Starting /dee2/code/volunteer_pipeline.sh ERR3079464 current disk space = 1543115534336 free memory = 1598163356 ERR3079464 SRAfilesize ba219ceb6b0053763e414650968bb224 ERR3079464.sra ERR3079464.sra file validated ERR3079464 is single end ERR3079464 is conventional basespace ERR3079464 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3079464_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.32075 14.0 14.0 33.0 2.0 33.0 2 29.1505 27.0 27.0 33.0 27.0 33.0 3 30.68475 33.0 27.0 33.0 27.0 33.0 4 31.967 33.0 33.0 33.0 27.0 33.0 5 32.451 33.0 33.0 33.0 33.0 33.0 6 35.91425 37.0 37.0 37.0 33.0 37.0 7 36.3985 37.0 37.0 37.0 37.0 37.0 8 36.4375 37.0 37.0 37.0 37.0 37.0 9 36.58 37.0 37.0 37.0 37.0 37.0 10 36.6535 37.0 37.0 37.0 37.0 37.0 11 36.5865 37.0 37.0 37.0 37.0 37.0 12 36.6275 37.0 37.0 37.0 37.0 37.0 13 36.60325 37.0 37.0 37.0 37.0 37.0 14 36.56 37.0 37.0 37.0 37.0 37.0 15 36.613 37.0 37.0 37.0 37.0 37.0 16 36.411 37.0 37.0 37.0 37.0 37.0 17 36.6045 37.0 37.0 37.0 37.0 37.0 18 36.6125 37.0 37.0 37.0 37.0 37.0 19 36.70825 37.0 37.0 37.0 37.0 37.0 20 36.63275 37.0 37.0 37.0 37.0 37.0 21 36.601 37.0 37.0 37.0 37.0 37.0 22 36.6405 37.0 37.0 37.0 37.0 37.0 23 36.589 37.0 37.0 37.0 37.0 37.0 24 36.653 37.0 37.0 37.0 37.0 37.0 25 36.5425 37.0 37.0 37.0 37.0 37.0 26 36.54225 37.0 37.0 37.0 37.0 37.0 27 36.55325 37.0 37.0 37.0 37.0 37.0 28 36.57825 37.0 37.0 37.0 37.0 37.0 29 36.61275 37.0 37.0 37.0 37.0 37.0 30 36.54075 37.0 37.0 37.0 37.0 37.0 31 36.48325 37.0 37.0 37.0 37.0 37.0 32 36.592 37.0 37.0 37.0 37.0 37.0 33 36.63425 37.0 37.0 37.0 37.0 37.0 34 36.568 37.0 37.0 37.0 37.0 37.0 35 36.51675 37.0 37.0 37.0 37.0 37.0 36 36.566 37.0 37.0 37.0 37.0 37.0 37 36.605 37.0 37.0 37.0 37.0 37.0 38 36.622 37.0 37.0 37.0 37.0 37.0 39 36.50925 37.0 37.0 37.0 37.0 37.0 40 36.53675 37.0 37.0 37.0 37.0 37.0 41 36.5385 37.0 37.0 37.0 37.0 37.0 42 36.47475 37.0 37.0 37.0 37.0 37.0 43 36.42525 37.0 37.0 37.0 37.0 37.0 44 36.45975 37.0 37.0 37.0 37.0 37.0 45 36.52625 37.0 37.0 37.0 37.0 37.0 46 36.511 37.0 37.0 37.0 37.0 37.0 47 36.46925 37.0 37.0 37.0 37.0 37.0 48 36.482 37.0 37.0 37.0 37.0 37.0 49 36.43525 37.0 37.0 37.0 37.0 37.0 50 36.47725 37.0 37.0 37.0 37.0 37.0 51 36.50025 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 1.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 3.0 26 3.0 27 11.0 28 12.0 29 22.0 30 27.0 31 42.0 32 46.0 33 82.0 34 179.0 35 1141.0 36 2429.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.702811244979916 16.83657707754093 6.611059623107816 50.84955205437133 2 27.125 14.85 37.55 20.474999999999998 3 23.974999999999998 20.724999999999998 20.825 34.475 4 28.475 24.025 19.15 28.349999999999998 5 30.599999999999998 26.950000000000003 20.4 22.05 6 25.7 33.525 19.325 21.45 7 23.35 21.475 32.625 22.55 8 21.675 22.400000000000002 28.375 27.55 9 22.6 19.6 29.675 28.125 10 24.3 31.275 22.35 22.075 11 27.500000000000004 25.2 20.1 27.200000000000003 12 24.425 21.3 25.25 29.025000000000002 13 24.75 22.975 26.224999999999998 26.05 14 24.224999999999998 24.275 25.224999999999998 26.275 15 25.1 23.5 24.474999999999998 26.924999999999997 16 26.424999999999997 22.75 23.825 27.0 17 26.174999999999997 24.075 23.849999999999998 25.900000000000002 18 26.275 23.275000000000002 23.275000000000002 27.175 19 26.8 25.074999999999996 22.625 25.5 20 26.75 22.775000000000002 24.6 25.874999999999996 21 24.349999999999998 23.35 24.025 28.275 22 25.674999999999997 24.975 22.85 26.5 23 25.924999999999997 24.075 23.95 26.05 24 24.875 25.0 23.575 26.55 25 26.35 24.175 23.325000000000003 26.150000000000002 26 26.650000000000002 23.849999999999998 23.65 25.85 27 23.775 24.525 24.3 27.400000000000002 28 26.075 24.55 23.1 26.275 29 25.775 23.7 23.875 26.650000000000002 30 26.200000000000003 24.025 22.875 26.900000000000002 31 26.200000000000003 22.875 23.125 27.800000000000004 32 25.575 24.925 23.150000000000002 26.35 33 25.624999999999996 23.474999999999998 23.7 27.200000000000003 34 26.200000000000003 24.775 21.925 27.1 35 26.025 24.099999999999998 23.25 26.625 36 25.900000000000002 23.575 24.6 25.924999999999997 37 26.400000000000002 24.375 23.25 25.974999999999998 38 26.5 23.125 23.9 26.474999999999998 39 25.1 24.575 23.175 27.150000000000002 40 25.75 24.725 22.725 26.8 41 26.275 24.025 23.549999999999997 26.150000000000002 42 25.650000000000002 22.425 25.424999999999997 26.5 43 26.875 23.125 22.7 27.3 44 26.674999999999997 23.925 23.875 25.525 45 26.974999999999998 23.075000000000003 23.7 26.25 46 26.125 23.95 23.0 26.924999999999997 47 26.55 23.875 23.575 26.0 48 26.55 23.45 23.400000000000002 26.6 49 26.5 22.95 22.400000000000002 28.15 50 26.825 23.65 22.8 26.724999999999998 51 25.775 23.95 23.925 26.35 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 1.0 19 0.5 20 0.0 21 1.5 22 3.0 23 3.0 24 3.0 25 5.5 26 9.0 27 10.0 28 12.0 29 14.0 30 25.5 31 37.0 32 40.5 33 44.0 34 58.5 35 73.0 36 118.5 37 164.0 38 173.5 39 183.0 40 210.5 41 238.0 42 249.0 43 260.0 44 249.5 45 239.0 46 265.0 47 291.0 48 290.0 49 289.0 50 271.0 51 253.0 52 246.5 53 240.0 54 235.5 55 231.0 56 210.5 57 190.0 58 184.0 59 178.0 60 174.0 61 170.0 62 160.5 63 151.0 64 147.5 65 144.0 66 132.5 67 121.0 68 119.0 69 117.0 70 106.0 71 95.0 72 86.0 73 77.0 74 71.0 75 58.5 76 52.0 77 38.0 78 24.0 79 23.0 80 22.0 81 15.0 82 8.0 83 4.5 84 1.0 85 1.5 86 2.0 87 1.0 88 0.0 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 19.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.91249367728882 97.775 2 1.0116337885685383 2.0 3 0.07587253414264036 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 2041868 READS because READLEN < 1 Read 2041868 spots for ERR3079464.sra Written 2041868 spots for ERR3079464.sra Rejected 2041868 READS because READLEN < 1 Read 2041868 spots for ERR3079464.sra Written 2041868 spots for ERR3079464.sra Rejected 2041868 READS because READLEN < 1 Read 2041868 spots for ERR3079464.sra Written 2041868 spots for ERR3079464.sra Rejected 2041868 READS because READLEN < 1 Read 2041868 spots for ERR3079464.sra Written 2041868 spots for ERR3079464.sra Rejected 2041868 READS because READLEN < 1 Read 2041868 spots for ERR3079464.sra Written 2041868 spots for ERR3079464.sra Rejected 2041868 READS because READLEN < 1 Read 2041868 spots for ERR3079464.sra Written 2041868 spots for ERR3079464.sra Rejected 2041886 READS because READLEN < 1 Read 2041886 spots for ERR3079464.sra Written 2041886 spots for ERR3079464.sra Rejected 2041868 READS because READLEN < 1 Read 2041868 spots for ERR3079464.sra Written 2041868 spots for ERR3079464.sra Rejected 2041868 READS because READLEN < 1 Read 2041868 spots for ERR3079464.sra Written 2041868 spots for ERR3079464.sra Rejected 2041868 READS because READLEN < 1 Read 2041868 spots for ERR3079464.sra Written 2041868 spots for ERR3079464.sra Rejected 2041868 READS because READLEN < 1 Read 2041868 spots for ERR3079464.sra Written 2041868 spots for ERR3079464.sra Rejected 2041868 READS because READLEN < 1 Read 2041868 spots for ERR3079464.sra Written 2041868 spots for ERR3079464.sra Rejected 2041868 READS because READLEN < 1 Read 2041868 spots for ERR3079464.sra Written 2041868 spots for ERR3079464.sra Rejected 2041868 READS because READLEN < 1 Read 2041868 spots for ERR3079464.sra Written 2041868 spots for ERR3079464.sra Rejected 2041868 READS because READLEN < 1 Read 2041868 spots for ERR3079464.sra Written 2041868 spots for ERR3079464.sra Rejected 2041868 READS because READLEN < 1 Read 2041868 spots for ERR3079464.sra Written 2041868 spots for ERR3079464.sra Rejected 2041868 READS because READLEN < 1 Read 2041868 spots for ERR3079464.sra Written 2041868 spots for ERR3079464.sra Rejected 2041868 READS because READLEN < 1 Read 2041868 spots for ERR3079464.sra Written 2041868 spots for ERR3079464.sra Rejected 2041868 READS because READLEN < 1 Read 2041868 spots for ERR3079464.sra Written 2041868 spots for ERR3079464.sra Rejected 2041868 READS because READLEN < 1 Read 2041868 spots for ERR3079464.sra Written 2041868 spots for ERR3079464.sra SRR ids: ['ERR3079464.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d8ow2chh ERR3079464.sra spots: 40837378 blocks: [[1, 2041868], [2041869, 4083736], [4083737, 6125604], [6125605, 8167472], [8167473, 10209340], [10209341, 12251208], [12251209, 14293076], [14293077, 16334944], [16334945, 18376812], [18376813, 20418680], [20418681, 22460548], [22460549, 24502416], [24502417, 26544284], [26544285, 28586152], [28586153, 30628020], [30628021, 32669888], [32669889, 34711756], [34711757, 36753624], [36753625, 38795492], [38795493, 40837378]] ERR3079464 file size 5800816 ERR3079464 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3079464 ERR3079464_1.fastq Input file: ERR3079464_1.fastq trimmed: ERR3079464-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:10:28 2024 >> started Sat Dec 7 12:10:47 2024 >> done (18.357s) 40837378 reads processed; of these: 3363 ( 0.01%) short reads filtered out after trimming by size control 24501 ( 0.06%) empty reads filtered out after trimming by size control 40809514 (99.93%) reads available; of these: 51347 ( 0.13%) trimmed reads available after processing 40758167 (99.87%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 403 0.00% 19 560 0.00% 20 666 0.00% 21 778 0.00% 22 985 0.00% 23 1237 0.00% 24 1676 0.00% 25 2089 0.01% 26 2089 0.01% 27 2004 0.00% 28 1854 0.00% 29 1706 0.00% 30 1655 0.00% 31 1545 0.00% 32 1467 0.00% 33 1487 0.00% 34 1556 0.00% 35 1545 0.00% 36 1552 0.00% 37 1563 0.00% 38 1559 0.00% 39 1559 0.00% 40 1665 0.00% 41 1694 0.00% 42 1732 0.00% 43 1696 0.00% 44 1809 0.00% 45 1756 0.00% 46 1713 0.00% 47 1881 0.00% 48 1879 0.00% 49 1922 0.00% 50 2065 0.01% 51 40758167 99.87% 40809514 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=3.01 fanout-score-rank=15 prefix-density=0.20 prefix-fanout=1.6 sequence=CCATGAAGACCTTTCTCATCCTCGCCCTCCTCGCCATCGTGGCGACCACCACCACTGCGCTGGTAGTCGACCCAGTCACTAG criterion=fanout-score sequence-density=0.07 sequence-density-rank=5 fanout-score=142.71 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=19.8 sequence=CCGCCGCCGCCA Started job on | Dec 07 12:10:57 Started mapping on | Dec 07 12:10:57 Finished on | Dec 07 12:11:31 Mapping speed, Million of reads per hour | 4321.01 Number of input reads | 40809514 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 32725608 Uniquely mapped reads % | 80.19% Average mapped length | 50.77 Number of splices: Total | 4897109 Number of splices: Annotated (sjdb) | 4679121 Number of splices: GT/AG | 4832626 Number of splices: GC/AG | 55130 Number of splices: AT/AC | 3566 Number of splices: Non-canonical | 5787 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.00% Deletion average length | 1.33 Insertion rate per base | 0.00% Insertion average length | 1.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2965825 % of reads mapped to multiple loci | 7.27% Number of reads mapped to too many loci | 4761391 % of reads mapped to too many loci | 11.67% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.58% % of reads unmapped: other | 0.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5118081 5118081 5118081 N_multimapping 2965825 2965825 2965825 N_noFeature 1506639 16716295 16965672 N_ambiguous 598149 25896 24654 UnstrandedReadsAssigned:30620820 PositiveStrandReadsAssigned:15983417 NegativeStrandReadsAssigned:15735282 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 ERR3079464 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR3079464-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 40,809,514 reads, 33,034,809 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,182 rounds 52973 ERR3079464.ke.tsv 35125 ERR3079464.se.tsv 88098 total ==> ERR3079464.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 25.6232 1.42816 PNS24247 1044 945 71.9158 3.55026 PNS24249 1928 1829 504.161 12.8595 PNS24246 1044 945 71.9158 3.55026 PNS24248 1044 945 71.9158 3.55026 PNS24244 1471 1372 48.4681 1.64805 PNS24243 293 194 8 1.92378 KQK14069 1603 1504 2819.15 87.4458 KQK14071 474 375 906.061 112.718 ==> ERR3079464.se.tsv <== BRADI_1g14170v3 4241 BRADI_1g53295v3 284 BRADI_1g59795v3 406 BRADI_1g07683v3 0 BRADI_1g00485v3 24 BRADI_1g20270v3 2136 BRADI_1g74790v3 79 BRADI_1g09890v3 31 BRADI_1g77505v3 631 BRADI_1g48960v3 5 ERR3079464 completed mapping pipeline successfully