Starting /dee2/code/volunteer_pipeline.sh ERR3079470 current disk space = 1543135805440 free memory = 1599133244 ERR3079470 SRAfilesize 512cfc5c4127544ea5f4569ebd2fe719 ERR3079470.sra ERR3079470.sra file validated ERR3079470 is single end ERR3079470 is conventional basespace ERR3079470 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3079470_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.68825 33.0 33.0 33.0 27.0 33.0 2 32.097 33.0 33.0 33.0 27.0 33.0 3 32.23925 33.0 33.0 33.0 33.0 33.0 4 32.3255 33.0 33.0 33.0 33.0 33.0 5 32.36825 33.0 33.0 33.0 33.0 33.0 6 36.05475 37.0 37.0 37.0 33.0 37.0 7 36.252 37.0 37.0 37.0 37.0 37.0 8 36.31225 37.0 37.0 37.0 37.0 37.0 9 36.36175 37.0 37.0 37.0 37.0 37.0 10 36.3015 37.0 37.0 37.0 37.0 37.0 11 36.43875 37.0 37.0 37.0 37.0 37.0 12 36.3625 37.0 37.0 37.0 37.0 37.0 13 36.29875 37.0 37.0 37.0 37.0 37.0 14 36.35525 37.0 37.0 37.0 37.0 37.0 15 36.333 37.0 37.0 37.0 37.0 37.0 16 36.31725 37.0 37.0 37.0 37.0 37.0 17 36.27025 37.0 37.0 37.0 37.0 37.0 18 36.297 37.0 37.0 37.0 37.0 37.0 19 36.3325 37.0 37.0 37.0 37.0 37.0 20 36.2375 37.0 37.0 37.0 37.0 37.0 21 36.29475 37.0 37.0 37.0 37.0 37.0 22 36.32075 37.0 37.0 37.0 37.0 37.0 23 36.0945 37.0 37.0 37.0 37.0 37.0 24 36.11325 37.0 37.0 37.0 37.0 37.0 25 36.2615 37.0 37.0 37.0 37.0 37.0 26 36.22125 37.0 37.0 37.0 37.0 37.0 27 36.14475 37.0 37.0 37.0 37.0 37.0 28 36.18425 37.0 37.0 37.0 37.0 37.0 29 36.25375 37.0 37.0 37.0 37.0 37.0 30 36.1885 37.0 37.0 37.0 37.0 37.0 31 36.2235 37.0 37.0 37.0 37.0 37.0 32 36.18225 37.0 37.0 37.0 37.0 37.0 33 36.1675 37.0 37.0 37.0 37.0 37.0 34 36.09475 37.0 37.0 37.0 37.0 37.0 35 36.08 37.0 37.0 37.0 37.0 37.0 36 36.11175 37.0 37.0 37.0 37.0 37.0 37 35.98075 37.0 37.0 37.0 37.0 37.0 38 36.16025 37.0 37.0 37.0 37.0 37.0 39 36.1 37.0 37.0 37.0 37.0 37.0 40 36.14275 37.0 37.0 37.0 37.0 37.0 41 36.13 37.0 37.0 37.0 37.0 37.0 42 36.14625 37.0 37.0 37.0 37.0 37.0 43 36.151 37.0 37.0 37.0 37.0 37.0 44 36.1345 37.0 37.0 37.0 37.0 37.0 45 36.07575 37.0 37.0 37.0 37.0 37.0 46 36.09125 37.0 37.0 37.0 37.0 37.0 47 35.89225 37.0 37.0 37.0 37.0 37.0 48 35.94475 37.0 37.0 37.0 37.0 37.0 49 35.5095 37.0 37.0 37.0 33.0 37.0 50 35.602 37.0 37.0 37.0 37.0 37.0 51 35.139 37.0 37.0 37.0 33.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 0.0 5 1.0 6 1.0 7 0.0 8 1.0 9 0.0 10 1.0 11 2.0 12 2.0 13 1.0 14 0.0 15 2.0 16 0.0 17 1.0 18 2.0 19 3.0 20 1.0 21 1.0 22 3.0 23 7.0 24 3.0 25 7.0 26 8.0 27 20.0 28 23.0 29 31.0 30 41.0 31 49.0 32 64.0 33 94.0 34 138.0 35 464.0 36 3023.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.70244420828905 15.276301806588735 7.863974495217853 47.157279489904354 2 27.125 16.900000000000002 33.1 22.875 3 23.925 22.625 21.224999999999998 32.225 4 27.500000000000004 25.45 18.55 28.499999999999996 5 28.925 28.575 19.7 22.8 6 23.575 34.175 20.225 22.025 7 21.425 19.35 35.5 23.724999999999998 8 20.849999999999998 21.675 26.8 30.675 9 21.9 19.825 30.4 27.875 10 22.825 30.775000000000002 24.2 22.2 11 28.449999999999996 24.175 19.525000000000002 27.85 12 25.575 21.65 24.7 28.075 13 24.4 24.575 25.35 25.674999999999997 14 24.875 24.025 24.5 26.6 15 24.25 23.45 24.25 28.050000000000004 16 24.575 24.4 24.75 26.275 17 26.174999999999997 23.0 24.125 26.700000000000003 18 26.075 24.275 22.55 27.1 19 25.124999999999996 24.925 22.525000000000002 27.425 20 26.724999999999998 24.625 23.7 24.95 21 25.25 23.150000000000002 24.175 27.425 22 25.474999999999998 24.224999999999998 23.5 26.8 23 25.674999999999997 22.650000000000002 24.825 26.85 24 26.025 23.925 23.3 26.75 25 25.0 24.275 24.025 26.700000000000003 26 26.025 23.925 23.35 26.700000000000003 27 26.424999999999997 23.775 22.650000000000002 27.150000000000002 28 26.424999999999997 24.75 23.1 25.724999999999998 29 26.474999999999998 24.025 24.349999999999998 25.15 30 25.4 23.175 26.0 25.424999999999997 31 25.374999999999996 24.125 23.225 27.275 32 24.875 24.175 23.65 27.3 33 26.025 24.45 23.599999999999998 25.924999999999997 34 25.974999999999998 23.549999999999997 23.05 27.425 35 25.575 24.725 24.325 25.374999999999996 36 24.875 23.3 23.549999999999997 28.275 37 24.425 23.474999999999998 25.5 26.6 38 26.724999999999998 24.525 22.875 25.874999999999996 39 24.325 23.875 23.799999999999997 28.000000000000004 40 24.575 23.9 24.3 27.224999999999998 41 25.374999999999996 24.725 23.150000000000002 26.75 42 25.424999999999997 22.75 23.275000000000002 28.549999999999997 43 25.324999999999996 22.025 25.95 26.700000000000003 44 26.55 22.325 23.474999999999998 27.650000000000002 45 25.8 24.975 22.25 26.974999999999998 46 23.925 24.55 23.625 27.900000000000002 47 26.525 22.45 24.075 26.950000000000003 48 26.424999999999997 22.675 23.400000000000002 27.500000000000004 49 26.200000000000003 21.825 24.775 27.200000000000003 50 25.924999999999997 22.7 23.400000000000002 27.975 51 24.75 23.375 23.875 28.000000000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 3.5 24 5.0 25 4.0 26 4.5 27 6.0 28 8.0 29 10.0 30 15.5 31 21.0 32 26.0 33 31.0 34 55.5 35 80.0 36 110.5 37 141.0 38 160.0 39 179.0 40 201.0 41 223.0 42 270.5 43 318.0 44 301.5 45 285.0 46 274.5 47 264.0 48 289.0 49 314.0 50 282.0 51 250.0 52 252.0 53 254.0 54 239.0 55 224.0 56 194.5 57 165.0 58 164.0 59 163.0 60 169.0 61 175.0 62 162.0 63 149.0 64 139.0 65 129.0 66 129.5 67 130.0 68 121.5 69 113.0 70 107.0 71 101.0 72 90.5 73 80.0 74 76.0 75 61.0 76 50.0 77 36.5 78 23.0 79 23.5 80 24.0 81 13.5 82 3.0 83 3.5 84 4.0 85 3.0 86 2.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.8999999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.85 #Duplication Level Percentage of deduplicated Percentage of total 1 94.2380183091007 87.5 2 4.469574582660204 8.3 3 0.9154550350026925 2.55 4 0.2154011847065159 0.8 5 0.08077544426494346 0.375 6 0.053850296176628974 0.3 7 0.026925148088314487 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTAGTTTCTCGTCGGTTTTGTCTTACTTTTGCATTTTCCTCTTGTTCCATG 7 0.17500000000000002 No Hit GTGAAATAGTTCGTGTGGAATATGGACTTCAATTTCTGACGCCCGTCGTCA 6 0.15 No Hit CTACATTCTCGAAGGTAGTGGTTTTGTAGGACTGGCTTTTCCTGGGTGCCC 6 0.15 No Hit CAAAACACAAACACAAACATCAAACCTAGCGCACCAAGCAGTAGCCAAACA 5 0.125 No Hit CTGGTAACTACAACGGAGTGCTACAATCTGGACGGAACATACTCAATGGTT 5 0.125 No Hit CTTCTGTTCACTCGAGCCAAGGCAAAACATCGAGGATCCCAACCGTGCCGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 2152554 READS because READLEN < 1 Read 2152554 spots for ERR3079470.sra Written 2152554 spots for ERR3079470.sra Rejected 2152554 READS because READLEN < 1 Read 2152554 spots for ERR3079470.sra Written 2152554 spots for ERR3079470.sra Rejected 2152554 READS because READLEN < 1 Read 2152554 spots for ERR3079470.sra Written 2152554 spots for ERR3079470.sra Rejected 2152567 READS because READLEN < 1 Read 2152567 spots for ERR3079470.sra Written 2152567 spots for ERR3079470.sra Rejected 2152554 READS because READLEN < 1 Read 2152554 spots for ERR3079470.sra Written 2152554 spots for ERR3079470.sra Rejected 2152554 READS because READLEN < 1 Read 2152554 spots for ERR3079470.sra Written 2152554 spots for ERR3079470.sra Rejected 2152554 READS because READLEN < 1 Read 2152554 spots for ERR3079470.sra Written 2152554 spots for ERR3079470.sra Rejected 2152554 READS because READLEN < 1 Read 2152554 spots for ERR3079470.sra Written 2152554 spots for ERR3079470.sra Rejected 2152554 READS because READLEN < 1 Read 2152554 spots for ERR3079470.sra Written 2152554 spots for ERR3079470.sra Rejected 2152554 READS because READLEN < 1 Read 2152554 spots for ERR3079470.sra Written 2152554 spots for ERR3079470.sra Rejected 2152554 READS because READLEN < 1 Read 2152554 spots for ERR3079470.sra Written 2152554 spots for ERR3079470.sra Rejected 2152554 READS because READLEN < 1 Read 2152554 spots for ERR3079470.sra Written 2152554 spots for ERR3079470.sra Rejected 2152554 READS because READLEN < 1 Read 2152554 spots for ERR3079470.sra Written 2152554 spots for ERR3079470.sra Rejected 2152554 READS because READLEN < 1 Read 2152554 spots for ERR3079470.sra Written 2152554 spots for ERR3079470.sra Rejected 2152554 READS because READLEN < 1 Read 2152554 spots for ERR3079470.sra Written 2152554 spots for ERR3079470.sra Rejected 2152554 READS because READLEN < 1 Read 2152554 spots for ERR3079470.sra Written 2152554 spots for ERR3079470.sra Rejected 2152554 READS because READLEN < 1 Read 2152554 spots for ERR3079470.sra Written 2152554 spots for ERR3079470.sra Rejected 2152554 READS because READLEN < 1 Read 2152554 spots for ERR3079470.sra Written 2152554 spots for ERR3079470.sra Rejected 2152554 READS because READLEN < 1 Read 2152554 spots for ERR3079470.sra Written 2152554 spots for ERR3079470.sra Rejected 2152554 READS because READLEN < 1 Read 2152554 spots for ERR3079470.sra Written 2152554 spots for ERR3079470.sra SRR ids: ['ERR3079470.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sv793l3z ERR3079470.sra spots: 43051093 blocks: [[1, 2152554], [2152555, 4305108], [4305109, 6457662], [6457663, 8610216], [8610217, 10762770], [10762771, 12915324], [12915325, 15067878], [15067879, 17220432], [17220433, 19372986], [19372987, 21525540], [21525541, 23678094], [23678095, 25830648], [25830649, 27983202], [27983203, 30135756], [30135757, 32288310], [32288311, 34440864], [34440865, 36593418], [36593419, 38745972], [38745973, 40898526], [40898527, 43051093]] ERR3079470 file size 6116443 ERR3079470 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3079470 ERR3079470_1.fastq Input file: ERR3079470_1.fastq trimmed: ERR3079470-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:46:49 2024 >> started Sat Dec 7 12:47:12 2024 >> done (22.874s) 43051093 reads processed; of these: 25093 ( 0.06%) short reads filtered out after trimming by size control 78804 ( 0.18%) empty reads filtered out after trimming by size control 42947196 (99.76%) reads available; of these: 1623648 ( 3.78%) trimmed reads available after processing 41323548 (96.22%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2571 0.01% 19 2835 0.01% 20 3154 0.01% 21 3627 0.01% 22 4379 0.01% 23 5221 0.01% 24 6497 0.02% 25 7661 0.02% 26 7700 0.02% 27 7942 0.02% 28 7680 0.02% 29 7718 0.02% 30 7803 0.02% 31 8519 0.02% 32 9009 0.02% 33 9952 0.02% 34 10745 0.03% 35 11728 0.03% 36 13284 0.03% 37 14671 0.03% 38 16259 0.04% 39 18054 0.04% 40 21106 0.05% 41 25029 0.06% 42 27566 0.06% 43 36003 0.08% 44 45420 0.11% 45 55578 0.13% 46 72084 0.17% 47 100312 0.23% 48 154456 0.36% 49 295710 0.69% 50 603375 1.40% 51 41323548 96.22% 42947196 reads passed initial QC criterion=sequence-density sequence-density=1.14 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=20 prefix-density=1.35 prefix-fanout=2.2 sequence=CCTCGCAGCCGCAGGGACC criterion=fanout-score sequence-density=0.11 sequence-density-rank=26 fanout-score=18.70 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=4.0 sequence=TGTTGCTGCTTCACCTGGCACCTGTTCTGCTGCACTGTAGGCCACGGTCCTAGGATTGACGTCGTCTGCATCTCCGTCGGGCTGCACCGCTGCAGGAAATACTCCCTACACTGGTCCAGTTGCTGTGGCGGGAAGGGGTGTTGTTGTGGCGGCTGCTGG Started job on | Dec 07 12:47:23 Started mapping on | Dec 07 12:47:24 Finished on | Dec 07 12:47:58 Mapping speed, Million of reads per hour | 4547.35 Number of input reads | 42947196 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 31493325 Uniquely mapped reads % | 73.33% Average mapped length | 50.67 Number of splices: Total | 3587193 Number of splices: Annotated (sjdb) | 3456580 Number of splices: GT/AG | 3545801 Number of splices: GC/AG | 31134 Number of splices: AT/AC | 1444 Number of splices: Non-canonical | 8814 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.32 Insertion rate per base | 0.00% Insertion average length | 1.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 8781898 % of reads mapped to multiple loci | 20.45% Number of reads mapped to too many loci | 2449501 % of reads mapped to too many loci | 5.70% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.40% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2671973 2671973 2671973 N_multimapping 8781898 8781898 8781898 N_noFeature 930271 16039385 16110764 N_ambiguous 293480 11222 10582 UnstrandedReadsAssigned:30269574 PositiveStrandReadsAssigned:15442718 NegativeStrandReadsAssigned:15371979 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 ERR3079470 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR3079470-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 42,947,196 reads, 38,498,243 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,233 rounds 52973 ERR3079470.ke.tsv 35125 ERR3079470.se.tsv 88098 total ==> ERR3079470.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 96.9886 4.33516 PNS24247 1044 945 37.1575 1.47104 PNS24249 1928 1829 282.62 5.78094 PNS24246 1044 945 37.1575 1.47104 PNS24248 1044 945 37.1575 1.47104 PNS24244 1471 1372 58.9194 1.60662 PNS24243 293 194 3 0.578535 KQK14069 1603 1504 2046.78 50.9136 KQK14071 474 375 732.464 73.0743 ==> ERR3079470.se.tsv <== BRADI_1g14170v3 3027 BRADI_1g53295v3 428 BRADI_1g59795v3 225 BRADI_1g07683v3 0 BRADI_1g00485v3 28 BRADI_1g20270v3 440 BRADI_1g74790v3 42 BRADI_1g09890v3 8 BRADI_1g77505v3 250 BRADI_1g48960v3 2 ERR3079470 completed mapping pipeline successfully