Starting /dee2/code/volunteer_pipeline.sh ERR3079467 current disk space = 1543099035648 free memory = 1606485824 ERR3079467 SRAfilesize 0dd2029e2d04bf192feb797e887f084b ERR3079467.sra ERR3079467.sra file validated ERR3079467 is single end ERR3079467 is conventional basespace ERR3079467 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3079467_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 53 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 18.838 14.0 14.0 33.0 2.0 33.0 2 26.743 27.0 27.0 33.0 14.0 33.0 3 28.37575 27.0 27.0 33.0 14.0 33.0 4 30.53225 33.0 27.0 33.0 27.0 33.0 5 31.64225 33.0 33.0 33.0 27.0 33.0 6 35.754 37.0 37.0 37.0 33.0 37.0 7 36.19 37.0 37.0 37.0 37.0 37.0 8 36.152 37.0 37.0 37.0 33.0 37.0 9 36.4305 37.0 37.0 37.0 37.0 37.0 10 36.5385 37.0 37.0 37.0 37.0 37.0 11 36.5915 37.0 37.0 37.0 37.0 37.0 12 36.604 37.0 37.0 37.0 37.0 37.0 13 36.5465 37.0 37.0 37.0 37.0 37.0 14 36.512 37.0 37.0 37.0 37.0 37.0 15 36.57075 37.0 37.0 37.0 37.0 37.0 16 36.3845 37.0 37.0 37.0 37.0 37.0 17 36.49 37.0 37.0 37.0 37.0 37.0 18 36.52125 37.0 37.0 37.0 37.0 37.0 19 36.53575 37.0 37.0 37.0 37.0 37.0 20 36.55125 37.0 37.0 37.0 37.0 37.0 21 36.555 37.0 37.0 37.0 37.0 37.0 22 36.45775 37.0 37.0 37.0 37.0 37.0 23 36.55875 37.0 37.0 37.0 37.0 37.0 24 36.567 37.0 37.0 37.0 37.0 37.0 25 36.579 37.0 37.0 37.0 37.0 37.0 26 36.56875 37.0 37.0 37.0 37.0 37.0 27 36.5065 37.0 37.0 37.0 37.0 37.0 28 36.54425 37.0 37.0 37.0 37.0 37.0 29 36.53275 37.0 37.0 37.0 37.0 37.0 30 36.46475 37.0 37.0 37.0 37.0 37.0 31 36.4825 37.0 37.0 37.0 37.0 37.0 32 36.5365 37.0 37.0 37.0 37.0 37.0 33 36.51925 37.0 37.0 37.0 37.0 37.0 34 36.5525 37.0 37.0 37.0 37.0 37.0 35 36.5385 37.0 37.0 37.0 37.0 37.0 36 36.56525 37.0 37.0 37.0 37.0 37.0 37 36.52475 37.0 37.0 37.0 37.0 37.0 38 36.49925 37.0 37.0 37.0 37.0 37.0 39 36.437 37.0 37.0 37.0 37.0 37.0 40 36.504 37.0 37.0 37.0 37.0 37.0 41 36.5165 37.0 37.0 37.0 37.0 37.0 42 36.41975 37.0 37.0 37.0 37.0 37.0 43 36.453 37.0 37.0 37.0 37.0 37.0 44 36.5215 37.0 37.0 37.0 37.0 37.0 45 36.53275 37.0 37.0 37.0 37.0 37.0 46 36.4545 37.0 37.0 37.0 37.0 37.0 47 36.4185 37.0 37.0 37.0 37.0 37.0 48 36.43625 37.0 37.0 37.0 37.0 37.0 49 36.4335 37.0 37.0 37.0 37.0 37.0 50 36.459 37.0 37.0 37.0 37.0 37.0 51 36.4965 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 0.0 21 1.0 22 0.0 23 0.0 24 1.0 25 9.0 26 7.0 27 10.0 28 17.0 29 23.0 30 23.0 31 42.0 32 58.0 33 111.0 34 240.0 35 1466.0 36 1990.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.24615384615385 17.753846153846155 7.56923076923077 46.43076923076923 2 29.45 17.075000000000003 31.275 22.2 3 27.625 20.025000000000002 19.675 32.675 4 28.125 24.675 17.925 29.275000000000002 5 31.025000000000002 26.325 19.55 23.1 6 24.325 33.6 19.55 22.525000000000002 7 22.475 21.25 33.050000000000004 23.225 8 21.825 22.85 26.525 28.799999999999997 9 23.225 19.025 30.625000000000004 27.125 10 23.799999999999997 31.624999999999996 23.599999999999998 20.974999999999998 11 28.15 25.15 19.2 27.500000000000004 12 24.5 21.825 23.799999999999997 29.875 13 26.075 24.575 23.9 25.45 14 24.3 23.400000000000002 23.724999999999998 28.575 15 25.5 24.0 23.549999999999997 26.950000000000003 16 26.400000000000002 22.525000000000002 22.825 28.249999999999996 17 27.625 23.925 22.125 26.325 18 26.075 24.45 23.724999999999998 25.75 19 25.724999999999998 24.099999999999998 23.025000000000002 27.150000000000002 20 26.05 24.0 23.05 26.900000000000002 21 26.025 23.575 23.849999999999998 26.55 22 26.325 23.974999999999998 22.325 27.375 23 26.174999999999997 24.825 23.549999999999997 25.45 24 26.525 25.124999999999996 22.0 26.35 25 25.75 24.675 22.75 26.825 26 26.6 23.674999999999997 23.5 26.224999999999998 27 26.106526631657918 24.706176544136035 23.305826456614152 25.881470367591895 28 26.05 23.724999999999998 23.275000000000002 26.950000000000003 29 26.05 24.349999999999998 22.5 27.1 30 25.63140785196299 23.355838959739934 22.980745186296573 28.032008002000502 31 26.8 23.075000000000003 22.2 27.925 32 25.75 24.275 23.75 26.224999999999998 33 25.575 23.75 23.75 26.924999999999997 34 25.45 23.925 23.875 26.75 35 26.481620405101275 23.23080770192548 24.281070267566893 26.006501625406354 36 24.349999999999998 23.549999999999997 24.75 27.35 37 26.174999999999997 22.95 24.474999999999998 26.400000000000002 38 25.575 25.324999999999996 22.475 26.625 39 25.674999999999997 24.925 22.75 26.650000000000002 40 27.025 23.375 22.425 27.175 41 25.825 22.775000000000002 25.124999999999996 26.275 42 25.5 24.099999999999998 23.525 26.875 43 27.0 23.674999999999997 22.85 26.474999999999998 44 26.85 22.8 23.05 27.3 45 26.075 24.349999999999998 23.9 25.674999999999997 46 26.450000000000003 22.525000000000002 22.375 28.65 47 26.875 23.175 22.95 27.0 48 26.3 23.974999999999998 23.575 26.150000000000002 49 26.450000000000003 24.675 23.375 25.5 50 27.175 23.5 22.025 27.3 51 26.450000000000003 23.875 23.549999999999997 26.125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 3.5 24 5.0 25 3.5 26 5.0 27 8.0 28 15.0 29 22.0 30 28.5 31 35.0 32 47.0 33 59.0 34 72.5 35 86.0 36 110.5 37 135.0 38 149.0 39 163.0 40 191.5 41 220.0 42 225.5 43 231.0 44 252.5 45 274.0 46 279.0 47 284.0 48 289.0 49 294.0 50 276.0 51 258.0 52 258.0 53 258.0 54 224.5 55 191.0 56 191.5 57 192.0 58 187.5 59 183.0 60 168.5 61 154.0 62 147.0 63 140.0 64 150.0 65 160.0 66 148.5 67 137.0 68 132.0 69 127.0 70 110.0 71 93.0 72 93.5 73 94.0 74 80.5 75 57.0 76 47.0 77 41.5 78 36.0 79 27.5 80 19.0 81 14.0 82 9.0 83 7.5 84 6.0 85 6.5 86 7.0 87 4.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 18.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.025 28 0.0 29 0.0 30 0.025 31 0.0 32 0.0 33 0.0 34 0.0 35 0.025 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44612286002014 98.75 2 0.4783484390735146 0.95 3 0.050352467270896276 0.15 4 0.0 0.0 5 0.0 0.0 6 0.025176233635448138 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTATG 6 0.15 TruSeq Adapter, Index 3 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 2083529 READS because READLEN < 1 Read 2083529 spots for ERR3079467.sra Written 2083529 spots for ERR3079467.sra Rejected 2083529 READS because READLEN < 1 Read 2083529 spots for ERR3079467.sra Written 2083529 spots for ERR3079467.sra Rejected 2083529 READS because READLEN < 1 Read 2083529 spots for ERR3079467.sra Written 2083529 spots for ERR3079467.sra Rejected 2083529 READS because READLEN < 1 Read 2083529 spots for ERR3079467.sra Written 2083529 spots for ERR3079467.sra Rejected 2083529 READS because READLEN < 1 Read 2083529 spots for ERR3079467.sra Written 2083529 spots for ERR3079467.sra Rejected 2083529 READS because READLEN < 1 Read 2083529 spots for ERR3079467.sra Written 2083529 spots for ERR3079467.sra Rejected 2083529 READS because READLEN < 1 Read 2083529 spots for ERR3079467.sra Written 2083529 spots for ERR3079467.sra Rejected 2083529 READS because READLEN < 1 Read 2083529 spots for ERR3079467.sra Written 2083529 spots for ERR3079467.sra Rejected 2083529 READS because READLEN < 1 Read 2083529 spots for ERR3079467.sra Written 2083529 spots for ERR3079467.sra Rejected 2083529 READS because READLEN < 1 Read 2083529 spots for ERR3079467.sra Written 2083529 spots for ERR3079467.sra Rejected 2083529 READS because READLEN < 1 Read 2083529 spots for ERR3079467.sra Written 2083529 spots for ERR3079467.sra Rejected 2083529 READS because READLEN < 1 Read 2083529 spots for ERR3079467.sra Written 2083529 spots for ERR3079467.sra Rejected 2083529 READS because READLEN < 1 Read 2083529 spots for ERR3079467.sra Written 2083529 spots for ERR3079467.sra Rejected 2083529 READS because READLEN < 1 Read 2083529 spots for ERR3079467.sra Written 2083529 spots for ERR3079467.sra Rejected 2083529 READS because READLEN < 1 Read 2083529 spots for ERR3079467.sra Written 2083529 spots for ERR3079467.sra Rejected 2083529 READS because READLEN < 1 Read 2083529 spots for ERR3079467.sra Written 2083529 spots for ERR3079467.sra Rejected 2083529 READS because READLEN < 1 Read 2083529 spots for ERR3079467.sra Written 2083529 spots for ERR3079467.sra Rejected 2083529 READS because READLEN < 1 Read 2083529 spots for ERR3079467.sra Written 2083529 spots for ERR3079467.sra Rejected 2083542 READS because READLEN < 1 Read 2083542 spots for ERR3079467.sra Written 2083542 spots for ERR3079467.sra Rejected 2083529 READS because READLEN < 1 Read 2083529 spots for ERR3079467.sra Written 2083529 spots for ERR3079467.sra SRR ids: ['ERR3079467.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_svn0os7p ERR3079467.sra spots: 41670593 blocks: [[1, 2083529], [2083530, 4167058], [4167059, 6250587], [6250588, 8334116], [8334117, 10417645], [10417646, 12501174], [12501175, 14584703], [14584704, 16668232], [16668233, 18751761], [18751762, 20835290], [20835291, 22918819], [22918820, 25002348], [25002349, 27085877], [27085878, 29169406], [29169407, 31252935], [31252936, 33336464], [33336465, 35419993], [35419994, 37503522], [37503523, 39587051], [39587052, 41670593]] ERR3079467 file size 5919614 ERR3079467 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3079467 ERR3079467_1.fastq Input file: ERR3079467_1.fastq trimmed: ERR3079467-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:34:13 2024 >> started Sat Dec 7 12:34:39 2024 >> done (26.562s) 41670593 reads processed; of these: 5416 ( 0.01%) short reads filtered out after trimming by size control 29840 ( 0.07%) empty reads filtered out after trimming by size control 41635337 (99.92%) reads available; of these: 51768 ( 0.12%) trimmed reads available after processing 41583569 (99.88%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 438 0.00% 19 550 0.00% 20 574 0.00% 21 778 0.00% 22 926 0.00% 23 1209 0.00% 24 1683 0.00% 25 2052 0.00% 26 1996 0.00% 27 1924 0.00% 28 1896 0.00% 29 1655 0.00% 30 1595 0.00% 31 1600 0.00% 32 1543 0.00% 33 1534 0.00% 34 1505 0.00% 35 1504 0.00% 36 1545 0.00% 37 1611 0.00% 38 1679 0.00% 39 1636 0.00% 40 1618 0.00% 41 1815 0.00% 42 1791 0.00% 43 1851 0.00% 44 1681 0.00% 45 1724 0.00% 46 1729 0.00% 47 1983 0.00% 48 2009 0.00% 49 1999 0.00% 50 2135 0.01% 51 41583569 99.88% 41635337 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=100.77 fanout-score-rank=16 prefix-density=0.83 prefix-fanout=17.3 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=23 fanout-score=379.19 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=23.0 sequence=CCGCCGCCGCGG Started job on | Dec 07 12:35:01 Started mapping on | Dec 07 12:35:01 Finished on | Dec 07 12:35:37 Mapping speed, Million of reads per hour | 4163.53 Number of input reads | 41635337 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 35643483 Uniquely mapped reads % | 85.61% Average mapped length | 50.76 Number of splices: Total | 5358394 Number of splices: Annotated (sjdb) | 5119231 Number of splices: GT/AG | 5287954 Number of splices: GC/AG | 61118 Number of splices: AT/AC | 4168 Number of splices: Non-canonical | 5154 Mismatch rate per base, % | 0.16% Deletion rate per base | 0.00% Deletion average length | 1.33 Insertion rate per base | 0.00% Insertion average length | 1.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1150683 % of reads mapped to multiple loci | 2.76% Number of reads mapped to too many loci | 4430613 % of reads mapped to too many loci | 10.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.72% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4841171 4841171 4841171 N_multimapping 1150683 1150683 1150683 N_noFeature 1314727 18184193 18396928 N_ambiguous 412513 19707 18624 UnstrandedReadsAssigned:33916243 PositiveStrandReadsAssigned:17439583 NegativeStrandReadsAssigned:17227931 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 ERR3079467 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR3079467-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 41,635,337 reads, 34,678,301 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,222 rounds 52973 ERR3079467.ke.tsv 35125 ERR3079467.se.tsv 88098 total ==> ERR3079467.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 77.4954 4.28339 PNS24247 1044 945 67.0226 3.28115 PNS24249 1928 1829 722.655 18.2791 PNS24246 1044 945 67.0226 3.28115 PNS24248 1044 945 67.0226 3.28115 PNS24244 1471 1372 43.7817 1.4763 PNS24243 293 194 6 1.43082 KQK14069 1603 1504 1448.52 44.5567 KQK14071 474 375 541.582 66.8143 ==> ERR3079467.se.tsv <== BRADI_1g14170v3 2204 BRADI_1g53295v3 332 BRADI_1g59795v3 361 BRADI_1g07683v3 0 BRADI_1g00485v3 67 BRADI_1g20270v3 7504 BRADI_1g74790v3 336 BRADI_1g09890v3 0 BRADI_1g77505v3 481 BRADI_1g48960v3 1 ERR3079467 completed mapping pipeline successfully