 109.5 65 102.0 66 97.5 67 84.5 68 75.5 69 71.0 70 55.0 71 43.0 72 32.5 73 26.0 74 20.0 75 12.0 76 7.5 77 6.5 78 7.5 79 4.5 80 2.0 81 1.5 82 2.0 83 3.0 84 2.5 85 2.0 86 1.5 87 1.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-159 0.0 160-164 0.0 165-169 0.0 170-174 0.0 175-179 0.0 180-184 0.0 185-189 0.0 190-194 0.0 195-199 0.0 200-204 0.0 205-209 0.0 210-214 0.0 215-219 0.0 220 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 5-9 6.0 10-14 25.0 15-19 28.0 20-24 25.0 25-29 24.0 30-34 35.0 35-39 29.0 40-44 31.0 45-49 35.0 50-54 58.0 55-59 85.0 60-64 92.0 65-69 136.0 70-74 151.0 75-79 203.0 80-84 210.0 85-89 229.0 90-94 255.0 95-99 243.0 100-104 238.0 105-109 216.0 110-114 248.0 115-119 234.0 120-124 201.0 125-129 175.0 130-134 147.0 135-139 123.0 140-144 109.0 145-149 96.0 150-154 62.0 155-159 60.0 160-164 55.0 165-169 36.0 170-174 32.0 175-179 17.0 180-184 16.0 185-189 9.0 190-194 8.0 195-199 4.0 200-204 6.0 205-209 3.0 210-214 3.0 215-219 1.0 220-221 1.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.175 #Duplication Level Percentage of deduplicated Percentage of total 1 98.95594601476955 97.15 2 0.8148714031066971 1.6 3 0.12732365673542145 0.375 4 0.05092946269416857 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025464731347084286 0.2 9 0.0 0.0 >10 0.025464731347084286 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACTCCAAGATCATCAACGACAGGGAGACTGGCCGTTCCCGCGGGTTCGGC 19 0.475 No Hit GGGGAAGAAGCTCACTGCCGAGGCTTATGACTGCAACAATACGGTTGAGC 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.0 0.0 0.0 0.0 0.0 80-84 0.0 0.0 0.0 0.0 0.0 85-89 0.0 0.0 0.0 0.0 0.0 90-94 0.0 0.0 0.0 0.0 0.0 95-99 0.0 0.0 0.0 0.0 0.0 100-104 0.0 0.0 0.0 0.0 0.0 105-109 0.0 0.0 0.0 0.0 0.0 110-114 0.0 0.0 0.0 0.0 0.0 115-119 0.0 0.0 0.0 0.0 0.0 120-124 0.0 0.0 0.0 0.0 0.0 125-129 0.0 0.0 0.0 0.0 0.0 130-134 0.0 0.0 0.0 0.0 0.0 135-139 0.0 0.0 0.0 0.0 0.0 140-144 0.0 0.0 0.0 0.0 0.0 145-149 0.0 0.0 0.0 0.0 0.0 150-154 0.0 0.0 0.0 0.0 0.0 155-159 0.0 0.0 0.0 0.0 0.0 160-164 0.0 0.0 0.0 0.0 0.0 165-169 0.0 0.0 0.0 0.0 0.0 170-174 0.0 0.0 0.0 0.0 0.0 175-179 0.0 0.0 0.0 0.0 0.0 180-184 0.0 0.0 0.0 0.0 0.0 185-189 0.0 0.0 0.0 0.0 0.0 190-194 0.0 0.0 0.0 0.0 0.0 195-199 0.0 0.0 0.0 0.0 0.0 200-204 0.0 0.0 0.0 0.0 0.0 205-208 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTCCCC 5 2.7872054E-4 3833.5002 170-174 TGGACGA 5 8.360889E-4 2555.6667 180-182 GGACGAG 5 8.360889E-4 2555.6667 180-182 TATAATG 5 0.0027864785 1533.4 175-179 TAATGGA 5 0.0027864785 1533.4 175-179 ATAATGG 5 0.0027864785 1533.4 175-179 ATGGACG 5 0.0027864785 1533.4 175-179 AATGGAC 5 0.0027864785 1533.4 175-179 CTATAAT 5 0.0041793543 1277.8334 170-174 TGGAGGT 10 0.0033440648 1277.8334 160-164 GCTATAA 5 0.0041793543 1277.8334 170-174 AGGCTAT 5 0.0041793543 1277.8334 170-174 GGCTATA 5 0.0041793543 1277.8334 170-174 GAGGCTA 5 0.0041793543 1277.8334 170-174 GCAAGAG 10 0.006686967 958.37506 155-159 >>END_MODULE Read 297648 spots for ERR1806581.sra Written 297648 spots for ERR1806581.sra Read 297648 spots for ERR1806581.sra Written 297648 spots for ERR1806581.sra Read 297648 spots for ERR1806581.sra Written 297648 spots for ERR1806581.sra Read 297648 spots for ERR1806581.sra Written 297648 spots for ERR1806581.sra Read 297648 spots for ERR1806581.sra Written 297648 spots for ERR1806581.sra Read 297648 spots for ERR1806581.sra Written 297648 spots for ERR1806581.sra Read 297648 spots for ERR1806581.sra Written 297648 spots for ERR1806581.sra Read 297648 spots for ERR1806581.sra Written 297648 spots for ERR1806581.sra Read 297648 spots for ERR1806581.sra Written 297648 spots for ERR1806581.sra Read 297648 spots for ERR1806581.sra Written 297648 spots for ERR1806581.sra Read 297648 spots for ERR1806581.sra Written 297648 spots for ERR1806581.sra Read 297648 spots for ERR1806581.sra Written 297648 spots for ERR1806581.sra Read 297648 spots for ERR1806581.sra Written 297648 spots for ERR1806581.sra Read 297648 spots for ERR1806581.sra Written 297648 spots for ERR1806581.sra Read 297648 spots for ERR1806581.sra Written 297648 spots for ERR1806581.sra Read 297654 spots for ERR1806581.sra Written 297654 spots for ERR1806581.sra Read 297648 spots for ERR1806581.sra Written 297648 spots for ERR1806581.sra Read 297648 spots for ERR1806581.sra Written 297648 spots for ERR1806581.sra Read 297648 spots for ERR1806581.sra Written 297648 spots for ERR1806581.sra Read 297648 spots for ERR1806581.sra Written 297648 spots for ERR1806581.sra SRR ids: ['ERR1806581.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bsvok6tl ERR1806581.sra spots: 5952966 blocks: [[1, 297648], [297649, 595296], [595297, 892944], [892945, 1190592], [1190593, 1488240], [1488241, 1785888], [1785889, 2083536], [2083537, 2381184], [2381185, 2678832], [2678833, 2976480], [2976481, 3274128], [3274129, 3571776], [3571777, 3869424], [3869425, 4167072], [4167073, 4464720], [4464721, 4762368], [4762369, 5060016], [5060017, 5357664], [5357665, 5655312], [5655313, 5952966]] ERR1806581 file size 1413313 ERR1806581 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1806581 ERR1806581_1.fastq Input file: ERR1806581_1.fastq trimmed: ERR1806581-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 17:10:39 2024 >> started Mon Dec 9 17:10:42 2024 >> done (3.160s) 5952966 reads processed; of these: 95293 ( 1.60%) short reads filtered out after trimming by size control 3 ( 0.00%) empty reads filtered out after trimming by size control 5857670 (98.40%) reads available; of these: 110633 ( 1.89%) trimmed reads available after processing 5747037 (98.11%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 9111 0.16% 19 8902 0.15% 20 8533 0.15% 21 8552 0.15% 22 8636 0.15% 23 8538 0.15% 24 9846 0.17% 25 8767 0.15% 26 8713 0.15% 27 8951 0.15% 28 9002 0.15% 29 9102 0.16% 30 9534 0.16% 31 9493 0.16% 32 9503 0.16% 33 9876 0.17% 34 9853 0.17% 35 10226 0.17% 36 10547 0.18% 37 10390 0.18% 38 10590 0.18% 39 11307 0.19% 40 11242 0.19% 41 11319 0.19% 42 12628 0.22% 43 12408 0.21% 44 12884 0.22% 45 14044 0.24% 46 14054 0.24% 47 14379 0.25% 48 15530 0.27% 49 15901 0.27% 50 16412 0.28% 51 17775 0.30% 52 18220 0.31% 53 18842 0.32% 54 20291 0.35% 55 20747 0.35% 56 21499 0.37% 57 23362 0.40% 58 23912 0.41% 59 25806 0.44% 60 27674 0.47% 61 28556 0.49% 62 29257 0.50% 63 33077 0.56% 64 32681 0.56% 65 33484 0.57% 66 35908 0.61% 67 37371 0.64% 68 38930 0.66% 69 41847 0.71% 70 43063 0.74% 71 44308 0.76% 72 47913 0.82% 73 47714 0.81% 74 51441 0.88% 75 52689 0.90% 76 54110 0.92% 77 62873 1.07% 78 64864 1.11% 79 58576 1.00% 80 58880 1.01% 81 62277 1.06% 82 68142 1.16% 83 66060 1.13% 84 67335 1.15% 85 68732 1.17% 86 66031 1.13% 87 69247 1.18% 88 70100 1.20% 89 70781 1.21% 90 74020 1.26% 91 72537 1.24% 92 72588 1.24% 93 79063 1.35% 94 75022 1.28% 95 75016 1.28% 96 76103 1.30% 97 73284 1.25% 98 74874 1.28% 99 75934 1.30% 100 75861 1.30% 101 75674 1.29% 102 75220 1.28% 103 76958 1.31% 104 73427 1.25% 105 73282 1.25% 106 70588 1.21% 107 70720 1.21% 108 71083 1.21% 109 71301 1.22% 110 68579 1.17% 111 69846 1.19% 112 69020 1.18% 113 65383 1.12% 114 66368 1.13% 115 63699 1.09% 116 62204 1.06% 117 62076 1.06% 118 59919 1.02% 119 58430 1.00% 120 58017 0.99% 121 56023 0.96% 122 54434 0.93% 123 52499 0.90% 124 51378 0.88% 125 50778 0.87% 126 49819 0.85% 127 47740 0.81% 128 45849 0.78% 129 46467 0.79% 130 44039 0.75% 131 42169 0.72% 132 42587 0.73% 133 40227 0.69% 134 39629 0.68% 135 38121 0.65% 136 35668 0.61% 137 34482 0.59% 138 35272 0.60% 139 33215 0.57% 140 32597 0.56% 141 30919 0.53% 142 29118 0.50% 143 28478 0.49% 144 27786 0.47% 145 27177 0.46% 146 25507 0.44% 147 25653 0.44% 148 23495 0.40% 149 22368 0.38% 150 22189 0.38% 151 21427 0.37% 152 20735 0.35% 153 20002 0.34% 154 19304 0.33% 155 19034 0.32% 156 17793 0.30% 157 17263 0.29% 158 15534 0.27% 159 14992 0.26% 160 14574 0.25% 161 13848 0.24% 162 13576 0.23% 163 13297 0.23% 164 12267 0.21% 165 11768 0.20% 166 10998 0.19% 167 10977 0.19% 168 10392 0.18% 169 9795 0.17% 170 9435 0.16% 171 8856 0.15% 172 8462 0.14% 173 7987 0.14% 174 7565 0.13% 175 7217 0.12% 176 7029 0.12% 177 6550 0.11% 178 6127 0.10% 179 5888 0.10% 180 5584 0.10% 181 5356 0.09% 182 5126 0.09% 183 4935 0.08% 184 4662 0.08% 185 4315 0.07% 186 4088 0.07% 187 3787 0.06% 188 3577 0.06% 189 3249 0.06% 190 3201 0.05% 191 3061 0.05% 192 2809 0.05% 193 2705 0.05% 194 2547 0.04% 195 2341 0.04% 196 2325 0.04% 197 2059 0.04% 198 1930 0.03% 199 1777 0.03% 200 1649 0.03% 201 1506 0.03% 202 1400 0.02% 203 1303 0.02% 204 1187 0.02% 205 1158 0.02% 206 1040 0.02% 207 989 0.02% 208 894 0.02% 209 839 0.01% 210 783 0.01% 211 744 0.01% 212 704 0.01% 213 597 0.01% 214 580 0.01% 215 481 0.01% 216 489 0.01% 217 428 0.01% 218 410 0.01% 219 375 0.01% 220 324 0.01% 221 284 0.00% 222 230 0.00% 223 255 0.00% 224 199 0.00% 225 194 0.00% 226 172 0.00% 227 163 0.00% 228 144 0.00% 229 119 0.00% 230 115 0.00% 231 94 0.00% 232 78 0.00% 233 95 0.00% 234 62 0.00% 235 89 0.00% 236 54 0.00% 237 54 0.00% 238 41 0.00% 239 42 0.00% 240 27 0.00% 241 30 0.00% 242 18 0.00% 243 17 0.00% 244 19 0.00% 245 20 0.00% 246 16 0.00% 247 9 0.00% 248 8 0.00% 249 14 0.00% 250 10 0.00% 251 5 0.00% 252 3 0.00% 253 12 0.00% 254 5 0.00% 255 4 0.00% 256 6 0.00% 257 1 0.00% 258 1 0.00% 259 4 0.00% 260 2 0.00% 261 5 0.00% 262 4 0.00% 263 2 0.00% 264 2 0.00% 265 1 0.00% 266 2 0.00% 267 0 0.00% 268 1 0.00% 269 1 0.00% 270 1 0.00% 271 0 0.00% 272 0 0.00% 273 0 0.00% 274 0 0.00% 275 1 0.00% 276 0 0.00% 277 0 0.00% 278 0 0.00% 279 0 0.00% 280 0 0.00% 281 0 0.00% 282 0 0.00% 283 0 0.00% 284 0 0.00% 285 0 0.00% 286 0 0.00% 287 0 0.00% 288 0 0.00% 289 0 0.00% 290 0 0.00% 291 0 0.00% 292 0 0.00% 293 0 0.00% 294 0 0.00% 295 0 0.00% 296 0 0.00% 297 0 0.00% 298 0 0.00% 299 0 0.00% 300 0 0.00% 301 0 0.00% 302 0 0.00% 303 0 0.00% 304 0 0.00% 305 0 0.00% 306 0 0.00% 307 0 0.00% 308 0 0.00% 309 0 0.00% 310 0 0.00% 311 0 0.00% 312 0 0.00% 313 0 0.00% 314 1 0.00% 315 0 0.00% 316 0 0.00% 317 0 0.00% 318 0 0.00% 319 0 0.00% 320 0 0.00% 321 0 0.00% 322 1 0.00% 5857670 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=4.47 fanout-score-rank=29 prefix-density=0.39 prefix-fanout=3.3 sequence=AAGATCCAGGACAAGGAGGGCAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=130.37 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=9.7 sequence=AGAAGATTGTGATCAAGACCTGTGGGACTACCATGCTCCTGCTCACCATTCCAAGGATTCTTGAGCTTGCTGAAGAGCTGTGCATGCCGCTTGCTGCTGTGAAGTACTCTCGAGGGATGTTCATCTTCCCTGGCGCACAGCCAGCTCCCCACAGGAGCTTCTCTGAGGAGGTTGATGTCCTTAACCGCTACTTTGGTGGCCTGAAATCTGGTGGCAATGCTTATGTGATTGGAGATCCAGCCAAGCCAGGCCAGAAGTGGCACATCTATTATGCCACTGAGCAACCTGAGAAACCTATGGTCACACTGGAGATGTGCATGACTGGGCTGGACAAGAAGAAAGCCTCTGTCTTCTTCAAGACTTCTGCTGATGGACACATCTCATGTGCTAAGGAGATGACAAAGGTCTCTGGTATCTCTGAAATCATCCCGGAGATGGAGGTCTGTGACTTCGACTTTGAGCCCTGCGGCTACTCCATGAACGCCATCCATGGATCTGCGTTCTCTACAAT Started job on | Dec 09 17:11:01 Started mapping on | Dec 09 17:11:01 Finished on | Dec 09 17:11:12 Mapping speed, Million of reads per hour | 1917.06 Number of input reads | 5857670 Average input read length | 101 UNIQUE READS: Uniquely mapped reads number | 4996229 Uniquely mapped reads % | 85.29% Average mapped length | 98.04 Number of splices: Total | 1584310 Number of splices: Annotated (sjdb) | 1487271 Number of splices: GT/AG | 1549802 Number of splices: GC/AG | 17071 Number of splices: AT/AC | 1266 Number of splices: Non-canonical | 16171 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.17% Deletion average length | 1.10 Insertion rate per base | 0.16% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 142522 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 78681 % of reads mapped to too many loci | 1.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.59% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 718919 718919 718919 N_multimapping 142522 142522 142522 N_noFeature 132809 176296 4886510 N_ambiguous 75471 9789 460 UnstrandedReadsAssigned:4787949 PositiveStrandReadsAssigned:4810144 NegativeStrandReadsAssigned:109259 Dataset is classified positive stranded MeadianReadLen=101 20thPercentileLength=75 echo kmer=71 ERR1806581 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR1806581-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,857,670 reads, 4,968,184 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 968 rounds 52973 ERR1806581.ke.tsv 35125 ERR1806581.se.tsv 88098 total ==> ERR1806581.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 78.4024 28.3814 PNS24247 1044 945 15.8554 5.08364 PNS24249 1928 1829 51.0235 8.45251 PNS24246 1044 945 15.8554 5.08364 PNS24248 1044 945 15.8554 5.08364 PNS24244 1471 1372 51.0079 11.2645 PNS24243 293 194 0 0 KQK14069 1603 1504 1535.54 309.344 KQK14071 474 375 56.8675 45.9475 ==> ERR1806581.se.tsv <== BRADI_1g14170v3 1595 BRADI_1g53295v3 38 BRADI_1g59795v3 71 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 468 BRADI_1g74790v3 88 BRADI_1g09890v3 0 BRADI_1g77505v3 100 BRADI_1g48960v3 0 ERR1806581 completed mapping pipeline successfully