Starting /dee2/code/volunteer_pipeline.sh ERR2276344 current disk space = 1548957077504 free memory = 1598461028 ERR2276344 SRAfilesize 43467bf47619daaf73f041582bd77597 ERR2276344.sra ERR2276344.sra file validated ERR2276344 is single end ERR2276344 is conventional basespace ERR2276344 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR2276344_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.53625 34.0 31.0 34.0 30.0 34.0 2 31.85825 34.0 31.0 34.0 30.0 34.0 3 32.04825 34.0 31.0 34.0 30.0 34.0 4 35.362 37.0 37.0 37.0 35.0 37.0 5 35.20425 37.0 37.0 37.0 33.0 37.0 6 35.119 37.0 36.0 37.0 33.0 37.0 7 35.14875 37.0 35.0 37.0 33.0 37.0 8 35.0905 37.0 35.0 37.0 33.0 37.0 9 36.856 39.0 39.0 39.0 34.0 39.0 10 36.812 39.0 38.0 39.0 34.0 39.0 11 36.84975 39.0 39.0 39.0 34.0 39.0 12 36.6735 39.0 38.0 39.0 33.0 39.0 13 36.65275 39.0 38.0 39.0 33.0 39.0 14 38.08525 41.0 39.0 41.0 33.0 41.0 15 37.964 41.0 39.0 41.0 33.0 41.0 16 37.95325 41.0 39.0 41.0 33.0 41.0 17 37.8945 41.0 39.0 41.0 33.0 41.0 18 37.814 41.0 39.0 41.0 33.0 41.0 19 37.75225 41.0 39.0 41.0 33.0 41.0 20 37.739 41.0 39.0 41.0 33.0 41.0 21 37.5665 41.0 38.0 41.0 32.0 41.0 22 37.30425 41.0 38.0 41.0 31.0 41.0 23 37.27175 40.0 38.0 41.0 32.0 41.0 24 36.918 40.0 38.0 41.0 30.0 41.0 25 36.83725 40.0 38.0 41.0 30.0 41.0 26 36.7345 40.0 38.0 41.0 30.0 41.0 27 36.63625 40.0 38.0 41.0 30.0 41.0 28 36.9315 40.0 38.0 41.0 30.0 41.0 29 36.9655 40.0 38.0 41.0 30.0 41.0 30 36.7865 40.0 38.0 41.0 30.0 41.0 31 36.8915 40.0 38.0 41.0 30.0 41.0 32 36.78225 40.0 38.0 41.0 30.0 41.0 33 36.64475 40.0 38.0 41.0 30.0 41.0 34 36.58 40.0 38.0 41.0 30.0 41.0 35 36.418 40.0 37.0 41.0 30.0 41.0 36 36.26425 40.0 37.0 41.0 28.0 41.0 37 36.24875 40.0 37.0 41.0 28.0 41.0 38 36.1155 40.0 37.0 41.0 28.0 41.0 39 35.96125 40.0 37.0 41.0 27.0 41.0 40 35.86925 40.0 36.0 41.0 27.0 41.0 41 35.6865 40.0 36.0 41.0 26.0 41.0 42 35.429 40.0 35.0 41.0 25.0 41.0 43 35.288 40.0 35.0 41.0 24.0 41.0 44 35.13775 40.0 35.0 41.0 23.0 41.0 45 34.882 40.0 35.0 41.0 22.0 41.0 46 34.72425 39.0 35.0 41.0 22.0 41.0 47 34.3765 39.0 35.0 41.0 18.0 41.0 48 34.30275 39.0 35.0 41.0 12.0 41.0 49 34.1415 39.0 34.0 41.0 2.0 41.0 50 33.95525 39.0 34.0 41.0 2.0 41.0 51 33.221 38.0 33.0 40.0 2.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 87.0 3 6.0 4 4.0 5 7.0 6 9.0 7 11.0 8 9.0 9 7.0 10 5.0 11 2.0 12 9.0 13 8.0 14 4.0 15 12.0 16 8.0 17 10.0 18 6.0 19 9.0 20 13.0 21 20.0 22 20.0 23 15.0 24 13.0 25 22.0 26 29.0 27 28.0 28 26.0 29 30.0 30 46.0 31 51.0 32 57.0 33 74.0 34 83.0 35 142.0 36 222.0 37 352.0 38 560.0 39 1976.0 40 8.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.296934380542183 11.147707119331137 8.96883709146187 55.586521408664815 2 27.375 19.2 30.25 23.175 3 24.825 21.224999999999998 22.85 31.1 4 27.625 27.125 16.2 29.049999999999997 5 32.125 28.025 21.099999999999998 18.75 6 26.85 30.625000000000004 20.375 22.15 7 22.650000000000002 17.75 34.050000000000004 25.55 8 22.55 21.65 25.674999999999997 30.125 9 24.25 19.575 28.425 27.750000000000004 10 24.9 31.8 22.400000000000002 20.9 11 30.45 21.175 17.349999999999998 31.025000000000002 12 24.474999999999998 20.825 24.675 30.025000000000002 13 23.400000000000002 24.2 25.6 26.8 14 25.474999999999998 23.25 22.95 28.325 15 23.625 25.05 25.0 26.325 16 26.775 22.425 21.675 29.125 17 27.575 24.675 20.375 27.375 18 24.85 24.875 25.074999999999996 25.2 19 25.525 22.675 23.674999999999997 28.125 20 28.1 22.7 23.65 25.55 21 26.875 24.775 23.35 25.0 22 26.224999999999998 24.825 21.65 27.3 23 26.974999999999998 27.05 21.525 24.45 24 24.275 24.9 23.425 27.400000000000002 25 26.150000000000002 22.675 24.175 27.0 26 25.95 23.150000000000002 23.575 27.325 27 25.45 25.15 21.825 27.575 28 25.4 25.6 22.0 27.0 29 27.700000000000003 24.2 22.2 25.900000000000002 30 26.025 23.474999999999998 23.1 27.400000000000002 31 25.275 23.875 23.025000000000002 27.825 32 28.449999999999996 24.75 22.925 23.875 33 24.375 23.275000000000002 23.674999999999997 28.675 34 27.075 24.474999999999998 22.025 26.424999999999997 35 25.3 26.825 21.75 26.125 36 24.031007751937985 25.331332833208304 24.431107776944234 26.206551637909474 37 26.325 23.175 21.525 28.975 38 27.1 24.5 22.3 26.1 39 26.875 22.975 24.05 26.1 40 25.575 24.175 22.2 28.050000000000004 41 26.05 23.724999999999998 24.224999999999998 26.0 42 25.35 23.275000000000002 23.7 27.675 43 26.138069034517258 21.860930465232617 24.937468734367183 27.063531765882942 44 25.93148287071768 24.131032758189548 22.005501375343837 27.93198299574894 45 26.638319159579787 23.28664332166083 23.23661830915458 26.8384192096048 46 25.64423317488116 22.091568676507382 26.1195896922692 26.144608456342254 47 25.662831415707853 25.237618809404704 22.861430715357677 26.23811905952976 48 24.924924924924923 24.3993993993994 24.274274274274273 26.401401401401404 49 28.982245561390346 22.88072018004501 20.830207551887973 27.306826706676667 50 27.400000000000002 22.95 22.625 27.025 51 25.674999999999997 22.75 25.0 26.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 2.0 22 4.0 23 2.5 24 1.0 25 3.5 26 6.5 27 7.0 28 11.5 29 16.0 30 27.5 31 39.0 32 50.0 33 61.0 34 78.0 35 95.0 36 107.5 37 120.0 38 128.5 39 137.0 40 162.5 41 188.0 42 198.0 43 208.0 44 225.0 45 242.0 46 249.5 47 257.0 48 261.0 49 265.0 50 261.5 51 258.0 52 290.5 53 323.0 54 277.0 55 231.0 56 216.0 57 201.0 58 207.5 59 214.0 60 197.0 61 180.0 62 174.0 63 168.0 64 170.0 65 172.0 66 152.5 67 133.0 68 127.0 69 121.0 70 109.5 71 98.0 72 83.5 73 69.0 74 62.5 75 52.5 76 49.0 77 38.5 78 28.0 79 26.0 80 24.0 81 18.5 82 13.0 83 10.0 84 7.0 85 5.0 86 3.0 87 2.5 88 2.0 89 1.5 90 1.0 91 0.5 92 0.0 93 0.5 94 1.0 95 0.5 96 0.0 97 0.5 98 1.0 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.025 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.05 44 0.025 45 0.05 46 0.075 47 0.05 48 0.1 49 0.025 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.20246977103164 96.39999999999999 2 0.6688963210702341 1.3 3 0.02572678157962439 0.075 4 0.05145356315924878 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02572678157962439 0.625 >50 0.02572678157962439 1.4000000000000001 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCC 56 1.4000000000000001 TruSeq Adapter, Index 9 (100% over 51bp) CGTATGCCGTCTTCTGCTTGAGATCGGAAGAGCACACGTCTGAACTCCAGT 25 0.625 Illumina Multiplexing PCR Primer 2.01 (100% over 31bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10 0.125 0.0 0.0 0.0 0.0 11 0.175 0.0 0.0 0.0 0.0 12 0.175 0.0 0.0 0.0 0.0 13 0.175 0.0 0.0 0.0 0.0 14 0.175 0.0 0.0 0.0 0.0 15 0.2 0.0 0.0 0.0 0.0 16 0.2 0.0 0.0 0.0 0.0 17 0.2 0.0 0.0 0.0 0.0 18 0.2 0.0 0.0 0.0 0.0 19 0.2 0.0 0.0 0.0 0.0 20 0.225 0.0 0.0 0.0 0.0 21 0.95 0.0 0.0 0.0 0.0 22 1.025 0.0 0.0 0.0 0.0 23 1.05 0.0 0.0 0.0 0.0 24 1.05 0.0 0.0 0.0 0.0 25 1.05 0.0 0.0 0.0 0.0 26 1.05 0.0 0.0 0.0 0.0 27 1.05 0.0 0.0 0.0 0.0 28 1.075 0.0 0.0 0.0 0.0 29 1.075 0.0 0.0 0.0 0.0 30 1.075 0.0 0.0 0.0 0.0 31 1.1 0.0 0.0 0.0 0.0 32 1.1 0.0 0.0 0.0 0.0 33 1.1 0.0 0.0 0.0 0.0 34 1.1 0.0 0.0 0.0 0.0 35 1.1 0.0 0.0 0.0 0.0 36 1.125 0.0 0.0 0.0 0.0 37 1.125 0.0 0.0 0.0 0.0 38 1.125 0.0 0.0 0.0 0.0 39 1.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 710170 READS because READLEN < 1 Read 710170 spots for ERR2276344.sra Written 710170 spots for ERR2276344.sra Rejected 710170 READS because READLEN < 1 Read 710170 spots for ERR2276344.sra Written 710170 spots for ERR2276344.sra Rejected 710170 READS because READLEN < 1 Read 710170 spots for ERR2276344.sra Written 710170 spots for ERR2276344.sra Rejected 710170 READS because READLEN < 1 Read 710170 spots for ERR2276344.sra Written 710170 spots for ERR2276344.sra Rejected 710170 READS because READLEN < 1 Read 710170 spots for ERR2276344.sra Written 710170 spots for ERR2276344.sra Rejected 710170 READS because READLEN < 1 Read 710170 spots for ERR2276344.sra Written 710170 spots for ERR2276344.sra Rejected 710170 READS because READLEN < 1 Read 710170 spots for ERR2276344.sra Written 710170 spots for ERR2276344.sra Rejected 710170 READS because READLEN < 1 Read 710170 spots for ERR2276344.sra Written 710170 spots for ERR2276344.sra Rejected 710170 READS because READLEN < 1 Read 710170 spots for ERR2276344.sra Written 710170 spots for ERR2276344.sra Rejected 710170 READS because READLEN < 1 Read 710170 spots for ERR2276344.sra Written 710170 spots for ERR2276344.sra Rejected 710179 READS because READLEN < 1 Read 710179 spots for ERR2276344.sra Written 710179 spots for ERR2276344.sra Rejected 710170 READS because READLEN < 1 Read 710170 spots for ERR2276344.sra Written 710170 spots for ERR2276344.sra Rejected 710170 READS because READLEN < 1 Read 710170 spots for ERR2276344.sra Written 710170 spots for ERR2276344.sra Rejected 710170 READS because READLEN < 1 Read 710170 spots for ERR2276344.sra Written 710170 spots for ERR2276344.sra Rejected 710170 READS because READLEN < 1 Read 710170 spots for ERR2276344.sra Written 710170 spots for ERR2276344.sra Rejected 710170 READS because READLEN < 1 Read 710170 spots for ERR2276344.sra Written 710170 spots for ERR2276344.sra Rejected 710170 READS because READLEN < 1 Read 710170 spots for ERR2276344.sra Written 710170 spots for ERR2276344.sra Rejected 710170 READS because READLEN < 1 Read 710170 spots for ERR2276344.sra Written 710170 spots for ERR2276344.sra Rejected 710170 READS because READLEN < 1 Read 710170 spots for ERR2276344.sra Written 710170 spots for ERR2276344.sra Rejected 710170 READS because READLEN < 1 Read 710170 spots for ERR2276344.sra Written 710170 spots for ERR2276344.sra SRR ids: ['ERR2276344.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5yoyydlw ERR2276344.sra spots: 14203409 blocks: [[1, 710170], [710171, 1420340], [1420341, 2130510], [2130511, 2840680], [2840681, 3550850], [3550851, 4261020], [4261021, 4971190], [4971191, 5681360], [5681361, 6391530], [6391531, 7101700], [7101701, 7811870], [7811871, 8522040], [8522041, 9232210], [9232211, 9942380], [9942381, 10652550], [10652551, 11362720], [11362721, 12072890], [12072891, 12783060], [12783061, 13493230], [13493231, 14203409]] ERR2276344 file size 2003395 ERR2276344 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR2276344 ERR2276344_1.fastq Input file: ERR2276344_1.fastq trimmed: ERR2276344-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 21:33:38 2024 >> started Fri Dec 6 21:33:44 2024 >> done (6.564s) 14203409 reads processed; of these: 222145 ( 1.56%) short reads filtered out after trimming by size control 534556 ( 3.76%) empty reads filtered out after trimming by size control 13446708 (94.67%) reads available; of these: 1205580 ( 8.97%) trimmed reads available after processing 12241128 (91.03%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 16157 0.12% 19 18375 0.14% 20 17710 0.13% 21 19024 0.14% 22 16398 0.12% 23 19891 0.15% 24 17085 0.13% 25 18154 0.14% 26 18707 0.14% 27 19505 0.15% 28 19036 0.14% 29 21926 0.16% 30 21689 0.16% 31 22595 0.17% 32 24781 0.18% 33 25213 0.19% 34 27589 0.21% 35 27435 0.20% 36 28187 0.21% 37 30893 0.23% 38 33199 0.25% 39 34651 0.26% 40 37541 0.28% 41 40906 0.30% 42 45553 0.34% 43 49503 0.37% 44 57965 0.43% 45 59499 0.44% 46 65164 0.48% 47 74620 0.55% 48 84882 0.63% 49 93412 0.69% 50 98335 0.73% 51 12241128 91.03% 13446708 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=3.57 fanout-score-rank=9 prefix-density=1.23 prefix-fanout=1.1 sequence=CTTCTGCTTGAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=32 fanout-score=5.38 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=2.0 sequence=TCAAATGTACACACACGATATCCATAGGGACAAAGAGAAATAACAAACCGGAAAGGAAAAACGCAAAGCAAAATGCCATGGTTGACGAAACCGGGCTGGCATCTTATACATATATATAT Started job on | Dec 06 21:33:55 Started mapping on | Dec 06 21:33:55 Finished on | Dec 06 21:34:15 Mapping speed, Million of reads per hour | 2420.41 Number of input reads | 13446708 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 12373040 Uniquely mapped reads % | 92.02% Average mapped length | 49.85 Number of splices: Total | 1843201 Number of splices: Annotated (sjdb) | 1770322 Number of splices: GT/AG | 1817119 Number of splices: GC/AG | 23378 Number of splices: AT/AC | 757 Number of splices: Non-canonical | 1947 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.00% Deletion average length | 1.31 Insertion rate per base | 0.00% Insertion average length | 1.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 499998 % of reads mapped to multiple loci | 3.72% Number of reads mapped to too many loci | 190356 % of reads mapped to too many loci | 1.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.77% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 573670 573670 573670 N_multimapping 499998 499998 499998 N_noFeature 359668 6332638 6221921 N_ambiguous 196718 10888 8795 UnstrandedReadsAssigned:11816654 PositiveStrandReadsAssigned:6029514 NegativeStrandReadsAssigned:6142324 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 ERR2276344 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR2276344-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,446,708 reads, 11,670,240 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,085 rounds 52973 ERR2276344.ke.tsv 35125 ERR2276344.se.tsv 88098 total ==> ERR2276344.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 47.1218 7.03371 PNS24247 1044 945 11.7388 1.55195 PNS24249 1928 1829 60.0328 4.10074 PNS24246 1044 945 11.7388 1.55195 PNS24248 1044 945 11.7388 1.55195 PNS24244 1471 1372 3.62901 0.330462 PNS24243 293 194 0 0 KQK14069 1603 1504 4048.88 336.337 KQK14071 474 375 1125.88 375.101 ==> ERR2276344.se.tsv <== BRADI_1g14170v3 5912 BRADI_1g53295v3 105 BRADI_1g59795v3 136 BRADI_1g07683v3 0 BRADI_1g00485v3 11 BRADI_1g20270v3 338 BRADI_1g74790v3 428 BRADI_1g09890v3 0 BRADI_1g77505v3 235 BRADI_1g48960v3 0 ERR2276344 completed mapping pipeline successfully