Starting /dee2/code/volunteer_pipeline.sh ERR3079462 current disk space = 1543005822976 free memory = 1598527952 ERR3079462 SRAfilesize 055cea42703a9a48a36a4063a1045f48 ERR3079462.sra ERR3079462.sra file validated ERR3079462 is single end ERR3079462 is conventional basespace ERR3079462 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3079462_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.806 33.0 33.0 33.0 14.0 33.0 2 31.91825 33.0 33.0 33.0 27.0 33.0 3 32.02875 33.0 33.0 33.0 33.0 33.0 4 32.30625 33.0 33.0 33.0 33.0 33.0 5 32.46875 33.0 33.0 33.0 33.0 33.0 6 36.0575 37.0 37.0 37.0 33.0 37.0 7 36.16975 37.0 37.0 37.0 37.0 37.0 8 36.2655 37.0 37.0 37.0 37.0 37.0 9 36.30775 37.0 37.0 37.0 37.0 37.0 10 36.409 37.0 37.0 37.0 37.0 37.0 11 36.44875 37.0 37.0 37.0 37.0 37.0 12 36.37 37.0 37.0 37.0 37.0 37.0 13 36.411 37.0 37.0 37.0 37.0 37.0 14 36.3475 37.0 37.0 37.0 37.0 37.0 15 36.32575 37.0 37.0 37.0 37.0 37.0 16 36.40425 37.0 37.0 37.0 37.0 37.0 17 36.33575 37.0 37.0 37.0 37.0 37.0 18 36.28525 37.0 37.0 37.0 37.0 37.0 19 36.34375 37.0 37.0 37.0 37.0 37.0 20 36.30875 37.0 37.0 37.0 37.0 37.0 21 36.34075 37.0 37.0 37.0 37.0 37.0 22 36.3625 37.0 37.0 37.0 37.0 37.0 23 36.32725 37.0 37.0 37.0 37.0 37.0 24 36.2835 37.0 37.0 37.0 37.0 37.0 25 36.29075 37.0 37.0 37.0 37.0 37.0 26 36.24625 37.0 37.0 37.0 37.0 37.0 27 36.33225 37.0 37.0 37.0 37.0 37.0 28 36.214 37.0 37.0 37.0 37.0 37.0 29 36.28375 37.0 37.0 37.0 37.0 37.0 30 36.14 37.0 37.0 37.0 37.0 37.0 31 36.0355 37.0 37.0 37.0 37.0 37.0 32 36.151 37.0 37.0 37.0 37.0 37.0 33 36.203 37.0 37.0 37.0 37.0 37.0 34 36.179 37.0 37.0 37.0 37.0 37.0 35 36.214 37.0 37.0 37.0 37.0 37.0 36 36.231 37.0 37.0 37.0 37.0 37.0 37 36.1305 37.0 37.0 37.0 37.0 37.0 38 35.96325 37.0 37.0 37.0 37.0 37.0 39 36.09525 37.0 37.0 37.0 37.0 37.0 40 36.1175 37.0 37.0 37.0 37.0 37.0 41 36.2075 37.0 37.0 37.0 37.0 37.0 42 36.1375 37.0 37.0 37.0 37.0 37.0 43 36.10875 37.0 37.0 37.0 37.0 37.0 44 36.09775 37.0 37.0 37.0 37.0 37.0 45 35.605 37.0 37.0 37.0 33.0 37.0 46 35.95225 37.0 37.0 37.0 37.0 37.0 47 36.00475 37.0 37.0 37.0 37.0 37.0 48 35.95625 37.0 37.0 37.0 37.0 37.0 49 35.81625 37.0 37.0 37.0 37.0 37.0 50 35.703 37.0 37.0 37.0 37.0 37.0 51 35.214 37.0 37.0 37.0 33.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 0.0 5 1.0 6 0.0 7 2.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 2.0 16 1.0 17 3.0 18 3.0 19 1.0 20 1.0 21 3.0 22 2.0 23 2.0 24 3.0 25 5.0 26 13.0 27 9.0 28 27.0 29 23.0 30 41.0 31 55.0 32 75.0 33 91.0 34 146.0 35 579.0 36 2903.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.93874760732841 14.246650259775773 8.285479901558656 45.52912223133716 2 27.224999999999998 16.425 33.35 23.0 3 25.3 21.25 21.475 31.974999999999998 4 29.075 26.025 17.65 27.250000000000004 5 29.049999999999997 29.825000000000003 19.400000000000002 21.725 6 22.825 34.5 21.275 21.4 7 21.9 19.175 35.099999999999994 23.825 8 20.775 22.425 28.075 28.725 9 23.625 19.55 29.725 27.1 10 23.3 33.75 22.825 20.125 11 27.125 24.7 19.950000000000003 28.225 12 25.275 22.400000000000002 23.875 28.449999999999996 13 23.200000000000003 25.35 26.075 25.374999999999996 14 25.7 24.15 24.425 25.724999999999998 15 24.6 25.124999999999996 24.15 26.125 16 24.075 24.9 23.75 27.275 17 26.575 24.2 23.1 26.125 18 25.724999999999998 24.2 24.65 25.424999999999997 19 26.224999999999998 23.674999999999997 23.400000000000002 26.700000000000003 20 27.525 23.5 23.25 25.724999999999998 21 26.224999999999998 23.549999999999997 23.3 26.924999999999997 22 25.124999999999996 24.7 23.25 26.924999999999997 23 25.1 24.224999999999998 23.175 27.500000000000004 24 25.575 24.3 23.275000000000002 26.85 25 26.400000000000002 23.925 23.95 25.724999999999998 26 25.55 24.15 22.875 27.425 27 26.700000000000003 23.150000000000002 23.075000000000003 27.075 28 25.25 23.150000000000002 24.275 27.325 29 25.7 23.425 24.075 26.8 30 25.6 23.175 24.825 26.400000000000002 31 26.650000000000002 23.325000000000003 23.974999999999998 26.05 32 25.5 24.575 23.275000000000002 26.650000000000002 33 25.15 24.224999999999998 23.474999999999998 27.150000000000002 34 25.674999999999997 23.075000000000003 23.400000000000002 27.85 35 27.150000000000002 23.674999999999997 23.674999999999997 25.5 36 24.625 23.974999999999998 23.625 27.775 37 26.35 23.65 23.05 26.950000000000003 38 26.125 23.474999999999998 22.975 27.425 39 26.825 23.1 22.35 27.725 40 25.2 23.125 23.7 27.975 41 26.275 24.125 22.725 26.875 42 25.35 23.825 23.575 27.250000000000004 43 24.95 24.425 23.724999999999998 26.900000000000002 44 26.974999999999998 24.675 23.325000000000003 25.025 45 25.8 24.15 23.825 26.224999999999998 46 24.775 23.25 23.775 28.199999999999996 47 25.924999999999997 23.1 23.325000000000003 27.650000000000002 48 26.0 24.099999999999998 23.525 26.375 49 27.525 22.900000000000002 22.225 27.35 50 24.8 24.175 22.85 28.175 51 25.974999999999998 24.75 23.849999999999998 25.424999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 2.0 2 2.0 3 2.0 4 2.0 5 2.0 6 2.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 2.0 22 4.0 23 3.5 24 3.0 25 3.0 26 9.5 27 16.0 28 13.5 29 11.0 30 19.5 31 28.0 32 36.0 33 44.0 34 70.5 35 97.0 36 115.5 37 134.0 38 166.0 39 198.0 40 208.5 41 219.0 42 242.0 43 265.0 44 273.0 45 281.0 46 276.5 47 272.0 48 271.5 49 271.0 50 259.0 51 247.0 52 250.0 53 253.0 54 232.5 55 212.0 56 201.0 57 190.0 58 197.5 59 205.0 60 185.0 61 165.0 62 149.5 63 134.0 64 124.0 65 114.0 66 126.0 67 138.0 68 117.5 69 97.0 70 103.5 71 110.0 72 108.0 73 106.0 74 81.5 75 53.5 76 50.0 77 40.5 78 31.0 79 26.0 80 21.0 81 12.0 82 3.0 83 4.5 84 6.0 85 5.0 86 4.0 87 3.0 88 2.0 89 1.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.575000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.32499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.52529875413171 96.875 2 1.2712941774726672 2.5 3 0.17798118484617342 0.525 4 0.02542588354945334 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1846272 READS because READLEN < 1 Read 1846272 spots for ERR3079462.sra Written 1846272 spots for ERR3079462.sra Rejected 1846272 READS because READLEN < 1 Read 1846272 spots for ERR3079462.sra Written 1846272 spots for ERR3079462.sra Rejected 1846272 READS because READLEN < 1 Read 1846272 spots for ERR3079462.sra Written 1846272 spots for ERR3079462.sra Rejected 1846272 READS because READLEN < 1 Read 1846272 spots for ERR3079462.sra Written 1846272 spots for ERR3079462.sra Rejected 1846272 READS because READLEN < 1 Read 1846272 spots for ERR3079462.sra Written 1846272 spots for ERR3079462.sra Rejected 1846272 READS because READLEN < 1 Read 1846272 spots for ERR3079462.sra Written 1846272 spots for ERR3079462.sra Rejected 1846272 READS because READLEN < 1 Read 1846272 spots for ERR3079462.sra Written 1846272 spots for ERR3079462.sra Rejected 1846272 READS because READLEN < 1 Read 1846272 spots for ERR3079462.sra Written 1846272 spots for ERR3079462.sra Rejected 1846272 READS because READLEN < 1 Read 1846272 spots for ERR3079462.sra Written 1846272 spots for ERR3079462.sra Rejected 1846272 READS because READLEN < 1 Read 1846272 spots for ERR3079462.sra Written 1846272 spots for ERR3079462.sra Rejected 1846272 READS because READLEN < 1 Read 1846272 spots for ERR3079462.sra Written 1846272 spots for ERR3079462.sra Rejected 1846272 READS because READLEN < 1 Read 1846272 spots for ERR3079462.sra Written 1846272 spots for ERR3079462.sra Rejected 1846290 READS because READLEN < 1 Read 1846290 spots for ERR3079462.sra Written 1846290 spots for ERR3079462.sra Rejected 1846272 READS because READLEN < 1 Read 1846272 spots for ERR3079462.sra Written 1846272 spots for ERR3079462.sra Rejected 1846272 READS because READLEN < 1 Read 1846272 spots for ERR3079462.sra Written 1846272 spots for ERR3079462.sra Rejected 1846272 READS because READLEN < 1 Read 1846272 spots for ERR3079462.sra Written 1846272 spots for ERR3079462.sra Rejected 1846272 READS because READLEN < 1 Read 1846272 spots for ERR3079462.sra Written 1846272 spots for ERR3079462.sra Rejected 1846272 READS because READLEN < 1 Read 1846272 spots for ERR3079462.sra Written 1846272 spots for ERR3079462.sra Rejected 1846272 READS because READLEN < 1 Read 1846272 spots for ERR3079462.sra Written 1846272 spots for ERR3079462.sra Rejected 1846272 READS because READLEN < 1 Read 1846272 spots for ERR3079462.sra Written 1846272 spots for ERR3079462.sra SRR ids: ['ERR3079462.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_38q2iinr ERR3079462.sra spots: 36925458 blocks: [[1, 1846272], [1846273, 3692544], [3692545, 5538816], [5538817, 7385088], [7385089, 9231360], [9231361, 11077632], [11077633, 12923904], [12923905, 14770176], [14770177, 16616448], [16616449, 18462720], [18462721, 20308992], [20308993, 22155264], [22155265, 24001536], [24001537, 25847808], [25847809, 27694080], [27694081, 29540352], [29540353, 31386624], [31386625, 33232896], [33232897, 35079168], [35079169, 36925458]] ERR3079462 file size 5243062 ERR3079462 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3079462 ERR3079462_1.fastq Input file: ERR3079462_1.fastq trimmed: ERR3079462-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 11:58:38 2024 >> started Sat Dec 7 11:58:59 2024 >> done (20.276s) 36925458 reads processed; of these: 26547 ( 0.07%) short reads filtered out after trimming by size control 69704 ( 0.19%) empty reads filtered out after trimming by size control 36829207 (99.74%) reads available; of these: 1263387 ( 3.43%) trimmed reads available after processing 35565820 (96.57%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2552 0.01% 19 2848 0.01% 20 3271 0.01% 21 3706 0.01% 22 4601 0.01% 23 5558 0.02% 24 7265 0.02% 25 8247 0.02% 26 8100 0.02% 27 7890 0.02% 28 7668 0.02% 29 7260 0.02% 30 7402 0.02% 31 7415 0.02% 32 7539 0.02% 33 8010 0.02% 34 8444 0.02% 35 9369 0.03% 36 10138 0.03% 37 11313 0.03% 38 12750 0.03% 39 15010 0.04% 40 16716 0.05% 41 19212 0.05% 42 22003 0.06% 43 26820 0.07% 44 34365 0.09% 45 44675 0.12% 46 55060 0.15% 47 75156 0.20% 48 118101 0.32% 49 219254 0.60% 50 465669 1.26% 51 35565820 96.57% 36829207 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.96 fanout-score-rank=13 prefix-density=0.53 prefix-fanout=1.8 sequence=CCATGAAGACCTTTCTCATCCTCGCCCTCCTCGCCATCGTGGCGACCACCACCACTGCGCTGGTAGTCGACCCAGTCACTAGATCTTTTCAGCCGTCACAGGAACAATCATGCCAGCAGCC criterion=fanout-score sequence-density=0.03 sequence-density-rank=22 fanout-score=21.40 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=5.8 sequence=GCGGCGGCCGCTGCAAAACCCGGGGCGCGAGCCCGGGCGGAGCGGCCGTCGGTGCAGATCTTGGTGGTAGTAGCAAATATTCAAATGAGAACTTTGAAGGCCGAAGAGGAGAAAGGTTCCATGTGAACGGCACTTGCACATGGGTAAGCCGATCCTAAGGGACGGGGTAACCCCGGCAGATAGCGCGATCACGCGTATCCCCCGAAAGGGAATCGGGTTAAGATTTCCCGAGCCGGGATGTGGCGGTTGACGGCGACGTTAGGAAGTCCGGAGACGCCGGCGGGGGCCTCGGGAAGAGTTATCTTTTCTGCTTAACGGCCTGCCAACCCTGGAATCGGTTCAGCCGGAGGTAGGGTCCAGTGGCCGGAAGAGCACCGCACGTCGCGCGGTGTCCGGTGCGCCCCCGGCGGCCCATGAAAATCCGGAGGACCGAGTACCGTTCACGCCCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAACAGCCTCTGGCCAATGGAACAATGTA Started job on | Dec 07 11:59:09 Started mapping on | Dec 07 11:59:09 Finished on | Dec 07 11:59:49 Mapping speed, Million of reads per hour | 3314.63 Number of input reads | 36829207 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 29476668 Uniquely mapped reads % | 80.04% Average mapped length | 50.66 Number of splices: Total | 3943074 Number of splices: Annotated (sjdb) | 3778775 Number of splices: GT/AG | 3893308 Number of splices: GC/AG | 41948 Number of splices: AT/AC | 2448 Number of splices: Non-canonical | 5370 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.00% Deletion average length | 1.32 Insertion rate per base | 0.00% Insertion average length | 1.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 3979052 % of reads mapped to multiple loci | 10.80% Number of reads mapped to too many loci | 3000980 % of reads mapped to too many loci | 8.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.52% % of reads unmapped: other | 0.49% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3373487 3373487 3373487 N_multimapping 3979052 3979052 3979052 N_noFeature 1223858 14985698 15223375 N_ambiguous 529134 19176 20653 UnstrandedReadsAssigned:27723676 PositiveStrandReadsAssigned:14471794 NegativeStrandReadsAssigned:14232640 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 ERR3079462 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR3079462-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,829,207 reads, 30,079,959 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,192 rounds 52973 ERR3079462.ke.tsv 35125 ERR3079462.se.tsv 88098 total ==> ERR3079462.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 144.179 8.39614 PNS24247 1044 945 77.1249 3.978 PNS24249 1928 1829 431.48 11.4987 PNS24246 1044 945 77.1249 3.978 PNS24248 1044 945 77.1249 3.978 PNS24244 1471 1372 44.9656 1.59745 PNS24243 293 194 11 2.76371 KQK14069 1603 1504 7111.25 230.463 KQK14071 474 375 2340.43 304.205 ==> ERR3079462.se.tsv <== BRADI_1g14170v3 10546 BRADI_1g53295v3 393 BRADI_1g59795v3 321 BRADI_1g07683v3 0 BRADI_1g00485v3 15 BRADI_1g20270v3 1358 BRADI_1g74790v3 56 BRADI_1g09890v3 21 BRADI_1g77505v3 496 BRADI_1g48960v3 13 ERR3079462 completed mapping pipeline successfully