Starting /dee2/code/volunteer_pipeline.sh ERR2276349 current disk space = 1548879544320 free memory = 1600502396 ERR2276349 SRAfilesize 966b2b6d0096e3dcbb08c32f84aab368 ERR2276349.sra ERR2276349.sra file validated ERR2276349 is single end ERR2276349 is conventional basespace ERR2276349 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR2276349_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3995 34.0 31.0 34.0 30.0 34.0 2 31.78275 34.0 31.0 34.0 30.0 34.0 3 32.01975 34.0 31.0 34.0 30.0 34.0 4 35.2785 37.0 37.0 37.0 35.0 37.0 5 35.1855 37.0 37.0 37.0 35.0 37.0 6 35.16525 37.0 37.0 37.0 35.0 37.0 7 35.1505 37.0 37.0 37.0 35.0 37.0 8 35.05925 37.0 37.0 37.0 35.0 37.0 9 36.90225 39.0 39.0 39.0 35.0 39.0 10 36.79025 39.0 39.0 39.0 34.0 39.0 11 36.926 39.0 39.0 39.0 34.0 39.0 12 36.78775 39.0 39.0 39.0 34.0 39.0 13 36.73925 39.0 39.0 39.0 34.0 39.0 14 38.24175 41.0 39.0 41.0 34.0 41.0 15 38.16375 41.0 39.0 41.0 34.0 41.0 16 38.141 41.0 39.0 41.0 34.0 41.0 17 38.09675 41.0 39.0 41.0 34.0 41.0 18 38.04825 41.0 39.0 41.0 34.0 41.0 19 37.97 41.0 39.0 41.0 33.0 41.0 20 37.918 41.0 39.0 41.0 33.0 41.0 21 37.846 41.0 39.0 41.0 34.0 41.0 22 37.74125 41.0 39.0 41.0 33.0 41.0 23 37.732 41.0 39.0 41.0 33.0 41.0 24 37.5345 41.0 38.0 41.0 32.0 41.0 25 37.34725 40.0 38.0 41.0 32.0 41.0 26 37.1875 40.0 38.0 41.0 31.0 41.0 27 37.08375 40.0 38.0 41.0 31.0 41.0 28 37.2235 40.0 38.0 41.0 32.0 41.0 29 37.21925 40.0 38.0 41.0 32.0 41.0 30 37.121 40.0 38.0 41.0 31.0 41.0 31 37.16475 40.0 38.0 41.0 31.0 41.0 32 37.12375 41.0 38.0 41.0 31.0 41.0 33 37.01625 41.0 38.0 41.0 31.0 41.0 34 36.999 41.0 38.0 41.0 30.0 41.0 35 36.84525 41.0 38.0 41.0 30.0 41.0 36 36.6885 40.0 38.0 41.0 30.0 41.0 37 36.63625 41.0 38.0 41.0 30.0 41.0 38 36.48925 40.0 38.0 41.0 30.0 41.0 39 36.43175 40.0 38.0 41.0 29.0 41.0 40 36.31175 40.0 37.0 41.0 29.0 41.0 41 36.1685 40.0 37.0 41.0 27.0 41.0 42 35.9445 40.0 36.0 41.0 26.0 41.0 43 35.708 40.0 36.0 41.0 25.0 41.0 44 35.61775 40.0 36.0 41.0 25.0 41.0 45 35.484 40.0 35.0 41.0 24.0 41.0 46 35.3545 40.0 35.0 41.0 24.0 41.0 47 35.0995 40.0 35.0 41.0 23.0 41.0 48 34.9585 40.0 35.0 41.0 22.0 41.0 49 34.777 40.0 35.0 41.0 19.0 41.0 50 34.6805 40.0 35.0 41.0 20.0 41.0 51 34.04275 39.0 34.0 41.0 15.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 101.0 3 6.0 4 3.0 5 3.0 6 3.0 7 4.0 8 9.0 9 3.0 10 5.0 11 3.0 12 11.0 13 5.0 14 9.0 15 7.0 16 6.0 17 9.0 18 8.0 19 6.0 20 16.0 21 12.0 22 15.0 23 11.0 24 18.0 25 26.0 26 15.0 27 23.0 28 23.0 29 25.0 30 34.0 31 45.0 32 60.0 33 62.0 34 78.0 35 114.0 36 198.0 37 304.0 38 577.0 39 2132.0 40 11.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.40884820747521 12.636664124078312 12.78921942537503 50.165268243071445 2 24.3 18.675 32.4 24.625 3 25.775 22.725 21.525 29.975 4 28.799999999999997 27.425 17.675 26.1 5 29.9 30.55 19.400000000000002 20.150000000000002 6 24.65 34.375 18.8 22.175 7 21.025 18.325 37.5 23.150000000000002 8 22.05 23.225 25.874999999999996 28.849999999999998 9 23.075000000000003 21.7 28.999999999999996 26.224999999999998 10 23.425 33.975 21.75 20.849999999999998 11 28.9 23.175 19.05 28.875 12 24.65 21.65 25.025 28.675 13 22.975 24.15 27.625 25.25 14 24.5 25.45 25.45 24.6 15 23.375 26.474999999999998 23.875 26.275 16 24.825 25.374999999999996 23.825 25.974999999999998 17 24.45 26.1 24.425 25.025 18 25.224999999999998 25.55 24.125 25.1 19 24.925 25.874999999999996 23.974999999999998 25.224999999999998 20 25.674999999999997 23.974999999999998 24.975 25.374999999999996 21 25.55 25.5 23.225 25.724999999999998 22 24.975 26.974999999999998 22.875 25.174999999999997 23 24.95 26.025 23.599999999999998 25.424999999999997 24 24.325 26.25 24.75 24.675 25 23.474999999999998 24.5 25.900000000000002 26.125 26 25.15 23.775 23.474999999999998 27.6 27 24.975 25.724999999999998 22.825 26.474999999999998 28 24.775 25.974999999999998 23.575 25.674999999999997 29 25.525 24.15 23.925 26.400000000000002 30 24.675 25.7 24.325 25.3 31 24.925 24.975 24.474999999999998 25.624999999999996 32 25.525 25.4 24.474999999999998 24.6 33 25.424999999999997 25.35 23.925 25.3 34 24.825 25.0 23.875 26.3 35 24.9 25.650000000000002 24.2 25.25 36 23.792844633475106 25.619214410808105 24.0180135101326 26.56992744558419 37 24.625 23.7 26.125 25.55 38 25.75 24.45 24.175 25.624999999999996 39 24.8 26.875 23.674999999999997 24.65 40 25.224999999999998 25.224999999999998 24.175 25.374999999999996 41 24.675 25.874999999999996 24.75 24.7 42 24.9 24.099999999999998 25.324999999999996 25.674999999999997 43 25.39444027047333 23.240671174555473 24.242424242424242 27.122464312546956 44 24.06805103827871 25.66925193895422 24.31823867900926 25.94445834375782 45 24.417731029301276 24.718256949661907 24.142248935637365 26.72176308539945 46 25.31930879038317 24.242424242424242 24.04207362885049 26.3961933383421 47 25.043826696719258 25.31930879038317 23.69146005509642 25.945404457801153 48 23.572144288577153 26.47795591182365 24.724448897795593 25.225450901803608 49 25.625625625625624 23.74874874874875 24.54954954954955 26.076076076076077 50 25.6 24.9 23.674999999999997 25.825 51 25.724999999999998 25.0 23.45 25.825 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 2.0 24 4.0 25 6.5 26 10.0 27 11.0 28 16.0 29 21.0 30 35.0 31 49.0 32 58.5 33 68.0 34 89.0 35 110.0 36 131.5 37 153.0 38 181.5 39 210.0 40 226.5 41 243.0 42 272.0 43 301.0 44 308.5 45 316.0 46 295.5 47 275.0 48 270.5 49 266.0 50 282.0 51 298.0 52 274.5 53 251.0 54 234.0 55 217.0 56 208.0 57 199.0 58 185.0 59 171.0 60 159.5 61 148.0 62 142.0 63 136.0 64 120.5 65 105.0 66 91.5 67 78.0 68 76.0 69 74.0 70 77.5 71 81.0 72 68.0 73 55.0 74 49.5 75 43.5 76 43.0 77 34.5 78 26.0 79 20.5 80 15.0 81 12.0 82 9.0 83 7.5 84 6.0 85 5.0 86 4.0 87 2.5 88 1.0 89 1.0 90 1.0 91 0.5 92 0.0 93 0.5 94 1.0 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.075 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.17500000000000002 44 0.075 45 0.17500000000000002 46 0.17500000000000002 47 0.17500000000000002 48 0.2 49 0.1 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77386934673366 99.275 2 0.20100502512562815 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02512562814070352 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCC 13 0.325 TruSeq Adapter, Index 8 (100% over 51bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.025 0.0 10 0.025 0.0 0.0 0.025 0.0 11 0.025 0.0 0.0 0.025 0.0 12 0.025 0.0 0.0 0.025 0.0 13 0.025 0.0 0.0 0.025 0.0 14 0.025 0.0 0.0 0.025 0.0 15 0.025 0.0 0.0 0.025 0.0 16 0.025 0.0 0.0 0.025 0.0 17 0.025 0.0 0.0 0.025 0.0 18 0.025 0.0 0.0 0.025 0.0 19 0.05 0.0 0.0 0.025 0.0 20 0.05 0.0 0.0 0.025 0.0 21 0.05 0.0 0.0 0.025 0.0 22 0.05 0.0 0.0 0.025 0.0 23 0.05 0.0 0.0 0.025 0.0 24 0.05 0.0 0.0 0.025 0.0 25 0.05 0.0 0.0 0.025 0.0 26 0.05 0.0 0.0 0.025 0.0 27 0.05 0.0 0.0 0.025 0.0 28 0.05 0.0 0.0 0.025 0.0 29 0.05 0.0 0.0 0.025 0.0 30 0.05 0.0 0.0 0.025 0.0 31 0.075 0.0 0.0 0.025 0.0 32 0.075 0.0 0.0 0.025 0.0 33 0.075 0.0 0.0 0.025 0.0 34 0.075 0.0 0.0 0.025 0.0 35 0.075 0.0 0.0 0.025 0.0 36 0.075 0.0 0.0 0.025 0.0 37 0.075 0.0 0.0 0.025 0.0 38 0.1 0.0 0.0 0.025 0.0 39 0.125 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 658028 READS because READLEN < 1 Read 658028 spots for ERR2276349.sra Written 658028 spots for ERR2276349.sra Rejected 658028 READS because READLEN < 1 Read 658028 spots for ERR2276349.sra Written 658028 spots for ERR2276349.sra Rejected 658028 READS because READLEN < 1 Read 658028 spots for ERR2276349.sra Written 658028 spots for ERR2276349.sra Rejected 658028 READS because READLEN < 1 Read 658028 spots for ERR2276349.sra Written 658028 spots for ERR2276349.sra Rejected 658028 READS because READLEN < 1 Read 658028 spots for ERR2276349.sra Written 658028 spots for ERR2276349.sra Rejected 658028 READS because READLEN < 1 Read 658028 spots for ERR2276349.sra Written 658028 spots for ERR2276349.sra Rejected 658028 READS because READLEN < 1 Read 658028 spots for ERR2276349.sra Written 658028 spots for ERR2276349.sra Rejected 658046 READS because READLEN < 1 Read 658046 spots for ERR2276349.sra Written 658046 spots for ERR2276349.sra Rejected 658028 READS because READLEN < 1 Read 658028 spots for ERR2276349.sra Written 658028 spots for ERR2276349.sra Rejected 658028 READS because READLEN < 1 Read 658028 spots for ERR2276349.sra Written 658028 spots for ERR2276349.sra Rejected 658028 READS because READLEN < 1 Read 658028 spots for ERR2276349.sra Written 658028 spots for ERR2276349.sra Rejected 658028 READS because READLEN < 1 Read 658028 spots for ERR2276349.sra Written 658028 spots for ERR2276349.sra Rejected 658028 READS because READLEN < 1 Read 658028 spots for ERR2276349.sra Written 658028 spots for ERR2276349.sra Rejected 658028 READS because READLEN < 1 Read 658028 spots for ERR2276349.sra Written 658028 spots for ERR2276349.sra Rejected 658028 READS because READLEN < 1 Read 658028 spots for ERR2276349.sra Written 658028 spots for ERR2276349.sra Rejected 658028 READS because READLEN < 1 Read 658028 spots for ERR2276349.sra Written 658028 spots for ERR2276349.sra Rejected 658028 READS because READLEN < 1 Read 658028 spots for ERR2276349.sra Written 658028 spots for ERR2276349.sra Rejected 658028 READS because READLEN < 1 Read 658028 spots for ERR2276349.sra Written 658028 spots for ERR2276349.sra Rejected 658028 READS because READLEN < 1 Read 658028 spots for ERR2276349.sra Written 658028 spots for ERR2276349.sra Rejected 658028 READS because READLEN < 1 Read 658028 spots for ERR2276349.sra Written 658028 spots for ERR2276349.sra SRR ids: ['ERR2276349.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f81pm54v ERR2276349.sra spots: 13160578 blocks: [[1, 658028], [658029, 1316056], [1316057, 1974084], [1974085, 2632112], [2632113, 3290140], [3290141, 3948168], [3948169, 4606196], [4606197, 5264224], [5264225, 5922252], [5922253, 6580280], [6580281, 7238308], [7238309, 7896336], [7896337, 8554364], [8554365, 9212392], [9212393, 9870420], [9870421, 10528448], [10528449, 11186476], [11186477, 11844504], [11844505, 12502532], [12502533, 13160578]] ERR2276349 file size 1854710 ERR2276349 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR2276349 ERR2276349_1.fastq Input file: ERR2276349_1.fastq trimmed: ERR2276349-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 21:44:34 2024 >> started Fri Dec 6 21:44:40 2024 >> done (6.098s) 13160578 reads processed; of these: 178698 ( 1.36%) short reads filtered out after trimming by size control 370632 ( 2.82%) empty reads filtered out after trimming by size control 12611248 (95.83%) reads available; of these: 954961 ( 7.57%) trimmed reads available after processing 11656287 (92.43%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 12572 0.10% 19 12303 0.10% 20 12608 0.10% 21 12826 0.10% 22 13122 0.10% 23 12928 0.10% 24 13299 0.11% 25 14178 0.11% 26 14734 0.12% 27 14726 0.12% 28 15097 0.12% 29 16418 0.13% 30 16632 0.13% 31 17940 0.14% 32 19090 0.15% 33 19736 0.16% 34 21626 0.17% 35 21766 0.17% 36 23343 0.19% 37 24490 0.19% 38 25855 0.21% 39 27990 0.22% 40 29808 0.24% 41 33304 0.26% 42 38135 0.30% 43 38745 0.31% 44 46728 0.37% 45 46970 0.37% 46 51773 0.41% 47 60445 0.48% 48 70124 0.56% 49 75812 0.60% 50 79838 0.63% 51 11656287 92.43% 12611248 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=17 prefix-density=0.10 prefix-fanout=2.0 sequence=ACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTGA criterion=fanout-score sequence-density=0.03 sequence-density-rank=14 fanout-score=146.64 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=16.1 sequence=GCCGCCGCCGCG Started job on | Dec 06 21:44:53 Started mapping on | Dec 06 21:44:54 Finished on | Dec 06 21:45:13 Mapping speed, Million of reads per hour | 2389.50 Number of input reads | 12611248 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 11555678 Uniquely mapped reads % | 91.63% Average mapped length | 50.05 Number of splices: Total | 1572598 Number of splices: Annotated (sjdb) | 1486059 Number of splices: GT/AG | 1545077 Number of splices: GC/AG | 25305 Number of splices: AT/AC | 929 Number of splices: Non-canonical | 1287 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 1.33 Insertion rate per base | 0.00% Insertion average length | 1.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 473611 % of reads mapped to multiple loci | 3.76% Number of reads mapped to too many loci | 428043 % of reads mapped to too many loci | 3.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.03% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 581959 581959 581959 N_multimapping 473611 473611 473611 N_noFeature 558310 5988571 5923447 N_ambiguous 218125 8457 8485 UnstrandedReadsAssigned:10779243 PositiveStrandReadsAssigned:5558650 NegativeStrandReadsAssigned:5623746 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 ERR2276349 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR2276349-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,611,248 reads, 10,726,667 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,163 rounds 52973 ERR2276349.ke.tsv 35125 ERR2276349.se.tsv 88098 total ==> ERR2276349.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 29.1329 4.66712 PNS24249 1928 1829 28.9304 2.39462 PNS24246 1044 945 29.1329 4.66712 PNS24248 1044 945 29.1329 4.66712 PNS24244 1471 1372 140.671 15.522 PNS24243 293 194 5 3.9018 KQK14069 1603 1504 24355.3 2451.56 KQK14071 474 375 5760.88 2325.7 ==> ERR2276349.se.tsv <== BRADI_1g14170v3 33487 BRADI_1g53295v3 226 BRADI_1g59795v3 427 BRADI_1g07683v3 0 BRADI_1g00485v3 16 BRADI_1g20270v3 318 BRADI_1g74790v3 247 BRADI_1g09890v3 0 BRADI_1g77505v3 290 BRADI_1g48960v3 0 ERR2276349 completed mapping pipeline successfully