Starting /dee2/code/volunteer_pipeline.sh ERR2276345 current disk space = 1548946743296 free memory = 1387450516 ERR2276345 SRAfilesize 0e4ad3da00698de8e48578f6bf29cc05 ERR2276345.sra ERR2276345.sra file validated ERR2276345 is single end ERR2276345 is conventional basespace ERR2276345 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR2276345_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.788 34.0 31.0 34.0 30.0 34.0 2 32.11375 34.0 31.0 34.0 30.0 34.0 3 32.37375 34.0 31.0 34.0 30.0 34.0 4 35.653 37.0 37.0 37.0 35.0 37.0 5 35.49475 37.0 37.0 37.0 35.0 37.0 6 35.43875 37.0 37.0 37.0 35.0 37.0 7 35.4315 37.0 37.0 37.0 35.0 37.0 8 35.38425 37.0 37.0 37.0 35.0 37.0 9 37.1815 39.0 39.0 39.0 35.0 39.0 10 37.16275 39.0 39.0 39.0 35.0 39.0 11 37.24075 39.0 39.0 39.0 35.0 39.0 12 37.08325 39.0 39.0 39.0 35.0 39.0 13 37.08075 39.0 38.0 39.0 34.0 39.0 14 38.59925 41.0 39.0 41.0 36.0 41.0 15 38.49275 41.0 39.0 41.0 35.0 41.0 16 38.4145 41.0 39.0 41.0 34.0 41.0 17 38.4035 41.0 39.0 41.0 35.0 41.0 18 38.25975 41.0 39.0 41.0 34.0 41.0 19 38.29375 41.0 39.0 41.0 34.0 41.0 20 38.24625 41.0 39.0 41.0 34.0 41.0 21 38.04925 41.0 39.0 41.0 34.0 41.0 22 37.91225 41.0 39.0 41.0 33.0 41.0 23 37.88575 41.0 38.0 41.0 33.0 41.0 24 37.736 40.0 38.0 41.0 33.0 41.0 25 37.48525 40.0 38.0 41.0 32.0 41.0 26 37.30575 40.0 38.0 41.0 31.0 41.0 27 37.183 40.0 38.0 41.0 31.0 41.0 28 37.323 40.0 38.0 41.0 31.0 41.0 29 37.42175 40.0 38.0 41.0 32.0 41.0 30 37.24575 40.0 38.0 41.0 31.0 41.0 31 37.311 40.0 38.0 41.0 31.0 41.0 32 37.2505 41.0 38.0 41.0 31.0 41.0 33 37.1305 40.0 38.0 41.0 31.0 41.0 34 37.07625 40.0 38.0 41.0 31.0 41.0 35 36.8795 40.0 38.0 41.0 30.0 41.0 36 36.762 40.0 38.0 41.0 30.0 41.0 37 36.646 40.0 37.0 41.0 30.0 41.0 38 36.49225 40.0 37.0 41.0 29.0 41.0 39 36.40175 40.0 37.0 41.0 28.0 41.0 40 36.353 40.0 37.0 41.0 29.0 41.0 41 36.15725 40.0 36.0 41.0 29.0 41.0 42 35.969 40.0 36.0 41.0 28.0 41.0 43 35.766 40.0 35.0 41.0 28.0 41.0 44 35.4715 40.0 35.0 41.0 26.0 41.0 45 35.304 40.0 35.0 41.0 24.0 41.0 46 35.1875 40.0 35.0 41.0 24.0 41.0 47 34.90575 40.0 35.0 41.0 22.0 41.0 48 34.6745 39.0 35.0 41.0 22.0 41.0 49 34.5215 39.0 35.0 41.0 20.0 41.0 50 34.33075 39.0 35.0 41.0 20.0 41.0 51 33.67475 38.0 34.0 40.0 2.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 66.0 3 6.0 4 3.0 5 3.0 6 3.0 7 4.0 8 4.0 9 7.0 10 3.0 11 4.0 12 7.0 13 8.0 14 9.0 15 10.0 16 10.0 17 8.0 18 9.0 19 15.0 20 12.0 21 17.0 22 15.0 23 15.0 24 14.0 25 15.0 26 19.0 27 24.0 28 25.0 29 31.0 30 33.0 31 54.0 32 44.0 33 96.0 34 110.0 35 141.0 36 204.0 37 322.0 38 569.0 39 2056.0 40 5.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.199797160243406 10.877281947261663 9.15314401622718 56.769776876267755 2 24.75 18.5 32.125 24.625 3 26.575 21.975 22.25 29.2 4 29.549999999999997 26.35 16.35 27.750000000000004 5 31.125000000000004 27.950000000000003 20.375 20.549999999999997 6 23.849999999999998 33.074999999999996 19.6 23.474999999999998 7 21.95 16.150000000000002 37.574999999999996 24.325 8 23.125 21.375 25.874999999999996 29.625 9 21.725 20.3 30.349999999999998 27.625 10 24.375 32.074999999999996 22.3 21.25 11 28.675 22.55 19.650000000000002 29.125 12 24.375 21.125 23.9 30.599999999999998 13 24.425 23.075000000000003 26.6 25.900000000000002 14 25.624999999999996 23.025000000000002 24.25 27.1 15 25.674999999999997 24.125 22.35 27.85 16 26.700000000000003 22.675 23.200000000000003 27.425 17 25.7 24.4 23.325000000000003 26.575 18 25.45 25.025 23.375 26.150000000000002 19 26.5 23.849999999999998 22.425 27.224999999999998 20 28.199999999999996 23.625 23.45 24.725 21 25.900000000000002 24.825 24.725 24.55 22 25.95 24.625 22.375 27.05 23 27.0 23.724999999999998 23.724999999999998 25.55 24 25.174999999999997 24.625 24.025 26.174999999999997 25 26.35 24.224999999999998 22.7 26.724999999999998 26 26.525 25.224999999999998 22.525000000000002 25.724999999999998 27 25.424999999999997 24.8 22.1 27.675 28 25.25 24.125 22.625 28.000000000000004 29 26.05 23.150000000000002 23.799999999999997 27.0 30 24.125 26.3 24.725 24.85 31 27.075 23.25 23.674999999999997 26.0 32 26.700000000000003 25.575 22.25 25.474999999999998 33 26.525 23.875 23.175 26.424999999999997 34 26.525 23.7 24.275 25.5 35 26.525 23.175 22.55 27.750000000000004 36 26.05 24.675 23.0 26.275 37 25.775 24.65 22.75 26.825 38 25.7 25.05 23.275000000000002 25.974999999999998 39 25.6 25.0 24.099999999999998 25.3 40 26.275 23.549999999999997 22.900000000000002 27.275 41 25.7 23.674999999999997 24.224999999999998 26.400000000000002 42 25.974999999999998 24.55 24.175 25.3 43 26.138069034517258 22.836418209104554 23.986993496748372 27.03851925962982 44 28.199999999999996 23.025000000000002 22.650000000000002 26.125 45 26.56992744558419 24.44333249937453 23.14235676757568 25.8443832874656 46 25.55055055055055 24.44944944944945 22.24724724724725 27.75275275275275 47 26.988494247123562 24.337168584292147 22.161080540270135 26.513256628314156 48 25.75719649561952 24.28035043804756 24.055068836045056 25.90738423028786 49 26.806701675418854 23.78094523630908 23.005751437859466 26.406601650412604 50 26.1 25.2 22.900000000000002 25.8 51 25.324999999999996 24.275 23.849999999999998 26.55 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 2.0 25 4.0 26 9.0 27 12.0 28 21.5 29 31.0 30 30.0 31 29.0 32 45.0 33 61.0 34 83.5 35 106.0 36 141.5 37 177.0 38 174.5 39 172.0 40 181.5 41 191.0 42 203.5 43 216.0 44 245.5 45 275.0 46 258.0 47 241.0 48 259.0 49 277.0 50 257.5 51 238.0 52 239.0 53 240.0 54 226.5 55 213.0 56 205.0 57 197.0 58 189.0 59 181.0 60 194.0 61 207.0 62 181.5 63 156.0 64 143.0 65 130.0 66 133.5 67 137.0 68 125.5 69 114.0 70 109.0 71 104.0 72 91.0 73 78.0 74 77.5 75 63.0 76 49.0 77 41.0 78 33.0 79 25.0 80 17.0 81 15.5 82 14.0 83 12.5 84 11.0 85 7.5 86 4.0 87 3.0 88 2.0 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 1.0 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4000000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.05 44 0.0 45 0.075 46 0.1 47 0.05 48 0.125 49 0.025 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.42724302588590096 0.8500000000000001 3 0.050263885398341285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.05 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.075 0.0 0.0 0.0 0.0 17 0.075 0.0 0.0 0.0 0.0 18 0.075 0.0 0.0 0.0 0.0 19 0.075 0.0 0.0 0.0 0.0 20 0.075 0.0 0.0 0.0 0.0 21 0.075 0.0 0.0 0.0 0.0 22 0.075 0.0 0.0 0.0 0.0 23 0.075 0.0 0.0 0.0 0.0 24 0.075 0.0 0.0 0.0 0.0 25 0.075 0.0 0.0 0.0 0.0 26 0.075 0.0 0.0 0.0 0.0 27 0.075 0.0 0.0 0.0 0.0 28 0.075 0.0 0.0 0.0 0.0 29 0.075 0.0 0.0 0.0 0.0 30 0.075 0.0 0.0 0.0 0.0 31 0.1 0.0 0.0 0.0 0.0 32 0.1 0.0 0.0 0.0 0.0 33 0.1 0.0 0.0 0.0 0.0 34 0.1 0.0 0.0 0.0 0.0 35 0.1 0.0 0.0 0.0 0.0 36 0.1 0.0 0.0 0.0 0.0 37 0.1 0.0 0.0 0.0 0.0 38 0.1 0.0 0.0 0.0 0.0 39 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 699019 READS because READLEN < 1 Read 699019 spots for ERR2276345.sra Written 699019 spots for ERR2276345.sra Rejected 699019 READS because READLEN < 1 Read 699019 spots for ERR2276345.sra Written 699019 spots for ERR2276345.sra Rejected 699019 READS because READLEN < 1 Read 699019 spots for ERR2276345.sra Written 699019 spots for ERR2276345.sra Rejected 699019 READS because READLEN < 1 Read 699019 spots for ERR2276345.sra Written 699019 spots for ERR2276345.sra Rejected 699019 READS because READLEN < 1 Read 699019 spots for ERR2276345.sra Written 699019 spots for ERR2276345.sra Rejected 699019 READS because READLEN < 1 Read 699019 spots for ERR2276345.sra Written 699019 spots for ERR2276345.sra Rejected 699019 READS because READLEN < 1 Read 699019 spots for ERR2276345.sra Written 699019 spots for ERR2276345.sra Rejected 699019 READS because READLEN < 1 Read 699019 spots for ERR2276345.sra Written 699019 spots for ERR2276345.sra Rejected 699028 READS because READLEN < 1 Read 699028 spots for ERR2276345.sra Written 699028 spots for ERR2276345.sra Rejected 699019 READS because READLEN < 1 Read 699019 spots for ERR2276345.sra Written 699019 spots for ERR2276345.sra Rejected 699019 READS because READLEN < 1 Read 699019 spots for ERR2276345.sra Written 699019 spots for ERR2276345.sra Rejected 699019 READS because READLEN < 1 Read 699019 spots for ERR2276345.sra Written 699019 spots for ERR2276345.sra Rejected 699019 READS because READLEN < 1 Read 699019 spots for ERR2276345.sra Written 699019 spots for ERR2276345.sra Rejected 699019 READS because READLEN < 1 Read 699019 spots for ERR2276345.sra Written 699019 spots for ERR2276345.sra Rejected 699019 READS because READLEN < 1 Read 699019 spots for ERR2276345.sra Written 699019 spots for ERR2276345.sra Rejected 699019 READS because READLEN < 1 Read 699019 spots for ERR2276345.sra Written 699019 spots for ERR2276345.sra Rejected 699019 READS because READLEN < 1 Read 699019 spots for ERR2276345.sra Written 699019 spots for ERR2276345.sra Rejected 699019 READS because READLEN < 1 Read 699019 spots for ERR2276345.sra Written 699019 spots for ERR2276345.sra Rejected 699019 READS because READLEN < 1 Read 699019 spots for ERR2276345.sra Written 699019 spots for ERR2276345.sra Rejected 699019 READS because READLEN < 1 Read 699019 spots for ERR2276345.sra Written 699019 spots for ERR2276345.sra SRR ids: ['ERR2276345.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yl9ikpws ERR2276345.sra spots: 13980389 blocks: [[1, 699019], [699020, 1398038], [1398039, 2097057], [2097058, 2796076], [2796077, 3495095], [3495096, 4194114], [4194115, 4893133], [4893134, 5592152], [5592153, 6291171], [6291172, 6990190], [6990191, 7689209], [7689210, 8388228], [8388229, 9087247], [9087248, 9786266], [9786267, 10485285], [10485286, 11184304], [11184305, 11883323], [11883324, 12582342], [12582343, 13281361], [13281362, 13980389]] ERR2276345 file size 1971597 ERR2276345 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR2276345 ERR2276345_1.fastq Input file: ERR2276345_1.fastq trimmed: ERR2276345-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 21:38:26 2024 >> started Fri Dec 6 21:38:34 2024 >> done (8.645s) 13980389 reads processed; of these: 205149 ( 1.47%) short reads filtered out after trimming by size control 260790 ( 1.87%) empty reads filtered out after trimming by size control 13514450 (96.67%) reads available; of these: 1148471 ( 8.50%) trimmed reads available after processing 12365979 (91.50%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 14601 0.11% 19 14889 0.11% 20 15102 0.11% 21 15555 0.12% 22 15852 0.12% 23 16254 0.12% 24 16224 0.12% 25 17517 0.13% 26 17939 0.13% 27 18637 0.14% 28 18013 0.13% 29 20097 0.15% 30 20951 0.16% 31 22092 0.16% 32 24364 0.18% 33 24054 0.18% 34 26444 0.20% 35 26176 0.19% 36 27173 0.20% 37 29617 0.22% 38 31480 0.23% 39 33508 0.25% 40 36058 0.27% 41 38949 0.29% 42 43643 0.32% 43 47880 0.35% 44 55550 0.41% 45 57443 0.43% 46 63683 0.47% 47 72090 0.53% 48 81266 0.60% 49 90476 0.67% 50 94894 0.70% 51 12365979 91.50% 13514450 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=19 prefix-density=0.15 prefix-fanout=2.2 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=32 fanout-score=5.31 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=2.0 sequence=TCAAATGTACACACACGATATCCATAGGGACAAAGAGAAATAACAAACCGGAAAGGAAAAACGCAAAGCAAAATGCCATGGTTGACGAAACCGGGCTGGCATCTTATACATATATATAT Started job on | Dec 06 21:38:57 Started mapping on | Dec 06 21:38:58 Finished on | Dec 06 21:39:14 Mapping speed, Million of reads per hour | 3040.75 Number of input reads | 13514450 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 12780615 Uniquely mapped reads % | 94.57% Average mapped length | 49.92 Number of splices: Total | 1912069 Number of splices: Annotated (sjdb) | 1837181 Number of splices: GT/AG | 1885316 Number of splices: GC/AG | 24098 Number of splices: AT/AC | 751 Number of splices: Non-canonical | 1904 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 1.31 Insertion rate per base | 0.00% Insertion average length | 1.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 470520 % of reads mapped to multiple loci | 3.48% Number of reads mapped to too many loci | 155793 % of reads mapped to too many loci | 1.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.73% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 263315 263315 263315 N_multimapping 470520 470520 470520 N_noFeature 393526 6548102 6433290 N_ambiguous 212203 11227 9325 UnstrandedReadsAssigned:12174886 PositiveStrandReadsAssigned:6221286 NegativeStrandReadsAssigned:6338000 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 ERR2276345 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR2276345-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,514,450 reads, 12,025,120 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52973 ERR2276345.ke.tsv 35125 ERR2276345.se.tsv 88098 total ==> ERR2276345.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 28.2105 4.09877 PNS24247 1044 945 19.8805 2.55837 PNS24249 1928 1829 52.0284 3.45936 PNS24246 1044 945 19.8805 2.55837 PNS24248 1044 945 19.8805 2.55837 PNS24244 1471 1372 28.1196 2.49244 PNS24243 293 194 1 0.626855 KQK14069 1603 1504 4062.93 328.518 KQK14071 474 375 948.198 307.494 ==> ERR2276345.se.tsv <== BRADI_1g14170v3 5730 BRADI_1g53295v3 105 BRADI_1g59795v3 157 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 293 BRADI_1g74790v3 428 BRADI_1g09890v3 0 BRADI_1g77505v3 275 BRADI_1g48960v3 0 ERR2276345 completed mapping pipeline successfully