Starting /dee2/code/volunteer_pipeline.sh ERR3079463 current disk space = 1543074410496 free memory = 1603025528 ERR3079463 SRAfilesize c6df00099bc3307329115d550fb8b85f ERR3079463.sra ERR3079463.sra file validated ERR3079463 is single end ERR3079463 is conventional basespace ERR3079463 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3079463_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.46975 33.0 14.0 33.0 2.0 33.0 2 30.7315 33.0 27.0 33.0 27.0 33.0 3 31.01375 33.0 33.0 33.0 27.0 33.0 4 31.49275 33.0 33.0 33.0 27.0 33.0 5 32.61375 33.0 33.0 33.0 33.0 33.0 6 36.10575 37.0 37.0 37.0 33.0 37.0 7 36.38475 37.0 37.0 37.0 37.0 37.0 8 36.32925 37.0 37.0 37.0 37.0 37.0 9 36.50225 37.0 37.0 37.0 37.0 37.0 10 36.5765 37.0 37.0 37.0 37.0 37.0 11 36.54525 37.0 37.0 37.0 37.0 37.0 12 36.62825 37.0 37.0 37.0 37.0 37.0 13 36.5255 37.0 37.0 37.0 37.0 37.0 14 36.53525 37.0 37.0 37.0 37.0 37.0 15 36.617 37.0 37.0 37.0 37.0 37.0 16 36.4135 37.0 37.0 37.0 37.0 37.0 17 36.546 37.0 37.0 37.0 37.0 37.0 18 36.55325 37.0 37.0 37.0 37.0 37.0 19 36.64075 37.0 37.0 37.0 37.0 37.0 20 36.55375 37.0 37.0 37.0 37.0 37.0 21 36.5725 37.0 37.0 37.0 37.0 37.0 22 36.53525 37.0 37.0 37.0 37.0 37.0 23 36.598 37.0 37.0 37.0 37.0 37.0 24 36.573 37.0 37.0 37.0 37.0 37.0 25 36.5145 37.0 37.0 37.0 37.0 37.0 26 36.54875 37.0 37.0 37.0 37.0 37.0 27 36.4745 37.0 37.0 37.0 37.0 37.0 28 36.42975 37.0 37.0 37.0 37.0 37.0 29 36.55425 37.0 37.0 37.0 37.0 37.0 30 36.535 37.0 37.0 37.0 37.0 37.0 31 36.48025 37.0 37.0 37.0 37.0 37.0 32 36.5465 37.0 37.0 37.0 37.0 37.0 33 36.502 37.0 37.0 37.0 37.0 37.0 34 36.5635 37.0 37.0 37.0 37.0 37.0 35 36.52125 37.0 37.0 37.0 37.0 37.0 36 36.51225 37.0 37.0 37.0 37.0 37.0 37 36.5515 37.0 37.0 37.0 37.0 37.0 38 36.55275 37.0 37.0 37.0 37.0 37.0 39 36.4565 37.0 37.0 37.0 37.0 37.0 40 36.51625 37.0 37.0 37.0 37.0 37.0 41 36.4345 37.0 37.0 37.0 37.0 37.0 42 36.42575 37.0 37.0 37.0 37.0 37.0 43 36.425 37.0 37.0 37.0 37.0 37.0 44 36.4695 37.0 37.0 37.0 37.0 37.0 45 36.46025 37.0 37.0 37.0 37.0 37.0 46 36.4675 37.0 37.0 37.0 37.0 37.0 47 36.43425 37.0 37.0 37.0 37.0 37.0 48 36.482 37.0 37.0 37.0 37.0 37.0 49 36.376 37.0 37.0 37.0 37.0 37.0 50 36.478 37.0 37.0 37.0 37.0 37.0 51 36.50375 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 1.0 19 1.0 20 0.0 21 0.0 22 0.0 23 1.0 24 4.0 25 6.0 26 6.0 27 6.0 28 12.0 29 22.0 30 25.0 31 43.0 32 51.0 33 90.0 34 176.0 35 1047.0 36 2508.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.724072910119418 15.304839723444374 6.945317410433689 49.02576995600251 2 26.1 16.775000000000002 34.75 22.375 3 23.799999999999997 21.5 21.625 33.074999999999996 4 29.075 23.225 17.7 30.0 5 31.75 25.85 21.0 21.4 6 25.575 32.025 20.65 21.75 7 22.1 21.4 32.95 23.549999999999997 8 22.25 22.0 27.500000000000004 28.249999999999996 9 22.900000000000002 19.425 30.625000000000004 27.05 10 23.7 30.625000000000004 22.95 22.725 11 27.200000000000003 24.25 20.875 27.675 12 25.674999999999997 21.05 24.575 28.7 13 25.7 23.7 25.025 25.575 14 25.8 23.799999999999997 24.3 26.1 15 25.874999999999996 23.625 23.45 27.05 16 26.575 23.45 22.475 27.500000000000004 17 26.525 24.0 23.75 25.724999999999998 18 24.925 24.474999999999998 24.45 26.150000000000002 19 26.224999999999998 24.075 23.225 26.474999999999998 20 26.825 23.849999999999998 23.35 25.974999999999998 21 25.775 24.55 23.674999999999997 26.0 22 25.474999999999998 23.775 23.45 27.3 23 25.624999999999996 24.6 23.599999999999998 26.174999999999997 24 27.075 23.775 22.975 26.174999999999997 25 26.775 23.724999999999998 22.2 27.3 26 26.150000000000002 24.625 23.674999999999997 25.55 27 25.924999999999997 24.325 23.849999999999998 25.900000000000002 28 27.075 23.825 21.75 27.35 29 24.875 24.125 22.95 28.050000000000004 30 25.624999999999996 23.7 24.525 26.150000000000002 31 26.05 22.925 22.975 28.050000000000004 32 26.900000000000002 24.275 23.225 25.6 33 24.25 24.325 24.375 27.05 34 26.25 23.25 23.150000000000002 27.35 35 25.6 23.674999999999997 24.45 26.275 36 25.8 24.0 23.5 26.700000000000003 37 27.925 22.275 22.875 26.924999999999997 38 26.974999999999998 23.974999999999998 23.125 25.924999999999997 39 27.175 22.725 23.05 27.05 40 26.650000000000002 24.4 23.075000000000003 25.874999999999996 41 26.5 25.650000000000002 22.675 25.174999999999997 42 26.25 24.525 23.425 25.8 43 27.3 23.775 22.7 26.224999999999998 44 26.3 23.425 24.05 26.224999999999998 45 26.85 23.775 22.625 26.75 46 27.075 23.3 21.95 27.675 47 26.875 24.474999999999998 23.0 25.650000000000002 48 25.074999999999996 24.375 24.0 26.55 49 25.900000000000002 24.25 22.75 27.1 50 27.925 23.775 22.675 25.624999999999996 51 25.374999999999996 24.8 22.975 26.85 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.5 20 1.0 21 2.0 22 3.0 23 3.0 24 3.0 25 3.0 26 6.5 27 10.0 28 13.5 29 17.0 30 27.0 31 37.0 32 47.0 33 57.0 34 75.0 35 93.0 36 117.0 37 141.0 38 162.5 39 184.0 40 193.5 41 203.0 42 241.5 43 280.0 44 269.0 45 258.0 46 284.0 47 310.0 48 311.5 49 313.0 50 276.0 51 239.0 52 234.5 53 230.0 54 210.0 55 190.0 56 178.0 57 166.0 58 167.0 59 168.0 60 156.0 61 144.0 62 161.0 63 178.0 64 150.5 65 123.0 66 120.0 67 117.0 68 109.0 69 101.0 70 108.5 71 116.0 72 104.0 73 92.0 74 84.5 75 68.0 76 59.0 77 47.5 78 36.0 79 29.5 80 23.0 81 21.0 82 19.0 83 11.5 84 4.0 85 2.5 86 1.0 87 0.5 88 0.0 89 0.5 90 1.0 91 1.5 92 2.0 93 1.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 20.45 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14141414141415 98.15 2 0.7070707070707071 1.4000000000000001 3 0.15151515151515152 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.025 0.0 0.0 17 0.0 0.0 0.025 0.0 0.0 18 0.0 0.0 0.025 0.0 0.0 19 0.0 0.0 0.025 0.0 0.0 20 0.0 0.0 0.025 0.0 0.0 21 0.0 0.0 0.025 0.0 0.0 22 0.0 0.0 0.025 0.0 0.0 23 0.0 0.0 0.025 0.0 0.0 24 0.0 0.0 0.025 0.0 0.0 25 0.0 0.0 0.025 0.0 0.0 26 0.0 0.0 0.025 0.0 0.0 27 0.0 0.0 0.025 0.0 0.0 28 0.0 0.0 0.025 0.0 0.0 29 0.0 0.0 0.025 0.0 0.0 30 0.0 0.0 0.025 0.0 0.0 31 0.0 0.0 0.025 0.0 0.0 32 0.0 0.0 0.025 0.0 0.0 33 0.0 0.0 0.025 0.0 0.0 34 0.0 0.0 0.025 0.0 0.0 35 0.0 0.0 0.025 0.0 0.0 36 0.0 0.0 0.025 0.0 0.0 37 0.0 0.0 0.025 0.0 0.0 38 0.0 0.0 0.025 0.0 0.0 39 0.0 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 2158926 READS because READLEN < 1 Read 2158926 spots for ERR3079463.sra Written 2158926 spots for ERR3079463.sra Rejected 2158926 READS because READLEN < 1 Read 2158926 spots for ERR3079463.sra Written 2158926 spots for ERR3079463.sra Rejected 2158926 READS because READLEN < 1 Read 2158926 spots for ERR3079463.sra Written 2158926 spots for ERR3079463.sra Rejected 2158926 READS because READLEN < 1 Read 2158926 spots for ERR3079463.sra Written 2158926 spots for ERR3079463.sra Rejected 2158926 READS because READLEN < 1 Read 2158926 spots for ERR3079463.sra Written 2158926 spots for ERR3079463.sra Rejected 2158926 READS because READLEN < 1 Read 2158926 spots for ERR3079463.sra Written 2158926 spots for ERR3079463.sra Rejected 2158926 READS because READLEN < 1 Read 2158926 spots for ERR3079463.sra Written 2158926 spots for ERR3079463.sra Rejected 2158926 READS because READLEN < 1 Read 2158926 spots for ERR3079463.sra Written 2158926 spots for ERR3079463.sra Rejected 2158926 READS because READLEN < 1 Read 2158926 spots for ERR3079463.sra Written 2158926 spots for ERR3079463.sra Rejected 2158926 READS because READLEN < 1 Read 2158926 spots for ERR3079463.sra Written 2158926 spots for ERR3079463.sra Rejected 2158926 READS because READLEN < 1 Read 2158926 spots for ERR3079463.sra Written 2158926 spots for ERR3079463.sra Rejected 2158926 READS because READLEN < 1 Read 2158926 spots for ERR3079463.sra Written 2158926 spots for ERR3079463.sra Rejected 2158926 READS because READLEN < 1 Read 2158926 spots for ERR3079463.sra Written 2158926 spots for ERR3079463.sra Rejected 2158926 READS because READLEN < 1 Read 2158926 spots for ERR3079463.sra Written 2158926 spots for ERR3079463.sra Rejected 2158926 READS because READLEN < 1 Read 2158926 spots for ERR3079463.sra Written 2158926 spots for ERR3079463.sra Rejected 2158926 READS because READLEN < 1 Read 2158926 spots for ERR3079463.sra Written 2158926 spots for ERR3079463.sra Rejected 2158926 READS because READLEN < 1 Read 2158926 spots for ERR3079463.sra Written 2158926 spots for ERR3079463.sra Rejected 2158926 READS because READLEN < 1 Read 2158926 spots for ERR3079463.sra Written 2158926 spots for ERR3079463.sra Rejected 2158926 READS because READLEN < 1 Read 2158926 spots for ERR3079463.sra Written 2158926 spots for ERR3079463.sra Rejected 2158934 READS because READLEN < 1 Read 2158934 spots for ERR3079463.sra Written 2158934 spots for ERR3079463.sra SRR ids: ['ERR3079463.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qaq6etxd ERR3079463.sra spots: 43178528 blocks: [[1, 2158926], [2158927, 4317852], [4317853, 6476778], [6476779, 8635704], [8635705, 10794630], [10794631, 12953556], [12953557, 15112482], [15112483, 17271408], [17271409, 19430334], [19430335, 21589260], [21589261, 23748186], [23748187, 25907112], [25907113, 28066038], [28066039, 30224964], [30224965, 32383890], [32383891, 34542816], [34542817, 36701742], [36701743, 38860668], [38860669, 41019594], [41019595, 43178528]] ERR3079463 file size 6134613 ERR3079463 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3079463 ERR3079463_1.fastq Input file: ERR3079463_1.fastq trimmed: ERR3079463-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:08:48 2024 >> started Sat Dec 7 12:09:09 2024 >> done (20.882s) 43178528 reads processed; of these: 3457 ( 0.01%) short reads filtered out after trimming by size control 46625 ( 0.11%) empty reads filtered out after trimming by size control 43128446 (99.88%) reads available; of these: 53053 ( 0.12%) trimmed reads available after processing 43075393 (99.88%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 471 0.00% 19 562 0.00% 20 698 0.00% 21 810 0.00% 22 1035 0.00% 23 1361 0.00% 24 1784 0.00% 25 2208 0.01% 26 2197 0.01% 27 2026 0.00% 28 1998 0.00% 29 1767 0.00% 30 1692 0.00% 31 1640 0.00% 32 1628 0.00% 33 1583 0.00% 34 1516 0.00% 35 1525 0.00% 36 1611 0.00% 37 1556 0.00% 38 1693 0.00% 39 1609 0.00% 40 1688 0.00% 41 1646 0.00% 42 1731 0.00% 43 1763 0.00% 44 1757 0.00% 45 1787 0.00% 46 1768 0.00% 47 1979 0.00% 48 1958 0.00% 49 1919 0.00% 50 2087 0.00% 51 43075393 99.88% 43128446 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=124.54 fanout-score-rank=6 prefix-density=0.59 prefix-fanout=19.3 sequence=GCCGCCGCCGCC criterion=fanout-score sequence-density=0.04 sequence-density-rank=11 fanout-score=234.11 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=19.8 sequence=CCGCCGCCGCCT Started job on | Dec 07 12:09:20 Started mapping on | Dec 07 12:09:21 Finished on | Dec 07 12:09:58 Mapping speed, Million of reads per hour | 4196.28 Number of input reads | 43128446 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 36088569 Uniquely mapped reads % | 83.68% Average mapped length | 50.78 Number of splices: Total | 5326965 Number of splices: Annotated (sjdb) | 5094303 Number of splices: GT/AG | 5255218 Number of splices: GC/AG | 61753 Number of splices: AT/AC | 4049 Number of splices: Non-canonical | 5945 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.00% Deletion average length | 1.32 Insertion rate per base | 0.00% Insertion average length | 1.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2234005 % of reads mapped to multiple loci | 5.18% Number of reads mapped to too many loci | 4447338 % of reads mapped to too many loci | 10.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.57% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4805872 4805872 4805872 N_multimapping 2234005 2234005 2234005 N_noFeature 1624056 18507533 18577528 N_ambiguous 684476 30769 29095 UnstrandedReadsAssigned:33780037 PositiveStrandReadsAssigned:17550267 NegativeStrandReadsAssigned:17481946 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 ERR3079463 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR3079463-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 43,128,446 reads, 35,490,516 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,175 rounds 52973 ERR3079463.ke.tsv 35125 ERR3079463.se.tsv 88098 total ==> ERR3079463.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 82.4686 3.8748 PNS24249 1928 1829 578.893 14.0532 PNS24246 1044 945 82.4686 3.8748 PNS24248 1044 945 82.4686 3.8748 PNS24244 1471 1372 42.7012 1.3819 PNS24243 293 194 9 2.05984 KQK14069 1603 1504 9797.63 289.245 KQK14071 474 375 2851.88 337.67 ==> ERR3079463.se.tsv <== BRADI_1g14170v3 13633 BRADI_1g53295v3 393 BRADI_1g59795v3 591 BRADI_1g07683v3 0 BRADI_1g00485v3 31 BRADI_1g20270v3 3001 BRADI_1g74790v3 157 BRADI_1g09890v3 32 BRADI_1g77505v3 767 BRADI_1g48960v3 1 ERR3079463 completed mapping pipeline successfully