Starting /dee2/code/volunteer_pipeline.sh ERR3079466 current disk space = 1543173017600 free memory = 1598553224 ERR3079466 SRAfilesize 194e9b1f595663aaf03aac4822db0c48 ERR3079466.sra ERR3079466.sra file validated ERR3079466 is single end ERR3079466 is conventional basespace ERR3079466 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3079466_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.547 33.0 33.0 33.0 27.0 33.0 2 32.10025 33.0 33.0 33.0 27.0 33.0 3 32.21125 33.0 33.0 33.0 33.0 33.0 4 32.42575 33.0 33.0 33.0 33.0 33.0 5 32.4935 33.0 33.0 33.0 33.0 33.0 6 36.161 37.0 37.0 37.0 37.0 37.0 7 36.3365 37.0 37.0 37.0 37.0 37.0 8 36.40275 37.0 37.0 37.0 37.0 37.0 9 36.50475 37.0 37.0 37.0 37.0 37.0 10 36.457 37.0 37.0 37.0 37.0 37.0 11 36.45525 37.0 37.0 37.0 37.0 37.0 12 36.431 37.0 37.0 37.0 37.0 37.0 13 36.40775 37.0 37.0 37.0 37.0 37.0 14 36.38975 37.0 37.0 37.0 37.0 37.0 15 36.4265 37.0 37.0 37.0 37.0 37.0 16 36.371 37.0 37.0 37.0 37.0 37.0 17 36.37375 37.0 37.0 37.0 37.0 37.0 18 36.4375 37.0 37.0 37.0 37.0 37.0 19 36.461 37.0 37.0 37.0 37.0 37.0 20 36.3545 37.0 37.0 37.0 37.0 37.0 21 36.4745 37.0 37.0 37.0 37.0 37.0 22 36.3745 37.0 37.0 37.0 37.0 37.0 23 36.1965 37.0 37.0 37.0 37.0 37.0 24 36.2425 37.0 37.0 37.0 37.0 37.0 25 36.40725 37.0 37.0 37.0 37.0 37.0 26 36.403 37.0 37.0 37.0 37.0 37.0 27 36.314 37.0 37.0 37.0 37.0 37.0 28 36.3605 37.0 37.0 37.0 37.0 37.0 29 36.3125 37.0 37.0 37.0 37.0 37.0 30 36.353 37.0 37.0 37.0 37.0 37.0 31 36.35425 37.0 37.0 37.0 37.0 37.0 32 36.29375 37.0 37.0 37.0 37.0 37.0 33 36.29925 37.0 37.0 37.0 37.0 37.0 34 36.34875 37.0 37.0 37.0 37.0 37.0 35 36.20825 37.0 37.0 37.0 37.0 37.0 36 36.25825 37.0 37.0 37.0 37.0 37.0 37 36.217 37.0 37.0 37.0 37.0 37.0 38 36.28025 37.0 37.0 37.0 37.0 37.0 39 36.29275 37.0 37.0 37.0 37.0 37.0 40 36.36225 37.0 37.0 37.0 37.0 37.0 41 36.22175 37.0 37.0 37.0 37.0 37.0 42 36.245 37.0 37.0 37.0 37.0 37.0 43 36.19975 37.0 37.0 37.0 37.0 37.0 44 36.2475 37.0 37.0 37.0 37.0 37.0 45 36.22725 37.0 37.0 37.0 37.0 37.0 46 36.20225 37.0 37.0 37.0 37.0 37.0 47 36.18375 37.0 37.0 37.0 37.0 37.0 48 36.2085 37.0 37.0 37.0 37.0 37.0 49 35.682 37.0 37.0 37.0 37.0 37.0 50 35.92025 37.0 37.0 37.0 37.0 37.0 51 35.4255 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 2.0 17 0.0 18 0.0 19 0.0 20 2.0 21 2.0 22 3.0 23 6.0 24 4.0 25 11.0 26 9.0 27 13.0 28 22.0 29 27.0 30 35.0 31 49.0 32 58.0 33 89.0 34 133.0 35 489.0 36 3041.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.24946695095949 14.68550106609808 8.315565031982942 44.74946695095949 2 29.049999999999997 15.875 32.625 22.45 3 26.224999999999998 21.7 20.65 31.424999999999997 4 28.299999999999997 26.224999999999998 18.05 27.425 5 29.799999999999997 29.575000000000003 19.925 20.7 6 24.025 33.074999999999996 20.025000000000002 22.875 7 22.325 19.5 34.725 23.45 8 21.099999999999998 21.575 28.299999999999997 29.025000000000002 9 21.925 20.125 29.299999999999997 28.65 10 24.875 31.25 23.724999999999998 20.150000000000002 11 27.650000000000002 24.95 20.125 27.275 12 25.624999999999996 21.025 23.849999999999998 29.5 13 23.150000000000002 24.7 26.25 25.900000000000002 14 24.0 26.375 24.075 25.55 15 23.875 25.174999999999997 23.525 27.425 16 26.1 23.375 23.175 27.35 17 25.75 24.425 23.549999999999997 26.275 18 25.724999999999998 24.375 23.425 26.474999999999998 19 26.375 23.375 22.625 27.625 20 25.5 25.374999999999996 23.35 25.775 21 26.05 25.174999999999997 22.7 26.075 22 24.975 24.4 23.674999999999997 26.950000000000003 23 25.35 24.8 24.075 25.775 24 24.875 24.7 23.925 26.5 25 26.35 23.200000000000003 23.45 27.0 26 24.825 24.0 24.825 26.35 27 25.924999999999997 24.25 23.075000000000003 26.75 28 26.625 24.075 23.275000000000002 26.025 29 26.525 23.425 24.65 25.4 30 25.374999999999996 23.425 23.974999999999998 27.224999999999998 31 24.8 23.275000000000002 24.0 27.925 32 26.174999999999997 23.799999999999997 23.75 26.275 33 24.45 24.275 24.175 27.1 34 25.3 24.224999999999998 23.075000000000003 27.400000000000002 35 25.474999999999998 25.1 23.75 25.674999999999997 36 25.1 25.275 22.8 26.825 37 25.85 24.45 23.35 26.35 38 25.05 25.025 22.925 27.0 39 26.325 24.474999999999998 23.375 25.825 40 26.05 23.575 23.5 26.875 41 26.625 24.425 23.125 25.825 42 25.8 24.099999999999998 22.5 27.6 43 25.75 24.075 23.849999999999998 26.325 44 24.45 25.624999999999996 23.325000000000003 26.6 45 24.975 23.7 23.65 27.675 46 26.950000000000003 23.549999999999997 22.025 27.474999999999998 47 24.825 24.95 24.175 26.05 48 26.275 24.175 24.099999999999998 25.45 49 26.8 25.05 22.7 25.45 50 25.5 24.474999999999998 23.549999999999997 26.474999999999998 51 25.825 24.45 22.85 26.875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 2.0 2 1.0 3 1.0 4 1.0 5 0.5 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.0 22 1.0 23 2.5 24 4.0 25 4.5 26 8.5 27 12.0 28 19.5 29 27.0 30 29.5 31 32.0 32 46.0 33 60.0 34 82.5 35 105.0 36 118.5 37 132.0 38 162.5 39 193.0 40 207.0 41 221.0 42 243.5 43 266.0 44 275.5 45 285.0 46 290.5 47 296.0 48 287.5 49 279.0 50 260.5 51 242.0 52 229.0 53 216.0 54 223.0 55 230.0 56 210.0 57 190.0 58 171.0 59 152.0 60 143.5 61 135.0 62 144.0 63 153.0 64 138.5 65 124.0 66 113.5 67 103.0 68 111.0 69 119.0 70 112.5 71 106.0 72 100.0 73 94.0 74 79.0 75 56.5 76 49.0 77 45.5 78 42.0 79 35.5 80 29.0 81 22.5 82 16.0 83 11.5 84 7.0 85 4.0 86 1.0 87 1.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64824120603015 99.15 2 0.32663316582914576 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.02512562814070352 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTATG 8 0.2 TruSeq Adapter, Index 7 (97% over 35bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 2199424 READS because READLEN < 1 Read 2199424 spots for ERR3079466.sra Written 2199424 spots for ERR3079466.sra Rejected 2199424 READS because READLEN < 1 Read 2199424 spots for ERR3079466.sra Written 2199424 spots for ERR3079466.sra Rejected 2199424 READS because READLEN < 1 Read 2199424 spots for ERR3079466.sra Written 2199424 spots for ERR3079466.sra Rejected 2199424 READS because READLEN < 1 Read 2199424 spots for ERR3079466.sra Written 2199424 spots for ERR3079466.sra Rejected 2199424 READS because READLEN < 1 Read 2199424 spots for ERR3079466.sra Written 2199424 spots for ERR3079466.sra Rejected 2199424 READS because READLEN < 1 Read 2199424 spots for ERR3079466.sra Written 2199424 spots for ERR3079466.sra Rejected 2199424 READS because READLEN < 1 Read 2199424 spots for ERR3079466.sra Written 2199424 spots for ERR3079466.sra Rejected 2199424 READS because READLEN < 1 Read 2199424 spots for ERR3079466.sra Written 2199424 spots for ERR3079466.sra Rejected 2199424 READS because READLEN < 1 Read 2199424 spots for ERR3079466.sra Written 2199424 spots for ERR3079466.sra Rejected 2199424 READS because READLEN < 1 Read 2199424 spots for ERR3079466.sra Written 2199424 spots for ERR3079466.sra Rejected 2199424 READS because READLEN < 1 Read 2199424 spots for ERR3079466.sra Written 2199424 spots for ERR3079466.sra Rejected 2199424 READS because READLEN < 1 Read 2199424 spots for ERR3079466.sra Written 2199424 spots for ERR3079466.sra Rejected 2199424 READS because READLEN < 1 Read 2199424 spots for ERR3079466.sra Written 2199424 spots for ERR3079466.sra Rejected 2199424 READS because READLEN < 1 Read 2199424 spots for ERR3079466.sra Written 2199424 spots for ERR3079466.sra Rejected 2199424 READS because READLEN < 1 Read 2199424 spots for ERR3079466.sra Written 2199424 spots for ERR3079466.sra Rejected 2199424 READS because READLEN < 1 Read 2199424 spots for ERR3079466.sra Written 2199424 spots for ERR3079466.sra Rejected 2199424 READS because READLEN < 1 Read 2199424 spots for ERR3079466.sra Written 2199424 spots for ERR3079466.sra Rejected 2199434 READS because READLEN < 1 Read 2199434 spots for ERR3079466.sra Written 2199434 spots for ERR3079466.sra Rejected 2199424 READS because READLEN < 1 Read 2199424 spots for ERR3079466.sra Written 2199424 spots for ERR3079466.sra Rejected 2199424 READS because READLEN < 1 Read 2199424 spots for ERR3079466.sra Written 2199424 spots for ERR3079466.sra SRR ids: ['ERR3079466.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_36kr4rwn ERR3079466.sra spots: 43988490 blocks: [[1, 2199424], [2199425, 4398848], [4398849, 6598272], [6598273, 8797696], [8797697, 10997120], [10997121, 13196544], [13196545, 15395968], [15395969, 17595392], [17595393, 19794816], [19794817, 21994240], [21994241, 24193664], [24193665, 26393088], [26393089, 28592512], [28592513, 30791936], [30791937, 32991360], [32991361, 35190784], [35190785, 37390208], [37390209, 39589632], [39589633, 41789056], [41789057, 43988490]] ERR3079466 file size 6250096 ERR3079466 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3079466 ERR3079466_1.fastq Input file: ERR3079466_1.fastq trimmed: ERR3079466-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:22:18 2024 >> started Sat Dec 7 12:22:38 2024 >> done (19.600s) 43988490 reads processed; of these: 17707 ( 0.04%) short reads filtered out after trimming by size control 98669 ( 0.22%) empty reads filtered out after trimming by size control 43872114 (99.74%) reads available; of these: 1534556 ( 3.50%) trimmed reads available after processing 42337558 (96.50%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2376 0.01% 19 2661 0.01% 20 3028 0.01% 21 3571 0.01% 22 4341 0.01% 23 5657 0.01% 24 7162 0.02% 25 8464 0.02% 26 8156 0.02% 27 8442 0.02% 28 8326 0.02% 29 8164 0.02% 30 8090 0.02% 31 8574 0.02% 32 9068 0.02% 33 9910 0.02% 34 10626 0.02% 35 11647 0.03% 36 12835 0.03% 37 14539 0.03% 38 15919 0.04% 39 17584 0.04% 40 20189 0.05% 41 23905 0.05% 42 26890 0.06% 43 34511 0.08% 44 43190 0.10% 45 52662 0.12% 46 69175 0.16% 47 94545 0.22% 48 143291 0.33% 49 276398 0.63% 50 560660 1.28% 51 42337558 96.50% 43872114 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=112.84 fanout-score-rank=14 prefix-density=0.84 prefix-fanout=18.1 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=19 fanout-score=322.76 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=18.1 sequence=CGCCGCCGCCACC Started job on | Dec 07 12:22:48 Started mapping on | Dec 07 12:22:48 Finished on | Dec 07 12:23:16 Mapping speed, Million of reads per hour | 5640.70 Number of input reads | 43872114 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 40160594 Uniquely mapped reads % | 91.54% Average mapped length | 50.67 Number of splices: Total | 5867644 Number of splices: Annotated (sjdb) | 5603443 Number of splices: GT/AG | 5791332 Number of splices: GC/AG | 66694 Number of splices: AT/AC | 4330 Number of splices: Non-canonical | 5288 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.30 Insertion rate per base | 0.00% Insertion average length | 1.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1261132 % of reads mapped to multiple loci | 2.87% Number of reads mapped to too many loci | 2230145 % of reads mapped to too many loci | 5.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.39% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2450388 2450388 2450388 N_multimapping 1261132 1261132 1261132 N_noFeature 1651681 20568738 20786784 N_ambiguous 496373 21086 21814 UnstrandedReadsAssigned:38012540 PositiveStrandReadsAssigned:19570770 NegativeStrandReadsAssigned:19351996 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 ERR3079466 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR3079466-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 43,872,114 reads, 39,007,346 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,282 rounds 52973 ERR3079466.ke.tsv 35125 ERR3079466.se.tsv 88098 total ==> ERR3079466.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0.291453 0.0143198 PNS24247 1044 945 156.905 6.82811 PNS24249 1928 1829 694.849 15.6233 PNS24246 1044 945 156.905 6.82811 PNS24248 1044 945 156.905 6.82811 PNS24244 1471 1372 69.1446 2.07252 PNS24243 293 194 4 0.847917 KQK14069 1603 1504 2325.44 63.5846 KQK14071 474 375 725.072 79.5143 ==> ERR3079466.se.tsv <== BRADI_1g14170v3 3461 BRADI_1g53295v3 423 BRADI_1g59795v3 512 BRADI_1g07683v3 0 BRADI_1g00485v3 70 BRADI_1g20270v3 8968 BRADI_1g74790v3 324 BRADI_1g09890v3 0 BRADI_1g77505v3 675 BRADI_1g48960v3 8 ERR3079466 completed mapping pipeline successfully