Starting /dee2/code/volunteer_pipeline.sh ERR3079465 current disk space = 1543162159104 free memory = 1606198616 ERR3079465 SRAfilesize ada1dfef53cc910f02d7472f55f25f00 ERR3079465.sra ERR3079465.sra file validated ERR3079465 is single end ERR3079465 is conventional basespace ERR3079465 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3079465_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.568 33.0 33.0 33.0 27.0 33.0 2 31.9925 33.0 33.0 33.0 27.0 33.0 3 32.164 33.0 33.0 33.0 33.0 33.0 4 32.39875 33.0 33.0 33.0 33.0 33.0 5 32.38025 33.0 33.0 33.0 33.0 33.0 6 35.997 37.0 37.0 37.0 33.0 37.0 7 36.187 37.0 37.0 37.0 37.0 37.0 8 36.3515 37.0 37.0 37.0 37.0 37.0 9 36.276 37.0 37.0 37.0 37.0 37.0 10 36.4155 37.0 37.0 37.0 37.0 37.0 11 36.3 37.0 37.0 37.0 37.0 37.0 12 36.32075 37.0 37.0 37.0 37.0 37.0 13 36.279 37.0 37.0 37.0 37.0 37.0 14 36.3315 37.0 37.0 37.0 37.0 37.0 15 36.34275 37.0 37.0 37.0 37.0 37.0 16 36.35575 37.0 37.0 37.0 37.0 37.0 17 36.25375 37.0 37.0 37.0 37.0 37.0 18 36.3245 37.0 37.0 37.0 37.0 37.0 19 36.28825 37.0 37.0 37.0 37.0 37.0 20 36.2795 37.0 37.0 37.0 37.0 37.0 21 36.32425 37.0 37.0 37.0 37.0 37.0 22 36.27275 37.0 37.0 37.0 37.0 37.0 23 36.05225 37.0 37.0 37.0 37.0 37.0 24 36.12 37.0 37.0 37.0 37.0 37.0 25 36.20075 37.0 37.0 37.0 37.0 37.0 26 36.30275 37.0 37.0 37.0 37.0 37.0 27 36.09875 37.0 37.0 37.0 37.0 37.0 28 36.1935 37.0 37.0 37.0 37.0 37.0 29 36.209 37.0 37.0 37.0 37.0 37.0 30 36.2045 37.0 37.0 37.0 37.0 37.0 31 36.2535 37.0 37.0 37.0 37.0 37.0 32 36.20025 37.0 37.0 37.0 37.0 37.0 33 36.17 37.0 37.0 37.0 37.0 37.0 34 36.155 37.0 37.0 37.0 37.0 37.0 35 36.0815 37.0 37.0 37.0 37.0 37.0 36 36.117 37.0 37.0 37.0 37.0 37.0 37 36.0205 37.0 37.0 37.0 37.0 37.0 38 36.087 37.0 37.0 37.0 37.0 37.0 39 36.18025 37.0 37.0 37.0 37.0 37.0 40 36.17625 37.0 37.0 37.0 37.0 37.0 41 35.98825 37.0 37.0 37.0 37.0 37.0 42 36.0255 37.0 37.0 37.0 37.0 37.0 43 36.118 37.0 37.0 37.0 37.0 37.0 44 36.064 37.0 37.0 37.0 37.0 37.0 45 35.9695 37.0 37.0 37.0 37.0 37.0 46 35.999 37.0 37.0 37.0 37.0 37.0 47 35.989 37.0 37.0 37.0 37.0 37.0 48 35.92875 37.0 37.0 37.0 37.0 37.0 49 35.4605 37.0 37.0 37.0 33.0 37.0 50 35.52975 37.0 37.0 37.0 37.0 37.0 51 35.00775 37.0 37.0 37.0 33.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 1.0 16 0.0 17 1.0 18 4.0 19 2.0 20 0.0 21 2.0 22 2.0 23 7.0 24 5.0 25 8.0 26 16.0 27 17.0 28 22.0 29 38.0 30 35.0 31 64.0 32 69.0 33 103.0 34 166.0 35 461.0 36 2969.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.69107856191744 14.460719041278294 7.696404793608521 46.15179760319574 2 27.825 15.299999999999999 34.1 22.775000000000002 3 24.75 20.8 22.2 32.25 4 28.825 26.5 17.9 26.775 5 30.3 28.275 20.150000000000002 21.275 6 23.549999999999997 33.525 20.4 22.525000000000002 7 21.349999999999998 20.1 34.599999999999994 23.95 8 20.175 22.475 27.250000000000004 30.099999999999998 9 23.075000000000003 19.725 29.875 27.325 10 23.150000000000002 32.45 22.6 21.8 11 27.250000000000004 24.55 20.25 27.950000000000003 12 24.5 20.974999999999998 26.224999999999998 28.299999999999997 13 23.849999999999998 24.15 25.95 26.05 14 23.3 24.175 26.375 26.150000000000002 15 24.65 23.875 24.85 26.625 16 25.35 24.2 23.724999999999998 26.724999999999998 17 26.150000000000002 23.599999999999998 23.974999999999998 26.275 18 26.3 23.45 24.474999999999998 25.775 19 26.400000000000002 23.075000000000003 23.474999999999998 27.05 20 25.174999999999997 23.625 23.674999999999997 27.525 21 26.200000000000003 23.625 23.400000000000002 26.775 22 26.400000000000002 24.474999999999998 22.025 27.1 23 25.4 24.575 24.075 25.95 24 25.0 24.625 22.825 27.55 25 25.924999999999997 25.874999999999996 22.5 25.7 26 24.875 25.275 23.65 26.200000000000003 27 25.424999999999997 23.775 23.0 27.800000000000004 28 25.724999999999998 23.075000000000003 24.125 27.075 29 25.25 24.275 24.65 25.825 30 25.575 23.799999999999997 24.4 26.224999999999998 31 25.7 24.525 22.725 27.05 32 26.25 24.875 23.25 25.624999999999996 33 24.725 25.15 24.224999999999998 25.900000000000002 34 26.5 23.5 23.9 26.1 35 25.825 24.175 24.275 25.724999999999998 36 24.85 24.65 23.45 27.05 37 25.5 24.25 22.8 27.450000000000003 38 26.85 24.2 23.799999999999997 25.15 39 26.700000000000003 23.849999999999998 24.224999999999998 25.224999999999998 40 26.875 23.225 23.125 26.775 41 25.174999999999997 23.575 24.575 26.674999999999997 42 24.75 24.65 24.3 26.3 43 26.424999999999997 23.075000000000003 23.175 27.325 44 26.125 25.0 22.650000000000002 26.224999999999998 45 26.1 24.65 23.400000000000002 25.85 46 25.275 24.125 22.400000000000002 28.199999999999996 47 26.275 25.25 22.85 25.624999999999996 48 25.95 22.875 25.05 26.125 49 25.900000000000002 24.0 23.625 26.474999999999998 50 25.974999999999998 24.775 23.400000000000002 25.85 51 25.575 23.974999999999998 23.674999999999997 26.775 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 1.0 3 1.5 4 2.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.0 17 1.0 18 1.0 19 1.0 20 1.0 21 2.5 22 4.0 23 6.5 24 9.0 25 6.5 26 7.5 27 11.0 28 15.0 29 19.0 30 25.0 31 31.0 32 52.0 33 73.0 34 82.5 35 92.0 36 118.5 37 145.0 38 159.0 39 173.0 40 199.0 41 225.0 42 247.5 43 270.0 44 270.5 45 271.0 46 292.0 47 313.0 48 286.5 49 260.0 50 261.5 51 263.0 52 261.0 53 259.0 54 219.5 55 180.0 56 186.5 57 193.0 58 180.0 59 167.0 60 154.0 61 141.0 62 134.5 63 128.0 64 137.5 65 147.0 66 127.5 67 108.0 68 113.0 69 118.0 70 106.5 71 95.0 72 93.0 73 91.0 74 79.0 75 60.5 76 54.0 77 41.5 78 29.0 79 23.5 80 18.0 81 15.5 82 13.0 83 11.0 84 9.0 85 9.5 86 10.0 87 6.0 88 2.0 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 2303225 READS because READLEN < 1 Read 2303225 spots for ERR3079465.sra Written 2303225 spots for ERR3079465.sra Rejected 2303225 READS because READLEN < 1 Read 2303225 spots for ERR3079465.sra Written 2303225 spots for ERR3079465.sra Rejected 2303225 READS because READLEN < 1 Read 2303225 spots for ERR3079465.sra Written 2303225 spots for ERR3079465.sra Rejected 2303225 READS because READLEN < 1 Read 2303225 spots for ERR3079465.sra Written 2303225 spots for ERR3079465.sra Rejected 2303225 READS because READLEN < 1 Read 2303225 spots for ERR3079465.sra Written 2303225 spots for ERR3079465.sra Rejected 2303225 READS because READLEN < 1 Read 2303225 spots for ERR3079465.sra Written 2303225 spots for ERR3079465.sra Rejected 2303225 READS because READLEN < 1 Read 2303225 spots for ERR3079465.sra Written 2303225 spots for ERR3079465.sra Rejected 2303225 READS because READLEN < 1 Read 2303225 spots for ERR3079465.sra Written 2303225 spots for ERR3079465.sra Rejected 2303225 READS because READLEN < 1 Read 2303225 spots for ERR3079465.sra Written 2303225 spots for ERR3079465.sra Rejected 2303237 READS because READLEN < 1 Read 2303237 spots for ERR3079465.sra Written 2303237 spots for ERR3079465.sra Rejected 2303225 READS because READLEN < 1 Read 2303225 spots for ERR3079465.sra Written 2303225 spots for ERR3079465.sra Rejected 2303225 READS because READLEN < 1 Read 2303225 spots for ERR3079465.sra Written 2303225 spots for ERR3079465.sra Rejected 2303225 READS because READLEN < 1 Read 2303225 spots for ERR3079465.sra Written 2303225 spots for ERR3079465.sra Rejected 2303225 READS because READLEN < 1 Read 2303225 spots for ERR3079465.sra Written 2303225 spots for ERR3079465.sra Rejected 2303225 READS because READLEN < 1 Read 2303225 spots for ERR3079465.sra Written 2303225 spots for ERR3079465.sra Rejected 2303225 READS because READLEN < 1 Read 2303225 spots for ERR3079465.sra Written 2303225 spots for ERR3079465.sra Rejected 2303225 READS because READLEN < 1 Read 2303225 spots for ERR3079465.sra Written 2303225 spots for ERR3079465.sra Rejected 2303225 READS because READLEN < 1 Read 2303225 spots for ERR3079465.sra Written 2303225 spots for ERR3079465.sra Rejected 2303225 READS because READLEN < 1 Read 2303225 spots for ERR3079465.sra Written 2303225 spots for ERR3079465.sra Rejected 2303225 READS because READLEN < 1 Read 2303225 spots for ERR3079465.sra Written 2303225 spots for ERR3079465.sra SRR ids: ['ERR3079465.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hfyxi3ih ERR3079465.sra spots: 46064512 blocks: [[1, 2303225], [2303226, 4606450], [4606451, 6909675], [6909676, 9212900], [9212901, 11516125], [11516126, 13819350], [13819351, 16122575], [16122576, 18425800], [18425801, 20729025], [20729026, 23032250], [23032251, 25335475], [25335476, 27638700], [27638701, 29941925], [29941926, 32245150], [32245151, 34548375], [34548376, 36851600], [36851601, 39154825], [39154826, 41458050], [41458051, 43761275], [43761276, 46064512]] ERR3079465 file size 6546091 ERR3079465 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3079465 ERR3079465_1.fastq Input file: ERR3079465_1.fastq trimmed: ERR3079465-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:21:53 2024 >> started Sat Dec 7 12:22:16 2024 >> done (23.398s) 46064512 reads processed; of these: 21406 ( 0.05%) short reads filtered out after trimming by size control 66222 ( 0.14%) empty reads filtered out after trimming by size control 45976884 (99.81%) reads available; of these: 1675080 ( 3.64%) trimmed reads available after processing 44301804 (96.36%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2604 0.01% 19 2898 0.01% 20 3314 0.01% 21 3875 0.01% 22 4689 0.01% 23 6016 0.01% 24 7420 0.02% 25 8693 0.02% 26 8834 0.02% 27 8697 0.02% 28 8736 0.02% 29 8600 0.02% 30 8816 0.02% 31 9512 0.02% 32 9821 0.02% 33 10823 0.02% 34 11535 0.03% 35 12740 0.03% 36 13900 0.03% 37 15462 0.03% 38 17177 0.04% 39 18894 0.04% 40 21872 0.05% 41 26076 0.06% 42 29205 0.06% 43 37596 0.08% 44 47045 0.10% 45 57417 0.12% 46 75150 0.16% 47 103896 0.23% 48 156274 0.34% 49 302622 0.66% 50 614871 1.34% 51 44301804 96.36% 45976884 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=106.99 fanout-score-rank=15 prefix-density=0.83 prefix-fanout=17.6 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=27 fanout-score=356.46 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=17.6 sequence=CGCCGCCGCCAT Started job on | Dec 07 12:22:28 Started mapping on | Dec 07 12:22:28 Finished on | Dec 07 12:22:56 Mapping speed, Million of reads per hour | 5911.31 Number of input reads | 45976884 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 42532532 Uniquely mapped reads % | 92.51% Average mapped length | 50.66 Number of splices: Total | 6330658 Number of splices: Annotated (sjdb) | 6044337 Number of splices: GT/AG | 6248950 Number of splices: GC/AG | 70787 Number of splices: AT/AC | 4950 Number of splices: Non-canonical | 5971 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.29 Insertion rate per base | 0.00% Insertion average length | 1.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1316114 % of reads mapped to multiple loci | 2.86% Number of reads mapped to too many loci | 1902915 % of reads mapped to too many loci | 4.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.40% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2128238 2128238 2128238 N_multimapping 1316114 1316114 1316114 N_noFeature 1642791 21801107 21906635 N_ambiguous 510154 22684 23256 UnstrandedReadsAssigned:40379587 PositiveStrandReadsAssigned:20708741 NegativeStrandReadsAssigned:20602641 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 ERR3079465 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR3079465-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 45,976,884 reads, 41,396,063 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,343 rounds 52973 ERR3079465.ke.tsv 35125 ERR3079465.se.tsv 88098 total ==> ERR3079465.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 238.749 11.3029 PNS24247 1044 945 96.3611 4.04059 PNS24249 1928 1829 870.124 18.8513 PNS24246 1044 945 96.3611 4.04059 PNS24248 1044 945 96.3611 4.04059 PNS24244 1471 1372 118.044 3.40929 PNS24243 293 194 15 3.06383 KQK14069 1603 1504 1598.93 42.1266 KQK14071 474 375 615.829 65.0734 ==> ERR3079465.se.tsv <== BRADI_1g14170v3 2562 BRADI_1g53295v3 521 BRADI_1g59795v3 453 BRADI_1g07683v3 2 BRADI_1g00485v3 68 BRADI_1g20270v3 10936 BRADI_1g74790v3 354 BRADI_1g09890v3 0 BRADI_1g77505v3 689 BRADI_1g48960v3 5 ERR3079465 completed mapping pipeline successfully