Starting /dee2/code/volunteer_pipeline.sh ERR1806582 current disk space = 1523776225280 free memory = 1365059384 ERR1806582 SRAfilesize fba7e0cafb468cf83222929325bc83f0 ERR1806582.sra ERR1806582.sra file validated ERR1806582 is single end ERR1806582 is conventional basespace ERR1806582 read1 length is 8-225 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1806582_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 8-225 %GC 51 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.80425 24.0 20.0 26.0 18.0 27.0 2 22.82425 24.0 20.0 26.0 16.0 27.0 3 22.6135 24.0 20.0 26.0 16.0 27.0 4 22.812 24.0 20.0 26.0 16.0 27.0 5 22.65325 24.0 20.0 26.0 16.0 27.0 6 22.75525 24.0 20.0 26.0 16.0 27.0 7 22.78025 24.0 20.0 26.0 16.0 28.0 8 22.993 24.0 20.0 26.0 16.0 28.0 9 22.884519038076153 24.0 20.0 26.0 16.0 28.0 10-14 23.057101002482007 24.0 20.0 26.2 16.0 28.0 15-19 23.361679430799192 25.0 21.0 27.0 16.8 28.0 20-24 23.51006308382337 25.0 21.0 27.0 17.2 28.0 25-29 23.619337328839435 25.0 21.0 27.0 18.0 28.0 30-34 23.569819916325724 25.0 21.0 27.0 17.8 28.0 35-39 23.67327504780493 25.0 21.0 27.0 18.0 28.0 40-44 23.671888439490942 25.0 21.0 27.0 17.8 28.0 45-49 23.56599825280438 25.0 21.0 27.0 17.2 28.0 50-54 23.594079488868868 25.0 21.0 27.0 17.8 28.0 55-59 23.689351407639673 25.0 21.0 27.0 17.8 28.0 60-64 23.65606095581412 25.0 21.0 27.0 17.6 28.0 65-69 23.653943737344587 25.0 21.0 27.0 17.6 28.0 70-74 23.693012913871435 25.0 21.0 27.0 18.0 28.0 75-79 23.623960998116104 25.0 21.0 27.0 18.0 28.0 80-84 23.533553578186684 25.0 21.0 26.6 17.4 28.0 85-89 23.535154953374985 25.0 21.0 26.2 17.8 27.6 90-94 23.567238403811167 25.0 21.0 26.6 17.8 28.0 95-99 23.44069708979844 25.0 21.0 26.0 17.8 28.0 100-104 23.317451015103984 25.0 20.8 26.0 17.4 27.4 105-109 23.418402160368238 25.0 21.0 26.0 17.6 27.0 110-114 23.443744509511237 25.0 21.0 26.0 17.8 27.4 115-119 23.24196818288587 24.4 20.4 26.0 17.2 27.4 120-124 22.899932559715303 24.2 20.0 26.0 16.4 27.0 125-129 22.794509734476673 24.0 20.2 26.0 16.4 27.0 130-134 22.757560151718014 23.8 20.0 26.0 16.2 27.0 135-139 22.68691653530373 24.0 20.0 26.0 16.8 27.0 140-144 22.577270384957096 23.8 19.8 26.0 16.2 27.0 145-149 22.54930786168297 23.6 20.0 26.0 16.6 27.0 150-154 22.241196758808154 23.0 19.6 25.4 16.2 26.8 155-159 21.90315971762461 22.6 19.6 25.0 15.0 26.6 160-164 21.556297811533817 22.4 19.2 24.8 14.0 26.2 165-169 21.2661996796109 22.0 18.2 24.8 14.0 26.2 170-174 21.618022238880563 NaN NaN NaN NaN NaN 175-179 21.569837988098858 NaN NaN NaN NaN NaN 180-184 21.665442830085745 NaN NaN NaN NaN NaN 185-189 20.24110530995054 NaN NaN NaN NaN NaN 190-194 19.66707395797051 NaN NaN NaN NaN NaN 195-199 19.652902192705664 NaN NaN NaN NaN NaN 200-204 20.387878787878787 NaN NaN NaN NaN NaN 205-209 18.361111111111107 NaN NaN NaN NaN NaN 210-214 16.995238095238097 NaN NaN NaN NaN NaN 215-219 19.32 NaN NaN NaN NaN NaN 220-224 18.65 NaN NaN NaN NaN NaN 225 19.0 NaN NaN NaN NaN NaN >>END_MODULE >>Per sequence quality scores warn #Quality Count 10 2.0 11 3.0 12 3.0 13 15.0 14 22.0 15 26.0 16 51.0 17 97.0 18 112.0 19 153.0 20 183.0 21 268.0 22 372.0 23 699.0 24 1042.0 25 809.0 26 141.0 27 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.65 45.074999999999996 16.925 14.35 2 40.400000000000006 35.85 5.925 17.825 3 31.0 30.825000000000003 19.825 18.35 4 36.875 27.1 15.725 20.3 5 28.000000000000004 27.0 17.8 27.200000000000003 6 26.575 28.199999999999996 19.7 25.525 7 23.65 30.099999999999998 22.8 23.45 8 25.724999999999998 25.2 24.05 25.025 9 25.876753507014026 23.52204408817635 24.19839679358717 26.402805611222448 10-14 26.95796794677956 24.28182642878742 23.85848200786211 24.90172361657091 15-19 27.955500871526713 24.85389111042756 22.49564236645135 24.69496565159438 20-24 28.040733620824028 24.253130357977867 22.839923104899466 24.866212916298643 25-29 26.833753678015977 24.978982765868015 23.239806641445988 24.94745691467003 30-34 27.81922830952889 24.403112342784055 22.857599658921337 24.920059688765722 35-39 26.70787247885491 23.65538928648883 23.67707655606159 25.959661678594664 40-44 27.422566371681416 24.413716814159294 23.346238938053094 24.817477876106196 45-49 27.430358158044342 24.26378624218306 23.41671404206936 24.88914155770324 50-54 27.095711512441905 23.954350255897406 23.489617036296252 25.460321195364433 55-59 25.966986942596698 25.043114067504312 23.392461197339244 25.597437792559745 60-64 26.292207792207794 24.006493506493506 24.25974025974026 25.441558441558442 65-69 27.070552147239262 23.487172336865587 23.654489682097044 25.787785833798104 70-74 27.125075895567697 23.960230722525804 24.058894960534303 24.855798421372192 75-79 25.51758543277625 24.85241539868629 24.07084060863058 25.559158559906876 80-84 26.348970888188394 24.26293343222696 24.522529204524385 24.865566475060263 85-89 26.289774482545567 24.7451343836886 24.446503964576255 24.51858716918958 90-94 25.886483323581043 24.2715038033938 24.119368051492103 25.72264482153306 95-99 25.448899689482925 25.205886323747805 24.368840286215743 24.97637370055353 100-104 25.88014395243311 25.176028790486622 24.190267563761537 24.75355969331873 105-109 25.246800731261427 24.29616087751371 24.93601462522852 25.521023765996343 110-114 25.68866111467008 24.556907964979715 24.83450779414905 24.919923126201155 115-119 25.792759051186014 24.344569288389515 24.64419475655431 25.21847690387016 120-124 25.238095238095237 25.476190476190474 24.732142857142858 24.553571428571427 125-129 26.025459688826025 25.636492220650638 23.302687411598303 25.035360678925034 130-134 26.202749140893474 25.171821305841924 24.22680412371134 24.398625429553263 135-139 25.673534072900157 24.933967247754886 24.458531431590067 24.933967247754886 140-144 24.59016393442623 23.081967213114755 26.360655737704917 25.967213114754102 145-149 25.991902834008094 27.044534412955468 24.291497975708502 22.672064777327936 150-154 27.876984126984127 24.702380952380953 23.71031746031746 23.71031746031746 155-159 22.835633626097867 25.59598494353827 25.84692597239649 25.72145545796738 160-164 26.395173453996986 24.8868778280543 26.244343891402718 22.473604826546005 165-169 22.0 26.36363636363636 24.363636363636363 27.27272727272727 170-174 24.651162790697676 27.209302325581397 23.488372093023255 24.651162790697676 175-179 27.21518987341772 28.164556962025316 22.468354430379748 22.151898734177212 180-184 25.6 23.599999999999998 26.8 24.0 185-189 30.412371134020617 23.195876288659793 18.556701030927837 27.835051546391753 190-194 29.166666666666668 21.52777777777778 27.083333333333332 22.22222222222222 195-199 21.568627450980394 28.431372549019606 21.568627450980394 28.431372549019606 200-204 26.31578947368421 21.052631578947366 28.07017543859649 24.561403508771928 205-209 30.23255813953488 20.930232558139537 34.883720930232556 13.953488372093023 210-214 27.27272727272727 27.27272727272727 36.36363636363637 9.090909090909092 215-219 21.73913043478261 30.434782608695656 13.043478260869565 34.78260869565217 220-224 33.33333333333333 16.666666666666664 16.666666666666664 33.33333333333333 225 0.0 0.0 0.0 100.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 1.0 2 1.0 3 1.0 4 1.0 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 3.5 18 6.0 19 6.5 20 6.0 21 6.0 22 7.5 23 9.5 24 10.0 25 12.5 26 14.5 27 15.5 28 18.5 29 19.0 30 20.0 31 21.5 32 23.0 33 27.5 34 35.0 35 45.5 36 53.5 37 73.5 38 99.5 39 107.33333333333333 40 121.0 41 146.66666666666669 42 156.66666666666666 43 181.0 44 204.83333333333334 45 228.33333333333334 46 239.66666666666669 47 230.66666666666669 48 238.16666666666666 49 235.16666666666669 50 233.5 51 248.16666666666669 52 240.0 53 218.0 54 218.5 55 207.33333333333334 56 191.33333333333331 57 184.0 58 166.0 59 151.5 60 160.0 61 161.83333333333331 62 158.33333333333331 63 147.33333333333331 64 134.0 65 127.5 66 110.5 67 104.0 68 105.0 69 95.0 70 75.5 71 55.5 72 44.5 73 42.5 74 30.5 75 17.5 76 13.5 77 13.5 78 12.0 79 8.0 80 5.0 81 3.5 82 3.5 83 4.0 84 5.5 85 7.0 86 6.5 87 6.0 88 5.0 89 2.5 90 1.0 91 1.0 92 1.0 93 1.0 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-159 0.0 160-164 0.0 165-169 0.0 170-174 0.0 175-179 0.0 180-184 0.0 185-189 0.0 190-194 0.0 195-199 0.0 200-204 0.0 205-209 0.0 210-214 0.0 215-219 0.0 220-224 0.0 225 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 5-9 13.0 10-14 62.0 15-19 56.0 20-24 47.0 25-29 49.0 30-34 55.0 35-39 68.0 40-44 89.0 45-49 106.0 50-54 148.0 55-59 150.0 60-64 200.0 65-69 227.0 70-74 219.0 75-79 259.0 80-84 230.0 85-89 215.0 90-94 244.0 95-99 205.0 100-104 192.0 105-109 167.0 110-114 147.0 115-119 126.0 120-124 122.0 125-129 100.0 130-134 91.0 135-139 80.0 140-144 65.0 145-149 50.0 150-154 46.0 155-159 29.0 160-164 23.0 165-169 24.0 170-174 27.0 175-179 16.0 180-184 7.0 185-189 13.0 190-194 10.0 195-199 7.0 200-204 7.0 205-209 2.0 210-214 2.0 215-219 1.0 220-224 3.0 225-226 1.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24050632911391 98.0 2 0.6835443037974683 1.35 3 0.025316455696202535 0.075 4 0.0 0.0 5 0.025316455696202535 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025316455696202535 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACTCCAAGATCATCAACGACAGGGAGACTGGCCGTTCCCGCGGGTTCGGC 18 0.44999999999999996 No Hit GGAGATGGAGGTCTGTGACTTCGACTTTGAGCCCTGCGGCTACTCCATGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.0 0.0 0.0 0.0 0.0 80-84 0.0 0.0 0.0 0.0 0.0 85-89 0.0 0.0 0.0 0.0 0.0 90-94 0.0 0.0 0.0 0.0 0.0 95-99 0.0 0.0 0.0 0.0 0.0 100-104 0.0 0.0 0.0 0.0 0.0 105-109 0.0 0.0 0.0 0.0 0.0 110-114 0.0 0.0 0.0 0.0 0.0 115-119 0.0 0.0 0.0 0.0 0.0 120-124 0.0 0.0 0.0 0.0 0.0 125-129 0.0 0.0 0.0 0.0 0.0 130-134 0.0 0.0 0.0 0.0 0.0 135-139 0.0 0.0 0.0 0.0 0.0 140-144 0.0 0.0 0.0 0.0 0.0 145-149 0.0 0.0 0.0 0.0 0.0 150-154 0.0 0.0 0.0 0.0 0.0 155-159 0.0 0.0 0.0 0.0 0.0 160-164 0.0 0.0 0.0 0.0 0.0 165-169 0.0 0.0 0.0 0.0 0.0 170-174 0.0 0.0 0.0 0.0 0.0 175-179 0.0 0.0 0.0 0.0 0.0 180-184 0.0 0.0 0.0 0.0 0.0 185-189 0.0 0.0 0.0 0.0 0.0 190-194 0.0 0.0 0.0 0.0 0.0 195-199 0.0 0.0 0.0 0.0 0.0 200-204 0.0 0.0 0.0 0.0 0.0 205-209 0.0 0.0 0.0 0.0 0.0 210-213 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACATCA 5 3.6367716E-4 3356.0 195-196 TCACATC 5 3.6367716E-4 3356.0 195-196 GTTCACC 5 0.0010909231 2237.3333 160-164 GCCCAGC 10 0.0014547086 1678.0 185-189 ATGATCG 10 0.0014547086 1678.0 170-174 ATCAGTG 10 0.0014547086 1678.0 180-184 CCATTCA 10 0.0014547086 1678.0 190-194 TTCACAT 5 0.0036356882 1342.4 190-194 ACCATTC 5 0.0036356882 1342.4 190-194 ATTCACA 5 0.0036356882 1342.4 190-194 GGGCCGG 5 0.0036356882 1342.4 150-154 CCCAGCC 5 0.0054529905 1118.6666 185-189 ATCCATG 10 0.0087247845 839.0 165-169 GCCAGCC 10 0.0087247845 839.0 180-184 TTTATTG 10 0.0028168147 191.77142 135-139 GCAGATC 10 0.005301794 156.09302 120-124 CAGATCT 10 0.009475274 129.07692 120-124 TTATTGC 15 0.009472828 127.84761 135-139 >>END_MODULE Read 332323 spots for ERR1806582.sra Written 332323 spots for ERR1806582.sra Read 332323 spots for ERR1806582.sra Written 332323 spots for ERR1806582.sra Read 332323 spots for ERR1806582.sra Written 332323 spots for ERR1806582.sra Read 332323 spots for ERR1806582.sra Written 332323 spots for ERR1806582.sra Read 332329 spots for ERR1806582.sra Written 332329 spots for ERR1806582.sra Read 332323 spots for ERR1806582.sra Written 332323 spots for ERR1806582.sra Read 332323 spots for ERR1806582.sra Written 332323 spots for ERR1806582.sra Read 332323 spots for ERR1806582.sra Written 332323 spots for ERR1806582.sra Read 332323 spots for ERR1806582.sra Written 332323 spots for ERR1806582.sra Read 332323 spots for ERR1806582.sra Written 332323 spots for ERR1806582.sra Read 332323 spots for ERR1806582.sra Written 332323 spots for ERR1806582.sra Read 332323 spots for ERR1806582.sra Written 332323 spots for ERR1806582.sra Read 332323 spots for ERR1806582.sra Written 332323 spots for ERR1806582.sra Read 332323 spots for ERR1806582.sra Written 332323 spots for ERR1806582.sra Read 332323 spots for ERR1806582.sra Written 332323 spots for ERR1806582.sra Read 332323 spots for ERR1806582.sra Written 332323 spots for ERR1806582.sra Read 332323 spots for ERR1806582.sra Written 332323 spots for ERR1806582.sra Read 332323 spots for ERR1806582.sra Written 332323 spots for ERR1806582.sra Read 332323 spots for ERR1806582.sra Written 332323 spots for ERR1806582.sra Read 332323 spots for ERR1806582.sra Written 332323 spots for ERR1806582.sra SRR ids: ['ERR1806582.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6nlbqu1y ERR1806582.sra spots: 6646466 blocks: [[1, 332323], [332324, 664646], [664647, 996969], [996970, 1329292], [1329293, 1661615], [1661616, 1993938], [1993939, 2326261], [2326262, 2658584], [2658585, 2990907], [2990908, 3323230], [3323231, 3655553], [3655554, 3987876], [3987877, 4320199], [4320200, 4652522], [4652523, 4984845], [4984846, 5317168], [5317169, 5649491], [5649492, 5981814], [5981815, 6314137], [6314138, 6646466]] ERR1806582 file size 1413961 ERR1806582 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1806582 ERR1806582_1.fastq Input file: ERR1806582_1.fastq trimmed: ERR1806582-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 17:11:43 2024 >> started Mon Dec 9 17:12:00 2024 >> done (17.078s) 6646466 reads processed; of these: 160187 ( 2.41%) short reads filtered out after trimming by size control 13 ( 0.00%) empty reads filtered out after trimming by size control 6486266 (97.59%) reads available; of these: 99617 ( 1.54%) trimmed reads available after processing 6386649 (98.46%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 15236 0.23% 19 14686 0.23% 20 14443 0.22% 21 14557 0.22% 22 14249 0.22% 23 14590 0.22% 24 15627 0.24% 25 15114 0.23% 26 15331 0.24% 27 16530 0.25% 28 16861 0.26% 29 16655 0.26% 30 18453 0.28% 31 18360 0.28% 32 18890 0.29% 33 20313 0.31% 34 21083 0.33% 35 20915 0.32% 36 22675 0.35% 37 22368 0.34% 38 23807 0.37% 39 26325 0.41% 40 26011 0.40% 41 26933 0.42% 42 31118 0.48% 43 30044 0.46% 44 31260 0.48% 45 34639 0.53% 46 35353 0.55% 47 36571 0.56% 48 39706 0.61% 49 40366 0.62% 50 41761 0.64% 51 45635 0.70% 52 46154 0.71% 53 46917 0.72% 54 50974 0.79% 55 52455 0.81% 56 53608 0.83% 57 57342 0.88% 58 57978 0.89% 59 60421 0.93% 60 64223 0.99% 61 65440 1.01% 62 64929 1.00% 63 71247 1.10% 64 68922 1.06% 65 68770 1.06% 66 71264 1.10% 67 72151 1.11% 68 73493 1.13% 69 76679 1.18% 70 76932 1.19% 71 77343 1.19% 72 80647 1.24% 73 76648 1.18% 74 78658 1.21% 75 79338 1.22% 76 80519 1.24% 77 88882 1.37% 78 88290 1.36% 79 79504 1.23% 80 78188 1.21% 81 79276 1.22% 82 81990 1.26% 83 78448 1.21% 84 79347 1.22% 85 78273 1.21% 86 74823 1.15% 87 76778 1.18% 88 75467 1.16% 89 74398 1.15% 90 75724 1.17% 91 72049 1.11% 92 71853 1.11% 93 74905 1.15% 94 70659 1.09% 95 69208 1.07% 96 69837 1.08% 97 65866 1.02% 98 66130 1.02% 99 65781 1.01% 100 64636 1.00% 101 63453 0.98% 102 62952 0.97% 103 61841 0.95% 104 58944 0.91% 105 58272 0.90% 106 55571 0.86% 107 55134 0.85% 108 54480 0.84% 109 54593 0.84% 110 51338 0.79% 111 50867 0.78% 112 50068 0.77% 113 47938 0.74% 114 48149 0.74% 115 45916 0.71% 116 44523 0.69% 117 44134 0.68% 118 42608 0.66% 119 41007 0.63% 120 40330 0.62% 121 38589 0.59% 122 37765 0.58% 123 36773 0.57% 124 35195 0.54% 125 34492 0.53% 126 34410 0.53% 127 32512 0.50% 128 31625 0.49% 129 31008 0.48% 130 29924 0.46% 131 28534 0.44% 132 28435 0.44% 133 27043 0.42% 134 26478 0.41% 135 25874 0.40% 136 24310 0.37% 137 23747 0.37% 138 23856 0.37% 139 22782 0.35% 140 22130 0.34% 141 21064 0.32% 142 19791 0.31% 143 19335 0.30% 144 18808 0.29% 145 18316 0.28% 146 17465 0.27% 147 17123 0.26% 148 16381 0.25% 149 15672 0.24% 150 15373 0.24% 151 14578 0.22% 152 14130 0.22% 153 13961 0.22% 154 13462 0.21% 155 13506 0.21% 156 12781 0.20% 157 12246 0.19% 158 11572 0.18% 159 11176 0.17% 160 10841 0.17% 161 10341 0.16% 162 10311 0.16% 163 9772 0.15% 164 9430 0.15% 165 8980 0.14% 166 8764 0.14% 167 8442 0.13% 168 8230 0.13% 169 7865 0.12% 170 7392 0.11% 171 7340 0.11% 172 7095 0.11% 173 6820 0.11% 174 6471 0.10% 175 6153 0.09% 176 5947 0.09% 177 5939 0.09% 178 5488 0.08% 179 5244 0.08% 180 5135 0.08% 181 5002 0.08% 182 4694 0.07% 183 4480 0.07% 184 4394 0.07% 185 4211 0.06% 186 4131 0.06% 187 3911 0.06% 188 3734 0.06% 189 3731 0.06% 190 3439 0.05% 191 3307 0.05% 192 3220 0.05% 193 3057 0.05% 194 2992 0.05% 195 2874 0.04% 196 2755 0.04% 197 2682 0.04% 198 2455 0.04% 199 2452 0.04% 200 2357 0.04% 201 2272 0.04% 202 2087 0.03% 203 2001 0.03% 204 1946 0.03% 205 1854 0.03% 206 1758 0.03% 207 1705 0.03% 208 1673 0.03% 209 1447 0.02% 210 1446 0.02% 211 1383 0.02% 212 1312 0.02% 213 1214 0.02% 214 1157 0.02% 215 1134 0.02% 216 1053 0.02% 217 1055 0.02% 218 908 0.01% 219 868 0.01% 220 864 0.01% 221 761 0.01% 222 763 0.01% 223 691 0.01% 224 622 0.01% 225 656 0.01% 226 602 0.01% 227 525 0.01% 228 494 0.01% 229 449 0.01% 230 378 0.01% 231 406 0.01% 232 395 0.01% 233 338 0.01% 234 300 0.00% 235 300 0.00% 236 313 0.00% 237 249 0.00% 238 268 0.00% 239 215 0.00% 240 208 0.00% 241 192 0.00% 242 186 0.00% 243 168 0.00% 244 151 0.00% 245 147 0.00% 246 121 0.00% 247 114 0.00% 248 92 0.00% 249 101 0.00% 250 82 0.00% 251 81 0.00% 252 79 0.00% 253 72 0.00% 254 57 0.00% 255 45 0.00% 256 58 0.00% 257 52 0.00% 258 33 0.00% 259 33 0.00% 260 30 0.00% 261 29 0.00% 262 22 0.00% 263 29 0.00% 264 22 0.00% 265 16 0.00% 266 19 0.00% 267 15 0.00% 268 16 0.00% 269 4 0.00% 270 14 0.00% 271 13 0.00% 272 10 0.00% 273 11 0.00% 274 3 0.00% 275 6 0.00% 276 7 0.00% 277 3 0.00% 278 5 0.00% 279 1 0.00% 280 2 0.00% 281 1 0.00% 282 0 0.00% 283 0 0.00% 284 1 0.00% 285 2 0.00% 286 0 0.00% 287 1 0.00% 288 0 0.00% 289 1 0.00% 290 0 0.00% 291 0 0.00% 292 1 0.00% 293 0 0.00% 294 1 0.00% 6486266 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=5.28 fanout-score-rank=23 prefix-density=0.29 prefix-fanout=4.1 sequence=GGCAAGACCATCAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=269.18 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=16.5 sequence=GCAGCAGCAGAGAGCCGGAGCGCCACCAGCCATCCGATCAAAACACACAGATCAATCCGATGGCTCTCGCTCTCTCCGGTTCCTCGGCTGCTGCCCGCGCGCTGGCCCAGCTGCTGGCCCCGTCCACCAGAAG Started job on | Dec 09 17:13:31 Started mapping on | Dec 09 17:13:31 Finished on | Dec 09 17:14:20 Mapping speed, Million of reads per hour | 476.54 Number of input reads | 6486266 Average input read length | 89 UNIQUE READS: Uniquely mapped reads number | 5244709 Uniquely mapped reads % | 80.86% Average mapped length | 83.70 Number of splices: Total | 1462334 Number of splices: Annotated (sjdb) | 1376935 Number of splices: GT/AG | 1430894 Number of splices: GC/AG | 16495 Number of splices: AT/AC | 1243 Number of splices: Non-canonical | 13702 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.14% Deletion average length | 1.10 Insertion rate per base | 0.13% Insertion average length | 1.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 166607 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 65865 % of reads mapped to too many loci | 1.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 15.38% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1074950 1074950 1074950 N_multimapping 166607 166607 166607 N_noFeature 151535 192187 5139407 N_ambiguous 74087 9883 488 UnstrandedReadsAssigned:5019087 PositiveStrandReadsAssigned:5042639 NegativeStrandReadsAssigned:104814 Dataset is classified positive stranded MeadianReadLen=86 20thPercentileLength=61 echo kmer=57 ERR1806582 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR1806582-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,486,266 reads, 5,240,850 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,054 rounds 52973 ERR1806582.ke.tsv 35125 ERR1806582.se.tsv 88098 total ==> ERR1806582.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 110.544 37.745 PNS24247 1044 945 8.1634 2.46883 PNS24249 1928 1829 64.035 10.0059 PNS24246 1044 945 8.1634 2.46883 PNS24248 1044 945 8.1634 2.46883 PNS24244 1471 1372 49.9312 10.4009 PNS24243 293 194 0 0 KQK14069 1603 1504 1741.81 330.983 KQK14071 474 375 203.685 155.231 ==> ERR1806582.se.tsv <== BRADI_1g14170v3 1974 BRADI_1g53295v3 35 BRADI_1g59795v3 77 BRADI_1g07683v3 1 BRADI_1g00485v3 8 BRADI_1g20270v3 478 BRADI_1g74790v3 82 BRADI_1g09890v3 0 BRADI_1g77505v3 119 BRADI_1g48960v3 2 ERR1806582 completed mapping pipeline successfully