Starting /dee2/code/volunteer_pipeline.sh ERR3079468 current disk space = 1543100559360 free memory = 1597882140 ERR3079468 SRAfilesize 559a08e92218ba102a1c654b10bfc0b8 ERR3079468.sra ERR3079468.sra file validated ERR3079468 is single end ERR3079468 is conventional basespace ERR3079468 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3079468_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.65575 33.0 33.0 33.0 14.0 33.0 2 31.87575 33.0 33.0 33.0 27.0 33.0 3 32.16525 33.0 33.0 33.0 33.0 33.0 4 32.42225 33.0 33.0 33.0 33.0 33.0 5 32.493 33.0 33.0 33.0 33.0 33.0 6 36.13675 37.0 37.0 37.0 37.0 37.0 7 36.24725 37.0 37.0 37.0 37.0 37.0 8 36.401 37.0 37.0 37.0 37.0 37.0 9 36.427 37.0 37.0 37.0 37.0 37.0 10 36.47075 37.0 37.0 37.0 37.0 37.0 11 36.417 37.0 37.0 37.0 37.0 37.0 12 36.4125 37.0 37.0 37.0 37.0 37.0 13 36.46275 37.0 37.0 37.0 37.0 37.0 14 36.38825 37.0 37.0 37.0 37.0 37.0 15 36.4035 37.0 37.0 37.0 37.0 37.0 16 36.431 37.0 37.0 37.0 37.0 37.0 17 36.3835 37.0 37.0 37.0 37.0 37.0 18 36.31025 37.0 37.0 37.0 37.0 37.0 19 36.4235 37.0 37.0 37.0 37.0 37.0 20 36.41575 37.0 37.0 37.0 37.0 37.0 21 36.442 37.0 37.0 37.0 37.0 37.0 22 36.41575 37.0 37.0 37.0 37.0 37.0 23 36.383 37.0 37.0 37.0 37.0 37.0 24 36.385 37.0 37.0 37.0 37.0 37.0 25 36.3835 37.0 37.0 37.0 37.0 37.0 26 36.37425 37.0 37.0 37.0 37.0 37.0 27 36.34775 37.0 37.0 37.0 37.0 37.0 28 36.278 37.0 37.0 37.0 37.0 37.0 29 36.32175 37.0 37.0 37.0 37.0 37.0 30 36.26125 37.0 37.0 37.0 37.0 37.0 31 36.16125 37.0 37.0 37.0 37.0 37.0 32 36.29175 37.0 37.0 37.0 37.0 37.0 33 36.3185 37.0 37.0 37.0 37.0 37.0 34 36.24875 37.0 37.0 37.0 37.0 37.0 35 36.29625 37.0 37.0 37.0 37.0 37.0 36 36.279 37.0 37.0 37.0 37.0 37.0 37 36.26775 37.0 37.0 37.0 37.0 37.0 38 36.081 37.0 37.0 37.0 37.0 37.0 39 36.16075 37.0 37.0 37.0 37.0 37.0 40 36.167 37.0 37.0 37.0 37.0 37.0 41 36.192 37.0 37.0 37.0 37.0 37.0 42 36.20525 37.0 37.0 37.0 37.0 37.0 43 36.15825 37.0 37.0 37.0 37.0 37.0 44 36.06125 37.0 37.0 37.0 37.0 37.0 45 35.52475 37.0 37.0 37.0 33.0 37.0 46 35.94 37.0 37.0 37.0 37.0 37.0 47 36.04875 37.0 37.0 37.0 37.0 37.0 48 35.92 37.0 37.0 37.0 37.0 37.0 49 35.909 37.0 37.0 37.0 37.0 37.0 50 35.70475 37.0 37.0 37.0 37.0 37.0 51 35.139 37.0 37.0 37.0 33.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 0.0 14 0.0 15 2.0 16 1.0 17 1.0 18 2.0 19 2.0 20 6.0 21 2.0 22 1.0 23 4.0 24 8.0 25 10.0 26 13.0 27 18.0 28 20.0 29 18.0 30 52.0 31 48.0 32 54.0 33 85.0 34 143.0 35 582.0 36 2925.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.586938550564895 14.384127858914301 7.7156241388812346 47.31330945163957 2 27.1 18.6 33.025 21.275 3 24.625 21.775 20.525 33.074999999999996 4 28.275 25.85 17.625 28.249999999999996 5 29.325000000000003 29.375 21.125 20.175 6 23.549999999999997 34.025 20.325 22.1 7 21.875 19.275000000000002 35.449999999999996 23.400000000000002 8 22.05 21.45 27.275 29.225 9 22.275 19.225 30.225 28.275 10 22.85 31.025000000000002 24.525 21.6 11 27.6 23.775 20.375 28.249999999999996 12 24.775 21.75 24.975 28.499999999999996 13 24.224999999999998 23.925 25.174999999999997 26.674999999999997 14 23.9 24.65 24.775 26.674999999999997 15 25.624999999999996 23.175 23.549999999999997 27.650000000000002 16 24.625 23.325000000000003 24.25 27.800000000000004 17 25.75 22.025 24.45 27.775 18 27.125 24.5 22.625 25.75 19 25.05 23.625 23.474999999999998 27.85 20 27.425 22.725 23.075000000000003 26.775 21 24.975 24.375 23.175 27.474999999999998 22 25.5 24.7 23.25 26.55 23 26.1 23.875 24.3 25.724999999999998 24 25.924999999999997 24.95 23.599999999999998 25.525 25 25.05 24.25 23.849999999999998 26.85 26 25.75 24.15 23.825 26.275 27 27.1 24.425 23.474999999999998 25.0 28 27.025 24.125 22.125 26.724999999999998 29 25.624999999999996 24.224999999999998 23.5 26.650000000000002 30 24.975 24.275 24.224999999999998 26.525 31 26.674999999999997 24.7 21.725 26.900000000000002 32 24.9 25.724999999999998 24.05 25.324999999999996 33 25.4 24.224999999999998 23.95 26.424999999999997 34 27.175 22.7 21.95 28.175 35 25.474999999999998 25.224999999999998 23.200000000000003 26.1 36 25.6 24.0 24.5 25.900000000000002 37 27.175 22.575 23.400000000000002 26.85 38 25.75 25.324999999999996 21.95 26.974999999999998 39 24.125 22.975 23.974999999999998 28.925 40 25.525 23.45 23.7 27.325 41 26.400000000000002 23.275000000000002 23.125 27.200000000000003 42 25.25 23.45 23.75 27.55 43 25.275 22.675 23.825 28.225 44 26.150000000000002 21.775 24.3 27.775 45 25.650000000000002 25.124999999999996 22.05 27.175 46 24.45 23.425 22.6 29.525000000000002 47 26.5 22.975 22.925 27.6 48 26.0 24.15 23.575 26.275 49 25.55 21.525 23.474999999999998 29.45 50 26.400000000000002 23.075000000000003 22.075 28.449999999999996 51 25.025 23.799999999999997 24.375 26.8 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 2.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.5 20 1.0 21 2.0 22 3.0 23 2.5 24 2.0 25 7.0 26 9.5 27 7.0 28 9.5 29 12.0 30 20.5 31 29.0 32 32.0 33 35.0 34 59.0 35 83.0 36 105.0 37 127.0 38 158.5 39 190.0 40 194.5 41 199.0 42 252.5 43 306.0 44 291.0 45 276.0 46 280.0 47 284.0 48 275.5 49 267.0 50 254.0 51 241.0 52 236.0 53 231.0 54 219.0 55 207.0 56 199.5 57 192.0 58 194.5 59 197.0 60 186.0 61 175.0 62 161.0 63 147.0 64 137.5 65 128.0 66 140.5 67 153.0 68 143.5 69 134.0 70 122.0 71 110.0 72 98.0 73 86.0 74 76.5 75 50.5 76 34.0 77 32.0 78 30.0 79 25.0 80 20.0 81 14.5 82 9.0 83 4.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.275 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.125 #Duplication Level Percentage of deduplicated Percentage of total 1 94.12080536912751 87.64999999999999 2 4.805369127516778 8.95 3 0.7785234899328859 2.175 4 0.2147651006711409 0.8 5 0.026845637583892613 0.125 6 0.05369127516778523 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTACAACGGAGTGCTACAATCTGGACGGAACATACTCAATGGTTTAAATGC 6 0.15 No Hit CTGGTATCCTTCACTCTCCGCCTTCTTTAAAACGACATAGTTTTGTGGTAT 6 0.15 No Hit GTTGGTCTTGAAAGCGATATACTGGTATCCTTCACTCTCCGCCTTCTTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.025 0.0 24 0.0 0.0 0.0 0.025 0.0 25 0.0 0.0 0.0 0.025 0.0 26 0.0 0.0 0.0 0.025 0.0 27 0.0 0.0 0.0 0.025 0.0 28 0.0 0.0 0.0 0.025 0.0 29 0.0 0.0 0.0 0.025 0.0 30 0.0 0.0 0.0 0.025 0.0 31 0.0 0.0 0.0 0.025 0.0 32 0.0 0.0 0.0 0.025 0.0 33 0.0 0.0 0.0 0.025 0.0 34 0.0 0.0 0.0 0.025 0.0 35 0.0 0.0 0.0 0.025 0.0 36 0.0 0.0 0.0 0.025 0.0 37 0.0 0.0 0.0 0.025 0.0 38 0.0 0.0 0.0 0.025 0.0 39 0.0 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 2010745 READS because READLEN < 1 Read 2010745 spots for ERR3079468.sra Written 2010745 spots for ERR3079468.sra Rejected 2010745 READS because READLEN < 1 Read 2010745 spots for ERR3079468.sra Written 2010745 spots for ERR3079468.sra Rejected 2010745 READS because READLEN < 1 Read 2010745 spots for ERR3079468.sra Written 2010745 spots for ERR3079468.sra Rejected 2010745 READS because READLEN < 1 Read 2010745 spots for ERR3079468.sra Written 2010745 spots for ERR3079468.sra Rejected 2010745 READS because READLEN < 1 Read 2010745 spots for ERR3079468.sra Written 2010745 spots for ERR3079468.sra Rejected 2010745 READS because READLEN < 1 Read 2010745 spots for ERR3079468.sra Written 2010745 spots for ERR3079468.sra Rejected 2010745 READS because READLEN < 1 Read 2010745 spots for ERR3079468.sra Written 2010745 spots for ERR3079468.sra Rejected 2010745 READS because READLEN < 1 Read 2010745 spots for ERR3079468.sra Written 2010745 spots for ERR3079468.sra Rejected 2010745 READS because READLEN < 1 Read 2010745 spots for ERR3079468.sra Written 2010745 spots for ERR3079468.sra Rejected 2010745 READS because READLEN < 1 Read 2010745 spots for ERR3079468.sra Written 2010745 spots for ERR3079468.sra Rejected 2010745 READS because READLEN < 1 Read 2010745 spots for ERR3079468.sra Written 2010745 spots for ERR3079468.sra Rejected 2010745 READS because READLEN < 1 Read 2010745 spots for ERR3079468.sra Written 2010745 spots for ERR3079468.sra Rejected 2010763 READS because READLEN < 1 Read 2010763 spots for ERR3079468.sra Written 2010763 spots for ERR3079468.sra Rejected 2010745 READS because READLEN < 1 Read 2010745 spots for ERR3079468.sra Written 2010745 spots for ERR3079468.sra Rejected 2010745 READS because READLEN < 1 Read 2010745 spots for ERR3079468.sra Written 2010745 spots for ERR3079468.sra Rejected 2010745 READS because READLEN < 1 Read 2010745 spots for ERR3079468.sra Written 2010745 spots for ERR3079468.sra Rejected 2010745 READS because READLEN < 1 Read 2010745 spots for ERR3079468.sra Written 2010745 spots for ERR3079468.sra Rejected 2010745 READS because READLEN < 1 Read 2010745 spots for ERR3079468.sra Written 2010745 spots for ERR3079468.sra Rejected 2010745 READS because READLEN < 1 Read 2010745 spots for ERR3079468.sra Written 2010745 spots for ERR3079468.sra Rejected 2010745 READS because READLEN < 1 Read 2010745 spots for ERR3079468.sra Written 2010745 spots for ERR3079468.sra SRR ids: ['ERR3079468.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_eo8ipm6v ERR3079468.sra spots: 40214918 blocks: [[1, 2010745], [2010746, 4021490], [4021491, 6032235], [6032236, 8042980], [8042981, 10053725], [10053726, 12064470], [12064471, 14075215], [14075216, 16085960], [16085961, 18096705], [18096706, 20107450], [20107451, 22118195], [22118196, 24128940], [24128941, 26139685], [26139686, 28150430], [28150431, 30161175], [30161176, 32171920], [32171921, 34182665], [34182666, 36193410], [36193411, 38204155], [38204156, 40214918]] ERR3079468 file size 5712067 ERR3079468 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3079468 ERR3079468_1.fastq Input file: ERR3079468_1.fastq trimmed: ERR3079468-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:33:21 2024 >> started Sat Dec 7 12:33:39 2024 >> done (18.096s) 40214918 reads processed; of these: 18692 ( 0.05%) short reads filtered out after trimming by size control 42888 ( 0.11%) empty reads filtered out after trimming by size control 40153338 (99.85%) reads available; of these: 1336043 ( 3.33%) trimmed reads available after processing 38817295 (96.67%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2290 0.01% 19 2562 0.01% 20 2883 0.01% 21 3416 0.01% 22 4309 0.01% 23 5274 0.01% 24 6838 0.02% 25 7846 0.02% 26 7752 0.02% 27 7666 0.02% 28 7506 0.02% 29 7027 0.02% 30 7126 0.02% 31 7117 0.02% 32 7432 0.02% 33 8083 0.02% 34 8468 0.02% 35 9127 0.02% 36 10188 0.03% 37 11319 0.03% 38 12627 0.03% 39 15067 0.04% 40 16840 0.04% 41 19375 0.05% 42 22328 0.06% 43 27745 0.07% 44 35689 0.09% 45 47096 0.12% 46 57955 0.14% 47 78729 0.20% 48 126190 0.31% 49 235939 0.59% 50 506234 1.26% 51 38817295 96.67% 40153338 reads passed initial QC criterion=sequence-density sequence-density=1.26 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=17 prefix-density=1.53 prefix-fanout=2.3 sequence=CCTCGCAGCCGCAGGGACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=55.59 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=2.0 sequence=CATCAACAATCATCACCACTGTCACCGAAAAGCATTAACAACATGAAGATCACCTTCTTCCTCTTAGCACTCTTAGCTTTGGTAGCAAGCGCTACCGCCTTTTCGCGGTACGCCGACGTCCGTACTGGGCAGGATCCGCACGTTCGCGGTGATAAGGGCATTAGTTCTGAGCAGCAATGCCATCAGGAGCAGATGAAGCTAGACTCCTGCAAGGACTACGTGACGGAGCGGTGCACGCTGCCAGGGGAGATACCGTTCACTAAGCCATATAAATGGGGGAAGGGCAGCTGCCAAGAGGTCAAGAACCAGTGCTGTCAAGAGCTAGAGAAGACATCATCAGA Started job on | Dec 07 12:34:10 Started mapping on | Dec 07 12:34:11 Finished on | Dec 07 12:34:55 Mapping speed, Million of reads per hour | 3285.27 Number of input reads | 40153338 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 30017046 Uniquely mapped reads % | 74.76% Average mapped length | 50.69 Number of splices: Total | 3136676 Number of splices: Annotated (sjdb) | 3017936 Number of splices: GT/AG | 3100547 Number of splices: GC/AG | 27210 Number of splices: AT/AC | 1265 Number of splices: Non-canonical | 7654 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.00% Deletion average length | 1.33 Insertion rate per base | 0.00% Insertion average length | 1.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 7884327 % of reads mapped to multiple loci | 19.64% Number of reads mapped to too many loci | 1977451 % of reads mapped to too many loci | 4.92% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.38% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2251965 2251965 2251965 N_multimapping 7884327 7884327 7884327 N_noFeature 864297 15226773 15367428 N_ambiguous 305602 9921 10004 UnstrandedReadsAssigned:28847147 PositiveStrandReadsAssigned:14780352 NegativeStrandReadsAssigned:14639614 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 ERR3079468 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR3079468-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 40,153,338 reads, 34,634,758 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,141 rounds 52973 ERR3079468.ke.tsv 35125 ERR3079468.se.tsv 88098 total ==> ERR3079468.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 8.44128e-05 4.05425e-06 PNS24247 1044 945 66.9088 2.84629 PNS24249 1928 1829 124.874 2.74466 PNS24246 1044 945 66.9088 2.84629 PNS24248 1044 945 66.9088 2.84629 PNS24244 1471 1372 143.399 4.20166 PNS24243 293 194 0 0 KQK14069 1603 1504 1837.25 49.1075 KQK14071 474 375 714.037 76.5452 ==> ERR3079468.se.tsv <== BRADI_1g14170v3 2971 BRADI_1g53295v3 381 BRADI_1g59795v3 254 BRADI_1g07683v3 0 BRADI_1g00485v3 17 BRADI_1g20270v3 294 BRADI_1g74790v3 43 BRADI_1g09890v3 7 BRADI_1g77505v3 328 BRADI_1g48960v3 17 ERR3079468 completed mapping pipeline successfully