Starting /dee2/code/volunteer_pipeline.sh ERR3079469 current disk space = 1543029362688 free memory = 1599129412 ERR3079469 SRAfilesize fa35fe64ae559b8f22c7060b39509645 ERR3079469.sra ERR3079469.sra file validated ERR3079469 is single end ERR3079469 is conventional basespace ERR3079469 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3079469_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.7065 33.0 33.0 33.0 14.0 33.0 2 32.11975 33.0 33.0 33.0 27.0 33.0 3 32.1295 33.0 33.0 33.0 27.0 33.0 4 32.4945 33.0 33.0 33.0 33.0 33.0 5 32.588 33.0 33.0 33.0 33.0 33.0 6 35.84525 37.0 37.0 37.0 33.0 37.0 7 36.16075 37.0 37.0 37.0 37.0 37.0 8 36.27425 37.0 37.0 37.0 37.0 37.0 9 36.23475 37.0 37.0 37.0 37.0 37.0 10 36.332 37.0 37.0 37.0 37.0 37.0 11 36.26175 37.0 37.0 37.0 37.0 37.0 12 36.14775 37.0 37.0 37.0 37.0 37.0 13 36.179 37.0 37.0 37.0 37.0 37.0 14 36.099 37.0 37.0 37.0 37.0 37.0 15 36.20625 37.0 37.0 37.0 37.0 37.0 16 36.1475 37.0 37.0 37.0 33.0 37.0 17 35.996 37.0 37.0 37.0 33.0 37.0 18 35.86175 37.0 37.0 37.0 33.0 37.0 19 36.0585 37.0 37.0 37.0 33.0 37.0 20 35.85275 37.0 37.0 37.0 33.0 37.0 21 35.80375 37.0 37.0 37.0 33.0 37.0 22 35.494 37.0 37.0 37.0 33.0 37.0 23 35.678 37.0 37.0 37.0 33.0 37.0 24 36.01425 37.0 37.0 37.0 33.0 37.0 25 36.12925 37.0 37.0 37.0 37.0 37.0 26 36.226 37.0 37.0 37.0 37.0 37.0 27 36.0745 37.0 37.0 37.0 37.0 37.0 28 35.887 37.0 37.0 37.0 33.0 37.0 29 35.53675 37.0 37.0 37.0 33.0 37.0 30 34.872 37.0 37.0 37.0 27.0 37.0 31 34.315 37.0 37.0 37.0 27.0 37.0 32 33.8955 37.0 33.0 37.0 27.0 37.0 33 33.52075 37.0 33.0 37.0 27.0 37.0 34 33.51175 37.0 33.0 37.0 27.0 37.0 35 34.336 37.0 33.0 37.0 27.0 37.0 36 34.301 37.0 33.0 37.0 27.0 37.0 37 34.716 37.0 37.0 37.0 27.0 37.0 38 35.02375 37.0 37.0 37.0 33.0 37.0 39 35.4155 37.0 37.0 37.0 33.0 37.0 40 35.60825 37.0 37.0 37.0 33.0 37.0 41 36.0185 37.0 37.0 37.0 33.0 37.0 42 36.08325 37.0 37.0 37.0 37.0 37.0 43 36.0665 37.0 37.0 37.0 37.0 37.0 44 36.15625 37.0 37.0 37.0 37.0 37.0 45 35.7055 37.0 37.0 37.0 33.0 37.0 46 36.02925 37.0 37.0 37.0 37.0 37.0 47 36.13525 37.0 37.0 37.0 37.0 37.0 48 36.1825 37.0 37.0 37.0 37.0 37.0 49 35.99825 37.0 37.0 37.0 37.0 37.0 50 36.01425 37.0 37.0 37.0 37.0 37.0 51 35.49975 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 0.0 17 2.0 18 2.0 19 0.0 20 1.0 21 3.0 22 2.0 23 3.0 24 5.0 25 0.0 26 8.0 27 20.0 28 27.0 29 57.0 30 72.0 31 84.0 32 114.0 33 218.0 34 385.0 35 933.0 36 2061.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.33615742006013 13.391637059305822 7.789013391637059 48.483192128997 2 26.400000000000002 17.2 33.625 22.775000000000002 3 23.200000000000003 22.8 21.099999999999998 32.9 4 26.650000000000002 26.974999999999998 18.35 28.025 5 30.049999999999997 28.825 20.549999999999997 20.575 6 22.125 33.7 20.599999999999998 23.575 7 21.15 19.425 35.699999999999996 23.724999999999998 8 22.2 20.724999999999998 27.675 29.4 9 22.875 20.175 30.275000000000002 26.674999999999997 10 24.2 31.324999999999996 23.275000000000002 21.2 11 28.475 23.375 20.724999999999998 27.425 12 24.4 21.375 25.174999999999997 29.049999999999997 13 23.625 23.849999999999998 26.05 26.474999999999998 14 25.474999999999998 23.25 24.5 26.775 15 25.324999999999996 24.05 23.525 27.1 16 24.9 24.099999999999998 24.4 26.6 17 25.874999999999996 22.95 23.35 27.825 18 25.8 23.225 23.674999999999997 27.3 19 25.2 24.325 21.825 28.65 20 26.85 24.9 23.7 24.55 21 26.5 22.7 23.3 27.500000000000004 22 25.25 24.375 22.375 28.000000000000004 23 26.0 23.175 24.224999999999998 26.6 24 25.6 24.0 23.375 27.025 25 25.724999999999998 25.4 24.0 24.875 26 25.8 24.15 23.0 27.05 27 25.974999999999998 23.849999999999998 24.349999999999998 25.825 28 26.35 23.425 22.25 27.975 29 25.624999999999996 24.375 24.325 25.674999999999997 30 24.55 23.775 24.925 26.75 31 25.0 23.95 22.650000000000002 28.4 32 25.1 24.325 24.3 26.275 33 24.2 24.425 24.65 26.724999999999998 34 26.25 22.475 22.15 29.125 35 25.0 24.8 23.775 26.424999999999997 36 23.925 23.875 25.5 26.700000000000003 37 25.7 22.725 25.25 26.325 38 25.825 23.875 23.225 27.075 39 25.074999999999996 23.825 23.325000000000003 27.775 40 24.25 24.474999999999998 24.85 26.424999999999997 41 26.1 22.95 23.825 27.125 42 25.8 23.35 23.549999999999997 27.3 43 25.4 23.25 23.025000000000002 28.325 44 26.900000000000002 22.425 24.125 26.55 45 26.625 23.599999999999998 22.825 26.950000000000003 46 25.5 23.775 22.625 28.1 47 25.900000000000002 22.575 25.55 25.974999999999998 48 27.275 23.775 22.45 26.5 49 26.200000000000003 22.7 23.45 27.650000000000002 50 26.950000000000003 22.1 22.775000000000002 28.175 51 26.75 23.275000000000002 24.025 25.95 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 3.0 23 1.5 24 0.0 25 1.0 26 2.5 27 3.0 28 9.5 29 16.0 30 18.0 31 20.0 32 26.0 33 32.0 34 64.0 35 96.0 36 119.0 37 142.0 38 159.5 39 177.0 40 201.0 41 225.0 42 256.0 43 287.0 44 303.0 45 319.0 46 306.5 47 294.0 48 291.0 49 288.0 50 272.5 51 257.0 52 228.5 53 200.0 54 199.5 55 199.0 56 191.0 57 183.0 58 169.5 59 156.0 60 170.5 61 185.0 62 174.5 63 164.0 64 157.5 65 151.0 66 137.0 67 123.0 68 116.5 69 110.0 70 111.5 71 113.0 72 104.5 73 96.0 74 77.5 75 53.0 76 47.0 77 33.5 78 20.0 79 20.5 80 21.0 81 14.0 82 7.0 83 3.5 84 0.0 85 2.0 86 4.0 87 2.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.325 #Duplication Level Percentage of deduplicated Percentage of total 1 93.69076631464934 86.5 2 5.009477389656106 9.25 3 0.9206607094503114 2.55 4 0.27078256160303277 1.0 5 0.027078256160303276 0.125 6 0.0 0.0 7 0.027078256160303276 0.17500000000000002 8 0.05415651232060655 0.4 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAAAACACAAACACAAACATCAAACCTAGCGCACCAAGCAGTAGCCAAACA 8 0.2 No Hit GTATGATTAACAGCTGCCCTCGACGAAGAAGTCCATTGAACACATTGCGGC 8 0.2 No Hit CTAGTTTCTCGTCGGTTTTGTCTTACTTTTGCATTTTCCTCTTGTTCCATG 7 0.17500000000000002 No Hit CAAAACACAAAACACAACATCAAATTTAGTCCCAAGCAGCAGCCAAACACC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1612264 READS because READLEN < 1 Read 1612264 spots for ERR3079469.sra Written 1612264 spots for ERR3079469.sra Rejected 1612264 READS because READLEN < 1 Read 1612264 spots for ERR3079469.sra Written 1612264 spots for ERR3079469.sra Rejected 1612264 READS because READLEN < 1 Read 1612264 spots for ERR3079469.sra Written 1612264 spots for ERR3079469.sra Rejected 1612264 READS because READLEN < 1 Read 1612264 spots for ERR3079469.sra Written 1612264 spots for ERR3079469.sra Rejected 1612264 READS because READLEN < 1 Read 1612264 spots for ERR3079469.sra Written 1612264 spots for ERR3079469.sra Rejected 1612264 READS because READLEN < 1 Read 1612264 spots for ERR3079469.sra Written 1612264 spots for ERR3079469.sra Rejected 1612264 READS because READLEN < 1 Read 1612264 spots for ERR3079469.sra Written 1612264 spots for ERR3079469.sra Rejected 1612264 READS because READLEN < 1 Read 1612264 spots for ERR3079469.sra Written 1612264 spots for ERR3079469.sra Rejected 1612264 READS because READLEN < 1 Read 1612264 spots for ERR3079469.sra Written 1612264 spots for ERR3079469.sra Rejected 1612264 READS because READLEN < 1 Read 1612264 spots for ERR3079469.sra Written 1612264 spots for ERR3079469.sra Rejected 1612264 READS because READLEN < 1 Read 1612264 spots for ERR3079469.sra Written 1612264 spots for ERR3079469.sra Rejected 1612264 READS because READLEN < 1 Read 1612264 spots for ERR3079469.sra Written 1612264 spots for ERR3079469.sra Rejected 1612264 READS because READLEN < 1 Read 1612264 spots for ERR3079469.sra Written 1612264 spots for ERR3079469.sra Rejected 1612270 READS because READLEN < 1 Read 1612270 spots for ERR3079469.sra Written 1612270 spots for ERR3079469.sra Rejected 1612264 READS because READLEN < 1 Read 1612264 spots for ERR3079469.sra Written 1612264 spots for ERR3079469.sra Rejected 1612264 READS because READLEN < 1 Read 1612264 spots for ERR3079469.sra Written 1612264 spots for ERR3079469.sra Rejected 1612264 READS because READLEN < 1 Read 1612264 spots for ERR3079469.sra Written 1612264 spots for ERR3079469.sra Rejected 1612264 READS because READLEN < 1 Read 1612264 spots for ERR3079469.sra Written 1612264 spots for ERR3079469.sra Rejected 1612264 READS because READLEN < 1 Read 1612264 spots for ERR3079469.sra Written 1612264 spots for ERR3079469.sra Rejected 1612264 READS because READLEN < 1 Read 1612264 spots for ERR3079469.sra Written 1612264 spots for ERR3079469.sra SRR ids: ['ERR3079469.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f93a1dzc ERR3079469.sra spots: 32245286 blocks: [[1, 1612264], [1612265, 3224528], [3224529, 4836792], [4836793, 6449056], [6449057, 8061320], [8061321, 9673584], [9673585, 11285848], [11285849, 12898112], [12898113, 14510376], [14510377, 16122640], [16122641, 17734904], [17734905, 19347168], [19347169, 20959432], [20959433, 22571696], [22571697, 24183960], [24183961, 25796224], [25796225, 27408488], [27408489, 29020752], [29020753, 30633016], [30633017, 32245286]] ERR3079469 file size 4575772 ERR3079469 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3079469 ERR3079469_1.fastq Input file: ERR3079469_1.fastq trimmed: ERR3079469-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:45:26 2024 >> started Sat Dec 7 12:45:41 2024 >> done (15.360s) 32245286 reads processed; of these: 6832 ( 0.02%) short reads filtered out after trimming by size control 4588 ( 0.01%) empty reads filtered out after trimming by size control 32233866 (99.96%) reads available; of these: 701121 ( 2.18%) trimmed reads available after processing 31532745 (97.82%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 989 0.00% 19 1305 0.00% 20 1828 0.01% 21 2069 0.01% 22 2464 0.01% 23 2981 0.01% 24 6008 0.02% 25 9768 0.03% 26 10137 0.03% 27 9778 0.03% 28 8736 0.03% 29 7443 0.02% 30 6622 0.02% 31 5847 0.02% 32 6589 0.02% 33 20628 0.06% 34 9736 0.03% 35 4514 0.01% 36 3442 0.01% 37 3432 0.01% 38 3840 0.01% 39 4421 0.01% 40 5247 0.02% 41 5896 0.02% 42 6886 0.02% 43 8950 0.03% 44 12061 0.04% 45 16823 0.05% 46 21592 0.07% 47 30636 0.10% 48 60619 0.19% 49 111325 0.35% 50 288509 0.90% 51 31532745 97.82% 32233866 reads passed initial QC criterion=sequence-density sequence-density=1.12 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=15 prefix-density=1.34 prefix-fanout=2.2 sequence=CCTCGCAGCCGCAGGGACC criterion=fanout-score sequence-density=0.12 sequence-density-rank=23 fanout-score=18.20 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=3.9 sequence=TGTTGCTGCTTCACCTGGCACCTGTTCTGCTGCACTGTAGGCCACGGTCCTAGGATTGACGTCGTCTGCATCTCCGTCGGGCTGCACCGCTGCAGGAAATACTCCCTACACTGGTCCAGTTGCTGTGGCGGGAAGGGGTGTTGTTGTGGCGGCTGCTGGCATGATTGTTCCTGTGACGGCTGAAAAGATCTAGTGACTGGGTCG Started job on | Dec 07 12:45:51 Started mapping on | Dec 07 12:45:51 Finished on | Dec 07 12:46:17 Mapping speed, Million of reads per hour | 4463.15 Number of input reads | 32233866 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 23806798 Uniquely mapped reads % | 73.86% Average mapped length | 50.73 Number of splices: Total | 2638108 Number of splices: Annotated (sjdb) | 2544266 Number of splices: GT/AG | 2608399 Number of splices: GC/AG | 22269 Number of splices: AT/AC | 1053 Number of splices: Non-canonical | 6387 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.00% Deletion average length | 1.34 Insertion rate per base | 0.00% Insertion average length | 1.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 6901011 % of reads mapped to multiple loci | 21.41% Number of reads mapped to too many loci | 1304216 % of reads mapped to too many loci | 4.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.40% % of reads unmapped: other | 0.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1526057 1526057 1526057 N_multimapping 6901011 6901011 6901011 N_noFeature 664109 12201958 12079090 N_ambiguous 203620 7567 7496 UnstrandedReadsAssigned:22939069 PositiveStrandReadsAssigned:11597273 NegativeStrandReadsAssigned:11720212 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 ERR3079469 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR3079469-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,233,866 reads, 28,189,202 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,111 rounds 52973 ERR3079469.ke.tsv 35125 ERR3079469.se.tsv 88098 total ==> ERR3079469.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 5.52397e-07 3.33814e-08 PNS24247 1044 945 67.5929 3.61783 PNS24249 1928 1829 179.136 4.95391 PNS24246 1044 945 67.5929 3.61783 PNS24248 1044 945 67.5929 3.61783 PNS24244 1471 1372 44.0853 1.62524 PNS24243 293 194 3 0.782165 KQK14069 1603 1504 1566.62 52.6859 KQK14071 474 375 418.417 56.436 ==> ERR3079469.se.tsv <== BRADI_1g14170v3 2222 BRADI_1g53295v3 351 BRADI_1g59795v3 140 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 313 BRADI_1g74790v3 35 BRADI_1g09890v3 5 BRADI_1g77505v3 163 BRADI_1g48960v3 15 ERR3079469 completed mapping pipeline successfully