Starting /dee2/code/volunteer_pipeline.sh ERR2276347 current disk space = 1548924669952 free memory = 1600922996 ERR2276347 SRAfilesize ba0c71a2d63641d754ff0b72189d1db3 ERR2276347.sra ERR2276347.sra file validated ERR2276347 is single end ERR2276347 is conventional basespace ERR2276347 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR2276347_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.86625 34.0 31.0 34.0 30.0 34.0 2 32.223 34.0 31.0 34.0 30.0 34.0 3 32.42375 34.0 33.0 34.0 30.0 34.0 4 35.731 37.0 37.0 37.0 35.0 37.0 5 35.61325 37.0 37.0 37.0 35.0 37.0 6 35.55725 37.0 37.0 37.0 35.0 37.0 7 35.581 37.0 37.0 37.0 35.0 37.0 8 35.46775 37.0 37.0 37.0 35.0 37.0 9 37.3805 39.0 39.0 39.0 35.0 39.0 10 37.2845 39.0 39.0 39.0 35.0 39.0 11 37.3685 39.0 39.0 39.0 35.0 39.0 12 37.2045 39.0 39.0 39.0 35.0 39.0 13 37.17725 39.0 39.0 39.0 35.0 39.0 14 38.7415 41.0 40.0 41.0 36.0 41.0 15 38.62825 41.0 39.0 41.0 36.0 41.0 16 38.436 41.0 39.0 41.0 34.0 41.0 17 38.4365 41.0 39.0 41.0 34.0 41.0 18 38.44 41.0 39.0 41.0 35.0 41.0 19 38.4555 41.0 39.0 41.0 35.0 41.0 20 38.4175 41.0 39.0 41.0 34.0 41.0 21 38.3325 41.0 39.0 41.0 34.0 41.0 22 38.20425 41.0 39.0 41.0 34.0 41.0 23 38.01 41.0 39.0 41.0 33.0 41.0 24 37.76575 40.0 38.0 41.0 33.0 41.0 25 37.619 40.0 38.0 41.0 32.0 41.0 26 37.49575 40.0 38.0 41.0 32.0 41.0 27 37.42625 40.0 38.0 41.0 32.0 41.0 28 37.6825 40.0 38.0 41.0 33.0 41.0 29 37.672 40.0 39.0 41.0 32.0 41.0 30 37.54325 40.0 38.0 41.0 32.0 41.0 31 37.614 41.0 39.0 41.0 33.0 41.0 32 37.65175 41.0 39.0 41.0 33.0 41.0 33 37.54125 41.0 38.0 41.0 33.0 41.0 34 37.468 41.0 38.0 41.0 32.0 41.0 35 37.313 41.0 38.0 41.0 32.0 41.0 36 37.27625 41.0 38.0 41.0 32.0 41.0 37 37.1405 41.0 38.0 41.0 31.0 41.0 38 37.0775 40.0 38.0 41.0 31.0 41.0 39 36.98775 40.0 38.0 41.0 31.0 41.0 40 36.8295 40.0 37.0 41.0 30.0 41.0 41 36.6565 40.0 37.0 41.0 30.0 41.0 42 36.49225 40.0 37.0 41.0 30.0 41.0 43 36.342 40.0 36.0 41.0 30.0 41.0 44 36.18725 40.0 36.0 41.0 29.0 41.0 45 36.03525 40.0 36.0 41.0 28.0 41.0 46 35.8985 40.0 35.0 41.0 28.0 41.0 47 35.644 40.0 35.0 41.0 26.0 41.0 48 35.415 40.0 35.0 41.0 26.0 41.0 49 35.3335 40.0 35.0 41.0 26.0 41.0 50 35.14375 40.0 35.0 41.0 25.0 41.0 51 34.573 39.0 35.0 41.0 23.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 55.0 3 4.0 4 7.0 5 5.0 6 6.0 7 6.0 8 2.0 9 9.0 10 6.0 11 3.0 12 3.0 13 8.0 14 5.0 15 7.0 16 7.0 17 9.0 18 11.0 19 10.0 20 8.0 21 7.0 22 8.0 23 5.0 24 15.0 25 23.0 26 20.0 27 24.0 28 16.0 29 31.0 30 39.0 31 48.0 32 55.0 33 80.0 34 78.0 35 126.0 36 205.0 37 288.0 38 557.0 39 2198.0 40 6.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.758515505846468 11.514997458057955 12.379257752923234 51.34722928317235 2 26.900000000000002 18.8 30.25 24.05 3 26.200000000000003 23.75 22.725 27.325 4 28.199999999999996 27.625 18.075 26.1 5 29.549999999999997 28.7 21.224999999999998 20.525 6 22.75 34.525 20.9 21.825 7 20.175 17.299999999999997 37.0 25.525 8 23.9 21.75 25.924999999999997 28.425 9 22.175 21.15 29.275000000000002 27.400000000000002 10 23.1 32.25 23.0 21.65 11 27.450000000000003 23.400000000000002 19.1 30.049999999999997 12 26.55 20.5 24.3 28.65 13 24.25 24.4 25.55 25.8 14 24.925 24.224999999999998 25.525 25.324999999999996 15 24.45 24.099999999999998 26.325 25.124999999999996 16 24.425 24.3 24.775 26.5 17 24.875 23.400000000000002 24.9 26.825 18 24.925 25.15 24.099999999999998 25.825 19 25.074999999999996 24.7 24.375 25.85 20 25.3 24.7 23.875 26.125 21 24.7 24.775 25.575 24.95 22 26.8 24.25 23.549999999999997 25.4 23 24.349999999999998 25.45 23.525 26.674999999999997 24 23.474999999999998 25.874999999999996 25.2 25.45 25 25.324999999999996 24.375 23.95 26.35 26 25.874999999999996 24.8 23.799999999999997 25.525 27 24.474999999999998 25.924999999999997 23.95 25.650000000000002 28 25.474999999999998 25.25 23.3 25.974999999999998 29 25.525 24.525 24.875 25.074999999999996 30 25.35 24.4 25.374999999999996 24.875 31 24.9 25.05 23.525 26.525 32 25.674999999999997 26.075 22.775000000000002 25.474999999999998 33 25.025 23.599999999999998 25.05 26.325 34 25.124999999999996 25.35 24.15 25.374999999999996 35 24.8 25.45 23.724999999999998 26.025 36 25.312656328164078 24.262131065532767 24.437218609304654 25.987993996998497 37 26.700000000000003 24.275 23.425 25.6 38 26.025 24.6 23.95 25.424999999999997 39 24.4 24.925 24.45 26.224999999999998 40 25.75 24.15 23.925 26.174999999999997 41 27.775 24.15 23.075000000000003 25.0 42 25.724999999999998 24.349999999999998 24.9 25.025 43 23.86079118678017 25.58838257386079 24.661992989484226 25.88883324987481 44 25.46273136568284 24.937468734367183 24.012006003001503 25.587793896948476 45 25.250501002004004 24.34869739478958 24.498997995991985 25.90180360721443 46 24.887218045112782 22.481203007518797 25.93984962406015 26.691729323308273 47 24.43665498247371 25.63845768652979 24.636955433149723 25.28793189784677 48 24.699097291875628 25.827482447342025 23.996990972918756 25.47642928786359 49 26.88844422211106 24.062031015507753 24.262131065532767 24.787393696848426 50 25.0 25.15 23.474999999999998 26.375 51 24.349999999999998 23.724999999999998 24.675 27.250000000000004 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.5 20 2.0 21 2.5 22 3.0 23 4.0 24 5.0 25 6.5 26 12.5 27 17.0 28 18.5 29 20.0 30 28.0 31 36.0 32 50.0 33 64.0 34 79.0 35 94.0 36 125.5 37 157.0 38 173.5 39 190.0 40 220.5 41 251.0 42 274.0 43 297.0 44 294.5 45 292.0 46 317.0 47 342.0 48 309.5 49 277.0 50 268.5 51 260.0 52 249.0 53 238.0 54 235.5 55 233.0 56 202.0 57 171.0 58 165.5 59 160.0 60 151.5 61 143.0 62 126.0 63 109.0 64 102.5 65 96.0 66 102.5 67 109.0 68 104.5 69 100.0 70 90.5 71 81.0 72 75.0 73 69.0 74 59.0 75 42.0 76 35.0 77 35.5 78 36.0 79 25.0 80 14.0 81 16.5 82 19.0 83 15.0 84 11.0 85 7.5 86 4.0 87 3.0 88 2.0 89 2.5 90 3.0 91 2.0 92 1.0 93 0.5 94 0.0 95 0.5 96 1.0 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.05 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.15 44 0.05 45 0.2 46 0.25 47 0.15 48 0.3 49 0.05 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69834087481146 99.15 2 0.22624434389140274 0.44999999999999996 3 0.0 0.0 4 0.025138260432378077 0.1 5 0.0 0.0 6 0.050276520864756154 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGTATGCCGTCTTCTGCTTGAGATCGGAAGAGCACACGTCTGAACTCCAGT 6 0.15 Illumina Multiplexing PCR Primer 2.01 (100% over 31bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCC 6 0.15 TruSeq Adapter, Index 1 (100% over 51bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.125 0.0 0.0 0.0 0.0 2 0.125 0.0 0.0 0.0 0.0 3 0.125 0.0 0.0 0.0 0.0 4 0.15 0.0 0.0 0.0 0.0 5 0.15 0.0 0.0 0.0 0.0 6 0.15 0.0 0.0 0.0 0.0 7 0.15 0.0 0.0 0.0 0.0 8 0.15 0.0 0.0 0.0 0.0 9 0.15 0.0 0.0 0.0 0.0 10 0.15 0.0 0.0 0.0 0.0 11 0.15 0.0 0.0 0.0 0.0 12 0.15 0.0 0.0 0.0 0.0 13 0.15 0.0 0.0 0.0 0.0 14 0.175 0.0 0.0 0.0 0.0 15 0.175 0.0 0.0 0.0 0.0 16 0.175 0.0 0.0 0.0 0.0 17 0.175 0.0 0.0 0.0 0.0 18 0.175 0.0 0.0 0.0 0.0 19 0.175 0.0 0.0 0.0 0.0 20 0.2 0.0 0.0 0.0 0.0 21 0.4 0.0 0.0 0.0 0.0 22 0.4 0.0 0.0 0.0 0.0 23 0.425 0.0 0.0 0.0 0.0 24 0.425 0.0 0.0 0.0 0.0 25 0.425 0.0 0.0 0.0 0.0 26 0.425 0.0 0.0 0.0 0.0 27 0.425 0.0 0.0 0.0 0.0 28 0.425 0.0 0.0 0.0 0.0 29 0.425 0.0 0.0 0.0 0.0 30 0.425 0.0 0.0 0.0 0.0 31 0.425 0.0 0.0 0.0 0.0 32 0.425 0.0 0.0 0.0 0.0 33 0.425 0.0 0.0 0.0 0.0 34 0.425 0.0 0.0 0.0 0.0 35 0.425 0.0 0.0 0.0 0.0 36 0.425 0.0 0.0 0.0 0.0 37 0.425 0.0 0.0 0.0 0.0 38 0.425 0.0 0.0 0.0 0.0 39 0.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 650337 READS because READLEN < 1 Read 650337 spots for ERR2276347.sra Written 650337 spots for ERR2276347.sra Rejected 650337 READS because READLEN < 1 Read 650337 spots for ERR2276347.sra Written 650337 spots for ERR2276347.sra Rejected 650352 READS because READLEN < 1 Read 650352 spots for ERR2276347.sra Written 650352 spots for ERR2276347.sra Rejected 650337 READS because READLEN < 1 Read 650337 spots for ERR2276347.sra Written 650337 spots for ERR2276347.sra Rejected 650337 READS because READLEN < 1 Read 650337 spots for ERR2276347.sra Written 650337 spots for ERR2276347.sra Rejected 650337 READS because READLEN < 1 Read 650337 spots for ERR2276347.sra Written 650337 spots for ERR2276347.sra Rejected 650337 READS because READLEN < 1 Read 650337 spots for ERR2276347.sra Written 650337 spots for ERR2276347.sra Rejected 650337 READS because READLEN < 1 Read 650337 spots for ERR2276347.sra Written 650337 spots for ERR2276347.sra Rejected 650337 READS because READLEN < 1 Read 650337 spots for ERR2276347.sra Written 650337 spots for ERR2276347.sra Rejected 650337 READS because READLEN < 1 Read 650337 spots for ERR2276347.sra Written 650337 spots for ERR2276347.sra Rejected 650337 READS because READLEN < 1 Read 650337 spots for ERR2276347.sra Written 650337 spots for ERR2276347.sra Rejected 650337 READS because READLEN < 1 Read 650337 spots for ERR2276347.sra Written 650337 spots for ERR2276347.sra Rejected 650337 READS because READLEN < 1 Read 650337 spots for ERR2276347.sra Written 650337 spots for ERR2276347.sra Rejected 650337 READS because READLEN < 1 Read 650337 spots for ERR2276347.sra Written 650337 spots for ERR2276347.sra Rejected 650337 READS because READLEN < 1 Read 650337 spots for ERR2276347.sra Written 650337 spots for ERR2276347.sra Rejected 650337 READS because READLEN < 1 Read 650337 spots for ERR2276347.sra Written 650337 spots for ERR2276347.sra Rejected 650337 READS because READLEN < 1 Read 650337 spots for ERR2276347.sra Written 650337 spots for ERR2276347.sra Rejected 650337 READS because READLEN < 1 Read 650337 spots for ERR2276347.sra Written 650337 spots for ERR2276347.sra Rejected 650337 READS because READLEN < 1 Read 650337 spots for ERR2276347.sra Written 650337 spots for ERR2276347.sra Rejected 650337 READS because READLEN < 1 Read 650337 spots for ERR2276347.sra Written 650337 spots for ERR2276347.sra SRR ids: ['ERR2276347.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_olvpe2f3 ERR2276347.sra spots: 13006755 blocks: [[1, 650337], [650338, 1300674], [1300675, 1951011], [1951012, 2601348], [2601349, 3251685], [3251686, 3902022], [3902023, 4552359], [4552360, 5202696], [5202697, 5853033], [5853034, 6503370], [6503371, 7153707], [7153708, 7804044], [7804045, 8454381], [8454382, 9104718], [9104719, 9755055], [9755056, 10405392], [10405393, 11055729], [11055730, 11706066], [11706067, 12356403], [12356404, 13006755]] ERR2276347 file size 1832778 ERR2276347 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR2276347 ERR2276347_1.fastq Input file: ERR2276347_1.fastq trimmed: ERR2276347-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 21:42:34 2024 >> started Fri Dec 6 21:42:44 2024 >> done (9.605s) 13006755 reads processed; of these: 175020 ( 1.35%) short reads filtered out after trimming by size control 213364 ( 1.64%) empty reads filtered out after trimming by size control 12618371 (97.01%) reads available; of these: 972873 ( 7.71%) trimmed reads available after processing 11645498 (92.29%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 12439 0.10% 19 15069 0.12% 20 13306 0.11% 21 13716 0.11% 22 13399 0.11% 23 14268 0.11% 24 13561 0.11% 25 14629 0.12% 26 15156 0.12% 27 14982 0.12% 28 14982 0.12% 29 16872 0.13% 30 17016 0.13% 31 18308 0.15% 32 19685 0.16% 33 19977 0.16% 34 21907 0.17% 35 21763 0.17% 36 23006 0.18% 37 24439 0.19% 38 26468 0.21% 39 28155 0.22% 40 30183 0.24% 41 32687 0.26% 42 37250 0.30% 43 40125 0.32% 44 47084 0.37% 45 48034 0.38% 46 52917 0.42% 47 61732 0.49% 48 70684 0.56% 49 77335 0.61% 50 81739 0.65% 51 11645498 92.29% 12618371 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=3.37 fanout-score-rank=27 prefix-density=0.44 prefix-fanout=1.2 sequence=CTTCTGCTTGAAAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=287.91 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=19.3 sequence=CGCCGCCGCCGA Started job on | Dec 06 21:42:53 Started mapping on | Dec 06 21:42:53 Finished on | Dec 06 21:43:11 Mapping speed, Million of reads per hour | 2523.67 Number of input reads | 12618371 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 11885190 Uniquely mapped reads % | 94.19% Average mapped length | 50.01 Number of splices: Total | 1764971 Number of splices: Annotated (sjdb) | 1672318 Number of splices: GT/AG | 1737158 Number of splices: GC/AG | 25279 Number of splices: AT/AC | 1083 Number of splices: Non-canonical | 1451 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 1.32 Insertion rate per base | 0.00% Insertion average length | 1.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 411284 % of reads mapped to multiple loci | 3.26% Number of reads mapped to too many loci | 153980 % of reads mapped to too many loci | 1.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.26% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 321897 321897 321897 N_multimapping 411284 411284 411284 N_noFeature 556676 6169592 6103051 N_ambiguous 185939 8688 8681 UnstrandedReadsAssigned:11142575 PositiveStrandReadsAssigned:5706910 NegativeStrandReadsAssigned:5773458 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 ERR2276347 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR2276347-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,618,371 reads, 11,053,834 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,101 rounds 52973 ERR2276347.ke.tsv 35125 ERR2276347.se.tsv 88098 total ==> ERR2276347.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 4.99311e-06 9.0524e-07 PNS24247 1044 945 36.5264 5.86533 PNS24249 1928 1829 99.1613 8.22709 PNS24246 1044 945 36.5264 5.86533 PNS24248 1044 945 36.5264 5.86533 PNS24244 1471 1372 32.2596 3.56799 PNS24243 293 194 2 1.56439 KQK14069 1603 1504 18430.8 1859.58 KQK14071 474 375 5694.53 2304.33 ==> ERR2276347.se.tsv <== BRADI_1g14170v3 27037 BRADI_1g53295v3 180 BRADI_1g59795v3 360 BRADI_1g07683v3 0 BRADI_1g00485v3 11 BRADI_1g20270v3 357 BRADI_1g74790v3 129 BRADI_1g09890v3 0 BRADI_1g77505v3 292 BRADI_1g48960v3 0 ERR2276347 completed mapping pipeline successfully