Starting /dee2/code/volunteer_pipeline.sh ERR2276348 current disk space = 1548867366912 free memory = 1598169984 ERR2276348 SRAfilesize d3c06334955460c51a5103ded389fb5b ERR2276348.sra ERR2276348.sra file validated ERR2276348 is single end ERR2276348 is conventional basespace ERR2276348 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR2276348_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.12475 34.0 31.0 34.0 28.0 34.0 2 31.5645 34.0 31.0 34.0 28.0 34.0 3 31.81275 34.0 31.0 34.0 28.0 34.0 4 35.13025 37.0 37.0 37.0 33.0 37.0 5 34.893 37.0 37.0 37.0 33.0 37.0 6 34.9415 37.0 37.0 37.0 33.0 37.0 7 34.86375 37.0 37.0 37.0 33.0 37.0 8 34.759 37.0 37.0 37.0 33.0 37.0 9 36.602 39.0 39.0 39.0 34.0 39.0 10 36.59475 39.0 39.0 39.0 33.0 39.0 11 36.53975 39.0 39.0 39.0 34.0 39.0 12 36.34125 39.0 38.0 39.0 33.0 39.0 13 36.3555 39.0 38.0 39.0 33.0 39.0 14 37.845 41.0 39.0 41.0 34.0 41.0 15 37.75975 41.0 39.0 41.0 33.0 41.0 16 37.705 41.0 39.0 41.0 33.0 41.0 17 37.648 41.0 39.0 41.0 33.0 41.0 18 37.642 41.0 39.0 41.0 32.0 41.0 19 37.56925 41.0 39.0 41.0 32.0 41.0 20 37.51775 41.0 39.0 41.0 32.0 41.0 21 37.40625 41.0 39.0 41.0 32.0 41.0 22 37.36775 41.0 39.0 41.0 32.0 41.0 23 37.251 41.0 38.0 41.0 32.0 41.0 24 37.087 40.0 38.0 41.0 31.0 41.0 25 36.92975 40.0 38.0 41.0 30.0 41.0 26 36.801 40.0 38.0 41.0 30.0 41.0 27 36.753 40.0 38.0 41.0 30.0 41.0 28 36.87675 40.0 38.0 41.0 30.0 41.0 29 36.90725 40.0 38.0 41.0 31.0 41.0 30 36.90775 40.0 38.0 41.0 30.0 41.0 31 36.87075 41.0 38.0 41.0 30.0 41.0 32 36.8855 41.0 38.0 41.0 30.0 41.0 33 36.83625 41.0 38.0 41.0 30.0 41.0 34 36.72175 41.0 38.0 41.0 30.0 41.0 35 36.6245 41.0 38.0 41.0 30.0 41.0 36 36.57125 40.0 38.0 41.0 30.0 41.0 37 36.5105 40.0 38.0 41.0 30.0 41.0 38 36.36 40.0 38.0 41.0 28.0 41.0 39 36.26825 40.0 38.0 41.0 28.0 41.0 40 36.17425 40.0 37.0 41.0 28.0 41.0 41 36.025 40.0 37.0 41.0 27.0 41.0 42 35.68975 40.0 36.0 41.0 25.0 41.0 43 35.56525 40.0 36.0 41.0 25.0 41.0 44 35.39625 40.0 36.0 41.0 23.0 41.0 45 35.25575 40.0 35.0 41.0 23.0 41.0 46 35.218 40.0 35.0 41.0 23.0 41.0 47 34.92825 40.0 35.0 41.0 21.0 41.0 48 34.75275 40.0 35.0 41.0 18.0 41.0 49 34.52625 40.0 35.0 41.0 8.0 41.0 50 34.30825 40.0 35.0 41.0 2.0 41.0 51 33.5775 39.0 34.0 41.0 2.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 116.0 3 10.0 4 12.0 5 7.0 6 4.0 7 12.0 8 5.0 9 7.0 10 9.0 11 5.0 12 7.0 13 6.0 14 9.0 15 7.0 16 6.0 17 12.0 18 7.0 19 7.0 20 8.0 21 11.0 22 9.0 23 9.0 24 15.0 25 16.0 26 18.0 27 19.0 28 22.0 29 31.0 30 26.0 31 32.0 32 48.0 33 84.0 34 93.0 35 121.0 36 182.0 37 321.0 38 589.0 39 2092.0 40 6.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.840490797546014 11.809815950920246 10.250511247443763 51.09918200408998 2 24.975 20.75 32.074999999999996 22.2 3 26.325 24.8 21.825 27.05 4 29.425 27.0 17.724999999999998 25.85 5 30.725 31.2 19.25 18.825 6 24.8 35.199999999999996 20.45 19.55 7 21.425 19.45 35.275 23.849999999999998 8 22.7 23.799999999999997 25.1 28.4 9 23.7 22.0 27.525 26.775 10 24.075 34.725 21.125 20.075000000000003 11 29.675 24.675 18.224999999999998 27.425 12 24.474999999999998 22.325 23.025000000000002 30.175 13 24.875 25.2 26.424999999999997 23.5 14 24.125 25.374999999999996 23.5 27.0 15 24.675 26.8 23.625 24.9 16 24.6 25.275 23.225 26.900000000000002 17 25.900000000000002 24.65 22.400000000000002 27.05 18 24.075 26.35 24.349999999999998 25.224999999999998 19 26.150000000000002 24.775 22.675 26.400000000000002 20 26.0 24.9 23.724999999999998 25.374999999999996 21 26.575 26.150000000000002 22.925 24.349999999999998 22 25.374999999999996 26.025 22.775000000000002 25.825 23 25.1 26.674999999999997 24.375 23.849999999999998 24 24.825 25.474999999999998 23.674999999999997 26.025 25 24.85 23.974999999999998 24.425 26.75 26 23.7 24.625 24.55 27.125 27 25.6 23.5 23.325000000000003 27.575 28 24.125 25.275 25.025 25.575 29 25.874999999999996 24.4 23.95 25.775 30 24.25 24.55 24.8 26.400000000000002 31 24.125 25.424999999999997 23.799999999999997 26.650000000000002 32 23.075000000000003 26.625 24.675 25.624999999999996 33 25.474999999999998 24.075 23.575 26.875 34 24.8 24.55 24.275 26.375 35 24.975 24.625 25.025 25.374999999999996 36 23.45 26.05 24.975 25.525 37 27.075 23.599999999999998 24.0 25.324999999999996 38 25.424999999999997 25.575 23.400000000000002 25.6 39 24.4 24.325 24.875 26.400000000000002 40 24.375 25.4 23.575 26.650000000000002 41 24.175 24.75 25.8 25.275 42 23.925 24.675 24.4 27.0 43 24.537268634317158 24.512256128064035 24.512256128064035 26.43821910955478 44 23.125 26.200000000000003 24.825 25.85 45 27.220415311483613 24.06805103827871 23.217413059794847 25.494120590442833 46 25.925925925925924 24.04904904904905 24.674674674674673 25.350350350350347 47 24.212106053026513 26.088044022011005 24.012006003001503 25.68784392196098 48 26.189283925888834 22.8592889334001 26.164246369554334 24.787180771156734 49 26.531632908227053 23.905976494123532 23.005751437859466 26.556639159789945 50 24.25 24.9 24.3 26.55 51 24.525 25.0 24.45 26.025 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 1.0 19 1.0 20 1.0 21 1.5 22 2.0 23 2.0 24 2.0 25 4.0 26 6.0 27 6.0 28 15.0 29 24.0 30 36.0 31 48.0 32 53.0 33 58.0 34 74.0 35 90.0 36 127.0 37 164.0 38 166.0 39 168.0 40 197.5 41 227.0 42 247.5 43 268.0 44 280.0 45 292.0 46 302.0 47 312.0 48 304.0 49 296.0 50 299.5 51 303.0 52 293.5 53 284.0 54 257.5 55 231.0 56 222.5 57 214.0 58 196.5 59 179.0 60 168.5 61 158.0 62 136.0 63 114.0 64 122.5 65 131.0 66 113.0 67 95.0 68 92.5 69 90.0 70 78.5 71 67.0 72 58.0 73 49.0 74 43.0 75 31.5 76 26.0 77 20.0 78 14.0 79 15.5 80 17.0 81 17.5 82 18.0 83 10.0 84 2.0 85 2.5 86 3.0 87 1.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1999999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.05 44 0.0 45 0.075 46 0.1 47 0.05 48 0.15 49 0.025 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72095383054287 98.275 2 0.15220700152207 0.3 3 0.076103500761035 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025367833587011668 0.22499999999999998 >10 0.025367833587011668 0.975 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCC 39 0.975 TruSeq Adapter, Index 3 (100% over 51bp) CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGACGTGT 9 0.22499999999999998 TruSeq Adapter, Index 3 (100% over 51bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.125 0.0 0.0 0.0 0.0 7 0.125 0.0 0.0 0.0 0.0 8 0.15 0.0 0.0 0.0 0.0 9 0.15 0.0 0.0 0.0 0.0 10 0.15 0.0 0.0 0.0 0.0 11 0.15 0.0 0.0 0.0 0.0 12 0.15 0.0 0.0 0.0 0.0 13 0.15 0.0 0.0 0.0 0.0 14 0.175 0.0 0.0 0.0 0.0 15 0.175 0.0 0.0 0.0 0.0 16 0.2 0.0 0.0 0.0 0.0 17 0.225 0.0 0.0 0.0 0.0 18 0.225 0.0 0.0 0.0 0.0 19 0.225 0.0 0.0 0.0 0.0 20 0.225 0.0 0.0 0.0 0.0 21 0.25 0.0 0.0 0.0 0.0 22 0.25 0.0 0.0 0.0 0.0 23 0.275 0.0 0.0 0.0 0.0 24 0.275 0.0 0.0 0.0 0.0 25 0.275 0.0 0.0 0.0 0.0 26 0.275 0.0 0.0 0.0 0.0 27 0.275 0.0 0.0 0.0 0.0 28 0.3 0.0 0.0 0.0 0.0 29 0.3 0.0 0.0 0.0 0.0 30 0.3 0.0 0.0 0.0 0.0 31 0.3 0.0 0.0 0.0 0.0 32 0.3 0.0 0.0 0.0 0.0 33 0.3 0.0 0.0 0.0 0.0 34 0.3 0.0 0.0 0.0 0.0 35 0.3 0.0 0.0 0.0 0.0 36 0.3 0.0 0.0 0.0 0.0 37 0.3 0.0 0.0 0.0 0.0 38 0.3 0.0 0.0 0.0 0.0 39 0.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 663381 READS because READLEN < 1 Read 663381 spots for ERR2276348.sra Written 663381 spots for ERR2276348.sra Rejected 663381 READS because READLEN < 1 Read 663381 spots for ERR2276348.sra Written 663381 spots for ERR2276348.sra Rejected 663381 READS because READLEN < 1 Read 663381 spots for ERR2276348.sra Written 663381 spots for ERR2276348.sra Rejected 663381 READS because READLEN < 1 Read 663381 spots for ERR2276348.sra Written 663381 spots for ERR2276348.sra Rejected 663400 READS because READLEN < 1 Read 663400 spots for ERR2276348.sra Written 663400 spots for ERR2276348.sra Rejected 663381 READS because READLEN < 1 Read 663381 spots for ERR2276348.sra Written 663381 spots for ERR2276348.sra Rejected 663381 READS because READLEN < 1 Read 663381 spots for ERR2276348.sra Written 663381 spots for ERR2276348.sra Rejected 663381 READS because READLEN < 1 Read 663381 spots for ERR2276348.sra Written 663381 spots for ERR2276348.sra Rejected 663381 READS because READLEN < 1 Read 663381 spots for ERR2276348.sra Written 663381 spots for ERR2276348.sra Rejected 663381 READS because READLEN < 1 Read 663381 spots for ERR2276348.sra Written 663381 spots for ERR2276348.sra Rejected 663381 READS because READLEN < 1 Read 663381 spots for ERR2276348.sra Written 663381 spots for ERR2276348.sra Rejected 663381 READS because READLEN < 1 Read 663381 spots for ERR2276348.sra Written 663381 spots for ERR2276348.sra Rejected 663381 READS because READLEN < 1 Read 663381 spots for ERR2276348.sra Written 663381 spots for ERR2276348.sra Rejected 663381 READS because READLEN < 1 Read 663381 spots for ERR2276348.sra Written 663381 spots for ERR2276348.sra Rejected 663381 READS because READLEN < 1 Read 663381 spots for ERR2276348.sra Written 663381 spots for ERR2276348.sra Rejected 663381 READS because READLEN < 1 Read 663381 spots for ERR2276348.sra Written 663381 spots for ERR2276348.sra Rejected 663381 READS because READLEN < 1 Read 663381 spots for ERR2276348.sra Written 663381 spots for ERR2276348.sra Rejected 663381 READS because READLEN < 1 Read 663381 spots for ERR2276348.sra Written 663381 spots for ERR2276348.sra Rejected 663381 READS because READLEN < 1 Read 663381 spots for ERR2276348.sra Written 663381 spots for ERR2276348.sra Rejected 663381 READS because READLEN < 1 Read 663381 spots for ERR2276348.sra Written 663381 spots for ERR2276348.sra SRR ids: ['ERR2276348.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kp2o_hcg ERR2276348.sra spots: 13267639 blocks: [[1, 663381], [663382, 1326762], [1326763, 1990143], [1990144, 2653524], [2653525, 3316905], [3316906, 3980286], [3980287, 4643667], [4643668, 5307048], [5307049, 5970429], [5970430, 6633810], [6633811, 7297191], [7297192, 7960572], [7960573, 8623953], [8623954, 9287334], [9287335, 9950715], [9950716, 10614096], [10614097, 11277477], [11277478, 11940858], [11940859, 12604239], [12604240, 13267639]] ERR2276348 file size 1869974 ERR2276348 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR2276348 ERR2276348_1.fastq Input file: ERR2276348_1.fastq trimmed: ERR2276348-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 21:44:01 2024 >> started Fri Dec 6 21:44:10 2024 >> done (8.400s) 13267639 reads processed; of these: 185903 ( 1.40%) short reads filtered out after trimming by size control 385228 ( 2.90%) empty reads filtered out after trimming by size control 12696508 (95.70%) reads available; of these: 986763 ( 7.77%) trimmed reads available after processing 11709745 (92.23%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 14194 0.11% 19 11983 0.09% 20 11957 0.09% 21 12229 0.10% 22 12194 0.10% 23 12754 0.10% 24 12797 0.10% 25 13868 0.11% 26 14450 0.11% 27 15307 0.12% 28 15164 0.12% 29 16043 0.13% 30 16543 0.13% 31 17557 0.14% 32 18695 0.15% 33 19718 0.16% 34 23589 0.19% 35 23245 0.18% 36 24036 0.19% 37 26578 0.21% 38 28890 0.23% 39 29898 0.24% 40 31007 0.24% 41 35865 0.28% 42 37504 0.30% 43 39262 0.31% 44 47608 0.37% 45 48870 0.38% 46 53073 0.42% 47 65717 0.52% 48 74411 0.59% 49 78621 0.62% 50 83136 0.65% 51 11709745 92.23% 12696508 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=39 prefix-density=0.00 prefix-fanout=1.0 sequence=CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGACGTGTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=161.57 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=15.7 sequence=CGCCGCCGCCGG Started job on | Dec 06 21:44:28 Started mapping on | Dec 06 21:44:28 Finished on | Dec 06 21:45:07 Mapping speed, Million of reads per hour | 1171.99 Number of input reads | 12696508 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 10380681 Uniquely mapped reads % | 81.76% Average mapped length | 50.04 Number of splices: Total | 1545478 Number of splices: Annotated (sjdb) | 1465348 Number of splices: GT/AG | 1520840 Number of splices: GC/AG | 22431 Number of splices: AT/AC | 875 Number of splices: Non-canonical | 1332 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.00% Deletion average length | 1.30 Insertion rate per base | 0.00% Insertion average length | 1.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 373317 % of reads mapped to multiple loci | 2.94% Number of reads mapped to too many loci | 146534 % of reads mapped to too many loci | 1.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 14.08% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1942510 1942510 1942510 N_multimapping 373317 373317 373317 N_noFeature 486108 5390916 5319917 N_ambiguous 170918 8009 7710 UnstrandedReadsAssigned:9723655 PositiveStrandReadsAssigned:4981756 NegativeStrandReadsAssigned:5053054 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 ERR2276348 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR2276348-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,696,508 reads, 9,652,751 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,132 rounds 52973 ERR2276348.ke.tsv 35125 ERR2276348.se.tsv 88098 total ==> ERR2276348.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 84.7728 17.3711 PNS24247 1044 945 6.8221 1.23817 PNS24249 1928 1829 49.3402 4.62682 PNS24246 1044 945 6.8221 1.23817 PNS24248 1044 945 6.8221 1.23817 PNS24244 1471 1372 66.4208 8.30319 PNS24243 293 194 4 3.53634 KQK14069 1603 1504 15708.4 1791.34 KQK14071 474 375 3939.63 1801.85 ==> ERR2276348.se.tsv <== BRADI_1g14170v3 22055 BRADI_1g53295v3 145 BRADI_1g59795v3 328 BRADI_1g07683v3 0 BRADI_1g00485v3 19 BRADI_1g20270v3 534 BRADI_1g74790v3 105 BRADI_1g09890v3 0 BRADI_1g77505v3 220 BRADI_1g48960v3 0 ERR2276348 completed mapping pipeline successfully