Starting /dee2/code/volunteer_pipeline.sh ERR2276346 current disk space = 1548936986624 free memory = 1601626324 ERR2276346 SRAfilesize e71d9e0732aa336500185ae70c74a26e ERR2276346.sra ERR2276346.sra file validated ERR2276346 is single end ERR2276346 is conventional basespace ERR2276346 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR2276346_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1445 34.0 31.0 34.0 31.0 34.0 2 32.472 34.0 31.0 34.0 31.0 34.0 3 32.72 34.0 33.0 34.0 31.0 34.0 4 36.02125 37.0 37.0 37.0 35.0 37.0 5 35.88375 37.0 37.0 37.0 35.0 37.0 6 35.91625 37.0 37.0 37.0 35.0 37.0 7 35.9365 37.0 37.0 37.0 35.0 37.0 8 35.88125 37.0 37.0 37.0 35.0 37.0 9 37.64625 39.0 39.0 39.0 35.0 39.0 10 37.57575 39.0 39.0 39.0 35.0 39.0 11 37.62975 39.0 39.0 39.0 35.0 39.0 12 37.42875 39.0 39.0 39.0 35.0 39.0 13 37.39175 39.0 39.0 39.0 35.0 39.0 14 39.00075 41.0 40.0 41.0 36.0 41.0 15 38.851 41.0 39.0 41.0 36.0 41.0 16 38.83325 41.0 39.0 41.0 36.0 41.0 17 38.872 41.0 39.0 41.0 36.0 41.0 18 38.8455 41.0 39.0 41.0 36.0 41.0 19 38.756 41.0 39.0 41.0 36.0 41.0 20 38.725 41.0 39.0 41.0 36.0 41.0 21 38.6295 41.0 39.0 41.0 35.0 41.0 22 38.4605 41.0 39.0 41.0 35.0 41.0 23 38.43 41.0 39.0 41.0 35.0 41.0 24 38.24725 40.0 38.0 41.0 34.0 41.0 25 38.0105 40.0 38.0 41.0 33.0 41.0 26 37.859 40.0 38.0 41.0 33.0 41.0 27 37.75825 40.0 38.0 41.0 33.0 41.0 28 38.03475 40.0 38.0 41.0 34.0 41.0 29 38.0105 40.0 38.0 41.0 34.0 41.0 30 37.95875 40.0 38.0 41.0 33.0 41.0 31 38.04525 41.0 39.0 41.0 34.0 41.0 32 37.9915 41.0 39.0 41.0 33.0 41.0 33 37.8865 41.0 38.0 41.0 33.0 41.0 34 37.83375 41.0 38.0 41.0 33.0 41.0 35 37.58525 41.0 38.0 41.0 32.0 41.0 36 37.5395 40.0 38.0 41.0 32.0 41.0 37 37.55525 41.0 38.0 41.0 33.0 41.0 38 37.39275 40.0 38.0 41.0 32.0 41.0 39 37.34775 40.0 38.0 41.0 32.0 41.0 40 37.209 40.0 38.0 41.0 32.0 41.0 41 36.9975 40.0 37.0 41.0 31.0 41.0 42 36.758 40.0 37.0 41.0 30.0 41.0 43 36.5845 40.0 37.0 41.0 30.0 41.0 44 36.40775 40.0 36.0 41.0 30.0 41.0 45 36.23825 40.0 36.0 41.0 30.0 41.0 46 36.12725 40.0 36.0 41.0 29.0 41.0 47 36.008 40.0 35.0 41.0 29.0 41.0 48 35.6415 40.0 35.0 41.0 28.0 41.0 49 35.3525 39.0 35.0 41.0 27.0 41.0 50 35.203 39.0 35.0 41.0 26.0 41.0 51 34.4685 39.0 34.0 41.0 23.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 28.0 3 3.0 4 4.0 5 2.0 6 7.0 7 4.0 8 5.0 9 6.0 10 2.0 11 8.0 12 5.0 13 4.0 14 6.0 15 7.0 16 3.0 17 6.0 18 9.0 19 8.0 20 7.0 21 11.0 22 9.0 23 14.0 24 14.0 25 18.0 26 17.0 27 22.0 28 35.0 29 31.0 30 23.0 31 47.0 32 50.0 33 61.0 34 100.0 35 149.0 36 166.0 37 360.0 38 615.0 39 2123.0 40 11.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.902562801319462 12.103527023598073 11.037807663029687 52.95610251205278 2 25.1 18.85 31.825 24.224999999999998 3 25.75 22.125 21.75 30.375000000000004 4 29.299999999999997 26.375 17.325 27.0 5 29.5 28.95 20.150000000000002 21.4 6 22.175 34.425 20.375 23.025000000000002 7 21.875 17.9 36.625 23.599999999999998 8 22.825 21.3 27.650000000000002 28.225 9 21.625 21.075 30.15 27.150000000000002 10 24.224999999999998 32.9 21.375 21.5 11 27.575 23.974999999999998 18.275 30.175 12 24.95 20.925 24.875 29.25 13 23.325000000000003 25.174999999999997 25.7 25.8 14 24.825 25.174999999999997 25.05 24.95 15 24.45 24.025 24.55 26.974999999999998 16 25.0 23.325000000000003 24.099999999999998 27.575 17 25.474999999999998 24.175 23.849999999999998 26.5 18 25.124999999999996 24.224999999999998 23.125 27.525 19 24.8 23.974999999999998 23.45 27.775 20 26.424999999999997 24.375 23.3 25.900000000000002 21 25.2 23.974999999999998 23.974999999999998 26.85 22 24.625 24.975 23.65 26.75 23 26.0 25.15 23.05 25.8 24 25.025 25.575 23.425 25.974999999999998 25 25.874999999999996 23.95 24.099999999999998 26.075 26 26.474999999999998 24.275 23.9 25.35 27 24.9 24.5 25.0 25.6 28 26.200000000000003 23.575 23.025000000000002 27.200000000000003 29 25.874999999999996 23.974999999999998 23.75 26.400000000000002 30 23.825 25.95 24.525 25.7 31 24.725 23.95 23.875 27.450000000000003 32 25.224999999999998 25.025 23.775 25.974999999999998 33 25.324999999999996 24.725 23.25 26.700000000000003 34 26.0 24.95 22.85 26.200000000000003 35 26.575 24.3 23.549999999999997 25.575 36 25.874999999999996 25.15 24.175 24.8 37 25.95 23.7 23.125 27.224999999999998 38 25.674999999999997 26.05 21.825 26.450000000000003 39 24.474999999999998 25.174999999999997 23.375 26.974999999999998 40 26.8 23.575 23.3 26.325 41 24.975 24.7 23.724999999999998 26.6 42 25.4 23.925 23.925 26.75 43 26.18154538634659 23.93098274568642 23.280820205051263 26.60665166291573 44 25.4 24.85 24.45 25.3 45 24.637318659329665 25.63781890945473 23.78689344672336 25.937968984492244 46 26.163081540770385 24.062031015507753 23.28664332166083 26.488244122061033 47 25.756439109777446 23.980995248812203 23.730932733183295 26.531632908227053 48 23.673673673673672 25.150150150150154 24.274274274274273 26.901901901901905 49 26.3 23.175 24.125 26.400000000000002 50 25.85 23.375 23.175 27.6 51 24.8 24.25 24.025 26.924999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 3.0 23 4.0 24 5.0 25 4.5 26 6.0 27 8.0 28 14.0 29 20.0 30 27.5 31 35.0 32 49.5 33 64.0 34 87.5 35 111.0 36 125.0 37 139.0 38 167.0 39 195.0 40 204.5 41 214.0 42 234.0 43 254.0 44 274.5 45 295.0 46 282.5 47 270.0 48 267.0 49 264.0 50 258.5 51 253.0 52 236.5 53 220.0 54 211.5 55 203.0 56 206.5 57 210.0 58 207.0 59 204.0 60 199.0 61 194.0 62 181.0 63 168.0 64 155.0 65 142.0 66 136.0 67 130.0 68 117.5 69 105.0 70 100.0 71 95.0 72 81.0 73 67.0 74 54.5 75 37.0 76 32.0 77 29.5 78 27.0 79 19.0 80 11.0 81 8.0 82 5.0 83 5.0 84 5.0 85 4.0 86 3.0 87 2.5 88 2.0 89 1.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4749999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.025 44 0.0 45 0.05 46 0.05 47 0.025 48 0.1 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39592247671784 98.725 2 0.5285678328718851 1.05 3 0.07550969041026932 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 603228 READS because READLEN < 1 Read 603228 spots for ERR2276346.sra Written 603228 spots for ERR2276346.sra Rejected 603228 READS because READLEN < 1 Read 603228 spots for ERR2276346.sra Written 603228 spots for ERR2276346.sra Rejected 603228 READS because READLEN < 1 Read 603228 spots for ERR2276346.sra Written 603228 spots for ERR2276346.sra Rejected 603228 READS because READLEN < 1 Read 603228 spots for ERR2276346.sra Written 603228 spots for ERR2276346.sra Rejected 603228 READS because READLEN < 1 Read 603228 spots for ERR2276346.sra Written 603228 spots for ERR2276346.sra Rejected 603228 READS because READLEN < 1 Read 603228 spots for ERR2276346.sra Written 603228 spots for ERR2276346.sra Rejected 603228 READS because READLEN < 1 Read 603228 spots for ERR2276346.sra Written 603228 spots for ERR2276346.sra Rejected 603228 READS because READLEN < 1 Read 603228 spots for ERR2276346.sra Written 603228 spots for ERR2276346.sra Rejected 603228 READS because READLEN < 1 Read 603228 spots for ERR2276346.sra Written 603228 spots for ERR2276346.sra Rejected 603228 READS because READLEN < 1 Read 603228 spots for ERR2276346.sra Written 603228 spots for ERR2276346.sra Rejected 603228 READS because READLEN < 1 Read 603228 spots for ERR2276346.sra Written 603228 spots for ERR2276346.sra Rejected 603228 READS because READLEN < 1 Read 603228 spots for ERR2276346.sra Written 603228 spots for ERR2276346.sra Rejected 603228 READS because READLEN < 1 Read 603228 spots for ERR2276346.sra Written 603228 spots for ERR2276346.sra Rejected 603228 READS because READLEN < 1 Read 603228 spots for ERR2276346.sra Written 603228 spots for ERR2276346.sra Rejected 603228 READS because READLEN < 1 Read 603228 spots for ERR2276346.sra Written 603228 spots for ERR2276346.sra Rejected 603228 READS because READLEN < 1 Read 603228 spots for ERR2276346.sra Written 603228 spots for ERR2276346.sra Rejected 603228 READS because READLEN < 1 Read 603228 spots for ERR2276346.sra Written 603228 spots for ERR2276346.sra Rejected 603228 READS because READLEN < 1 Read 603228 spots for ERR2276346.sra Written 603228 spots for ERR2276346.sra Rejected 603244 READS because READLEN < 1 Read 603244 spots for ERR2276346.sra Written 603244 spots for ERR2276346.sra Rejected 603228 READS because READLEN < 1 Read 603228 spots for ERR2276346.sra Written 603228 spots for ERR2276346.sra SRR ids: ['ERR2276346.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yeuetlla ERR2276346.sra spots: 12064576 blocks: [[1, 603228], [603229, 1206456], [1206457, 1809684], [1809685, 2412912], [2412913, 3016140], [3016141, 3619368], [3619369, 4222596], [4222597, 4825824], [4825825, 5429052], [5429053, 6032280], [6032281, 6635508], [6635509, 7238736], [7238737, 7841964], [7841965, 8445192], [8445193, 9048420], [9048421, 9651648], [9651649, 10254876], [10254877, 10858104], [10858105, 11461332], [11461333, 12064576]] ERR2276346 file size 1698444 ERR2276346 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR2276346 ERR2276346_1.fastq Input file: ERR2276346_1.fastq trimmed: ERR2276346-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 21:38:33 2024 >> started Fri Dec 6 21:38:40 2024 >> done (6.402s) 12064576 reads processed; of these: 135030 ( 1.12%) short reads filtered out after trimming by size control 127504 ( 1.06%) empty reads filtered out after trimming by size control 11802042 (97.82%) reads available; of these: 876570 ( 7.43%) trimmed reads available after processing 10925472 (92.57%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 9851 0.08% 19 10038 0.09% 20 10088 0.09% 21 10503 0.09% 22 10922 0.09% 23 11013 0.09% 24 10973 0.09% 25 12183 0.10% 26 12396 0.11% 27 12921 0.11% 28 12670 0.11% 29 14585 0.12% 30 15049 0.13% 31 15499 0.13% 32 17606 0.15% 33 17376 0.15% 34 19023 0.16% 35 19062 0.16% 36 19696 0.17% 37 21980 0.19% 38 23688 0.20% 39 25442 0.22% 40 27217 0.23% 41 29948 0.25% 42 33912 0.29% 43 37201 0.32% 44 43639 0.37% 45 45338 0.38% 46 50114 0.42% 47 57966 0.49% 48 65745 0.56% 49 74247 0.63% 50 78679 0.67% 51 10925472 92.57% 11802042 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=22 prefix-density=0.17 prefix-fanout=2.1 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=34 fanout-score=11.44 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.6 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCAGGCGTTGTTGTTCACTGGGTCGGACAGGTGGTCGGCCAGGTTCTCGAG Started job on | Dec 06 21:38:55 Started mapping on | Dec 06 21:38:58 Finished on | Dec 06 21:39:11 Mapping speed, Million of reads per hour | 3268.26 Number of input reads | 11802042 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 11151301 Uniquely mapped reads % | 94.49% Average mapped length | 50.07 Number of splices: Total | 1623446 Number of splices: Annotated (sjdb) | 1559801 Number of splices: GT/AG | 1600989 Number of splices: GC/AG | 20280 Number of splices: AT/AC | 616 Number of splices: Non-canonical | 1561 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 1.31 Insertion rate per base | 0.00% Insertion average length | 1.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 424421 % of reads mapped to multiple loci | 3.60% Number of reads mapped to too many loci | 104368 % of reads mapped to too many loci | 0.88% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.98% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 226320 226320 226320 N_multimapping 424421 424421 424421 N_noFeature 313749 5661315 5627161 N_ambiguous 192970 9089 8376 UnstrandedReadsAssigned:10644582 PositiveStrandReadsAssigned:5480897 NegativeStrandReadsAssigned:5515764 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 ERR2276346 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR2276346-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,802,042 reads, 10,573,605 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,090 rounds 52973 ERR2276346.ke.tsv 35125 ERR2276346.se.tsv 88098 total ==> ERR2276346.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 51.6518 8.32274 PNS24247 1044 945 8.77542 1.2524 PNS24249 1928 1829 30.2928 2.23373 PNS24246 1044 945 8.77542 1.2524 PNS24248 1044 945 8.77542 1.2524 PNS24244 1471 1372 52.7292 5.18326 PNS24243 293 194 0 0 KQK14069 1603 1504 3202.49 287.175 KQK14071 474 375 560.004 201.403 ==> ERR2276346.se.tsv <== BRADI_1g14170v3 4139 BRADI_1g53295v3 82 BRADI_1g59795v3 144 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 269 BRADI_1g74790v3 313 BRADI_1g09890v3 1 BRADI_1g77505v3 248 BRADI_1g48960v3 0 ERR2276346 completed mapping pipeline successfully