Starting /dee2/code/volunteer_pipeline.sh ERR3079471 current disk space = 1543307223040 free memory = 1598623776 ERR3079471 SRAfilesize 84260f14f4404a1ffcb03059ddc4173d ERR3079471.sra ERR3079471.sra file validated ERR3079471 is single end ERR3079471 is conventional basespace ERR3079471 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3079471_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.74325 33.0 33.0 33.0 14.0 33.0 2 31.9105 33.0 33.0 33.0 27.0 33.0 3 32.133 33.0 33.0 33.0 33.0 33.0 4 32.35725 33.0 33.0 33.0 33.0 33.0 5 32.4055 33.0 33.0 33.0 33.0 33.0 6 36.1135 37.0 37.0 37.0 37.0 37.0 7 36.1965 37.0 37.0 37.0 37.0 37.0 8 36.39225 37.0 37.0 37.0 37.0 37.0 9 36.33325 37.0 37.0 37.0 37.0 37.0 10 36.4945 37.0 37.0 37.0 37.0 37.0 11 36.35925 37.0 37.0 37.0 37.0 37.0 12 36.29875 37.0 37.0 37.0 37.0 37.0 13 36.407 37.0 37.0 37.0 37.0 37.0 14 36.3465 37.0 37.0 37.0 37.0 37.0 15 36.3955 37.0 37.0 37.0 37.0 37.0 16 36.4425 37.0 37.0 37.0 37.0 37.0 17 36.296 37.0 37.0 37.0 37.0 37.0 18 36.34125 37.0 37.0 37.0 37.0 37.0 19 36.41375 37.0 37.0 37.0 37.0 37.0 20 36.40375 37.0 37.0 37.0 37.0 37.0 21 36.4075 37.0 37.0 37.0 37.0 37.0 22 36.37975 37.0 37.0 37.0 37.0 37.0 23 36.3645 37.0 37.0 37.0 37.0 37.0 24 36.34375 37.0 37.0 37.0 37.0 37.0 25 36.35525 37.0 37.0 37.0 37.0 37.0 26 36.34725 37.0 37.0 37.0 37.0 37.0 27 36.27025 37.0 37.0 37.0 37.0 37.0 28 36.1905 37.0 37.0 37.0 37.0 37.0 29 36.15525 37.0 37.0 37.0 37.0 37.0 30 36.098 37.0 37.0 37.0 37.0 37.0 31 36.10075 37.0 37.0 37.0 37.0 37.0 32 36.15075 37.0 37.0 37.0 37.0 37.0 33 36.197 37.0 37.0 37.0 37.0 37.0 34 36.26 37.0 37.0 37.0 37.0 37.0 35 36.22075 37.0 37.0 37.0 37.0 37.0 36 36.2395 37.0 37.0 37.0 37.0 37.0 37 36.06 37.0 37.0 37.0 37.0 37.0 38 35.903 37.0 37.0 37.0 37.0 37.0 39 36.02975 37.0 37.0 37.0 37.0 37.0 40 35.992 37.0 37.0 37.0 37.0 37.0 41 36.09425 37.0 37.0 37.0 37.0 37.0 42 36.08275 37.0 37.0 37.0 37.0 37.0 43 36.13925 37.0 37.0 37.0 37.0 37.0 44 36.091 37.0 37.0 37.0 37.0 37.0 45 35.54225 37.0 37.0 37.0 33.0 37.0 46 35.9495 37.0 37.0 37.0 37.0 37.0 47 35.94425 37.0 37.0 37.0 37.0 37.0 48 35.991 37.0 37.0 37.0 37.0 37.0 49 35.9035 37.0 37.0 37.0 37.0 37.0 50 35.80275 37.0 37.0 37.0 37.0 37.0 51 35.27825 37.0 37.0 37.0 33.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 1.0 17 5.0 18 2.0 19 2.0 20 5.0 21 3.0 22 0.0 23 5.0 24 10.0 25 2.0 26 6.0 27 27.0 28 25.0 29 28.0 30 36.0 31 34.0 32 72.0 33 95.0 34 144.0 35 553.0 36 2936.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.939983557138945 14.825979720471363 8.303644834201151 45.930391888188545 2 26.474999999999998 18.075 33.800000000000004 21.65 3 24.975 20.95 21.7 32.375 4 27.075 26.025 19.025 27.875 5 29.325000000000003 28.499999999999996 21.175 21.0 6 24.15 34.125 19.8 21.925 7 21.4 20.05 33.95 24.6 8 20.549999999999997 21.725 27.800000000000004 29.925 9 23.974999999999998 18.875 28.599999999999998 28.549999999999997 10 23.549999999999997 30.7 23.9 21.85 11 27.925 23.95 19.45 28.675 12 24.875 21.025 24.925 29.175 13 23.849999999999998 24.099999999999998 25.4 26.650000000000002 14 24.975 24.375 24.825 25.825 15 25.650000000000002 24.525 23.075000000000003 26.75 16 23.95 24.075 23.9 28.075 17 25.124999999999996 23.200000000000003 23.775 27.900000000000002 18 25.6 23.625 24.349999999999998 26.424999999999997 19 25.575 23.150000000000002 23.375 27.900000000000002 20 26.825 22.025 23.849999999999998 27.3 21 25.124999999999996 24.15 24.55 26.174999999999997 22 26.325 24.075 22.925 26.674999999999997 23 26.150000000000002 23.275000000000002 23.200000000000003 27.375 24 24.474999999999998 24.474999999999998 23.724999999999998 27.325 25 25.275 24.5 25.2 25.025 26 26.775 22.725 23.674999999999997 26.825 27 25.7 24.825 23.5 25.974999999999998 28 27.125 23.775 21.625 27.474999999999998 29 25.650000000000002 23.25 24.224999999999998 26.875 30 24.275 22.575 24.3 28.849999999999998 31 25.4 23.45 23.200000000000003 27.950000000000003 32 27.025 23.5 22.875 26.6 33 27.200000000000003 23.400000000000002 23.849999999999998 25.55 34 26.525 23.575 22.55 27.35 35 25.85 23.45 24.075 26.625 36 26.0 23.35 24.4 26.25 37 25.6 23.400000000000002 24.075 26.924999999999997 38 25.724999999999998 23.5 24.2 26.575 39 26.25 24.175 22.55 27.025 40 25.05 24.0 23.075000000000003 27.875 41 28.1 23.799999999999997 22.45 25.650000000000002 42 25.650000000000002 23.45 23.65 27.250000000000004 43 25.775 22.85 24.125 27.250000000000004 44 27.250000000000004 22.875 24.15 25.724999999999998 45 26.224999999999998 23.575 23.075000000000003 27.125 46 25.45 22.575 24.75 27.224999999999998 47 27.175 22.75 22.125 27.950000000000003 48 25.45 23.35 23.474999999999998 27.725 49 25.775 22.400000000000002 24.3 27.525 50 26.224999999999998 23.3 24.3 26.174999999999997 51 25.525 22.5 24.25 27.725 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.0 22 0.0 23 1.0 24 2.0 25 4.5 26 5.5 27 4.0 28 7.5 29 11.0 30 21.5 31 32.0 32 41.0 33 50.0 34 72.0 35 94.0 36 95.0 37 96.0 38 139.5 39 183.0 40 200.5 41 218.0 42 247.0 43 276.0 44 284.5 45 293.0 46 280.5 47 268.0 48 284.0 49 300.0 50 282.5 51 265.0 52 235.0 53 205.0 54 227.0 55 249.0 56 216.0 57 183.0 58 177.0 59 171.0 60 172.0 61 173.0 62 161.0 63 149.0 64 135.0 65 121.0 66 127.5 67 134.0 68 132.0 69 130.0 70 116.5 71 103.0 72 98.0 73 93.0 74 85.0 75 58.5 76 40.0 77 33.0 78 26.0 79 21.5 80 17.0 81 15.0 82 13.0 83 9.5 84 6.0 85 3.5 86 1.0 87 1.0 88 1.0 89 0.5 90 0.0 91 1.0 92 2.0 93 1.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.774999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.325 #Duplication Level Percentage of deduplicated Percentage of total 1 95.70633448184469 90.275 2 3.206997084548105 6.05 3 0.7421150278293136 2.1 4 0.1590246488205672 0.6 5 0.13252054068380598 0.625 6 0.0 0.0 7 0.05300821627352239 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTACTCGATCTCGTATG 7 0.17500000000000002 TruSeq Adapter, Index 27 (97% over 39bp) CTGGTATCCTTCACTCTCCGCCTTCTTTAAAACGACATAGTTTTGTGGTAT 7 0.17500000000000002 No Hit GGGAAATTCTGACCGTTGAGGCGTGCGATACTGCCAGCACGTGGGTTGTAT 5 0.125 No Hit GGCACACACTAGTTTCTCGTCGGTTTTGTCTTACTTTTGCATTTTCCTCTT 5 0.125 No Hit AAAACACAAAACACAACATCAAATTTAGTCCCAAGCAGCAGCCAAACACCA 5 0.125 No Hit CTCCGATCGGGTAACTCTGGCAGCTGCTTTGGGGGAAATTCGGAGTCAACA 5 0.125 No Hit CTTCTGTTCACTCGAGCCAAGGCAAAACATCGAGGATCCCAACCGTGCCGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 2064586 READS because READLEN < 1 Read 2064586 spots for ERR3079471.sra Written 2064586 spots for ERR3079471.sra Rejected 2064586 READS because READLEN < 1 Read 2064586 spots for ERR3079471.sra Written 2064586 spots for ERR3079471.sra Rejected 2064586 READS because READLEN < 1 Read 2064586 spots for ERR3079471.sra Written 2064586 spots for ERR3079471.sra Rejected 2064586 READS because READLEN < 1 Read 2064586 spots for ERR3079471.sra Written 2064586 spots for ERR3079471.sra Rejected 2064586 READS because READLEN < 1 Read 2064586 spots for ERR3079471.sra Written 2064586 spots for ERR3079471.sra Rejected 2064586 READS because READLEN < 1 Read 2064586 spots for ERR3079471.sra Written 2064586 spots for ERR3079471.sra Rejected 2064586 READS because READLEN < 1 Read 2064586 spots for ERR3079471.sra Written 2064586 spots for ERR3079471.sra Rejected 2064586 READS because READLEN < 1 Read 2064586 spots for ERR3079471.sra Written 2064586 spots for ERR3079471.sra Rejected 2064586 READS because READLEN < 1 Read 2064586 spots for ERR3079471.sra Written 2064586 spots for ERR3079471.sra Rejected 2064586 READS because READLEN < 1 Read 2064586 spots for ERR3079471.sra Written 2064586 spots for ERR3079471.sra Rejected 2064586 READS because READLEN < 1 Read 2064586 spots for ERR3079471.sra Written 2064586 spots for ERR3079471.sra Rejected 2064586 READS because READLEN < 1 Read 2064586 spots for ERR3079471.sra Written 2064586 spots for ERR3079471.sra Rejected 2064586 READS because READLEN < 1 Read 2064586 spots for ERR3079471.sra Written 2064586 spots for ERR3079471.sra Rejected 2064586 READS because READLEN < 1 Read 2064586 spots for ERR3079471.sra Written 2064586 spots for ERR3079471.sra Rejected 2064586 READS because READLEN < 1 Read 2064586 spots for ERR3079471.sra Written 2064586 spots for ERR3079471.sra Rejected 2064586 READS because READLEN < 1 Read 2064586 spots for ERR3079471.sra Written 2064586 spots for ERR3079471.sra Rejected 2064586 READS because READLEN < 1 Read 2064586 spots for ERR3079471.sra Written 2064586 spots for ERR3079471.sra Rejected 2064586 READS because READLEN < 1 Read 2064586 spots for ERR3079471.sra Written 2064586 spots for ERR3079471.sra Rejected 2064586 READS because READLEN < 1 Read 2064586 spots for ERR3079471.sra Written 2064586 spots for ERR3079471.sra Rejected 2064591 READS because READLEN < 1 Read 2064591 spots for ERR3079471.sra Written 2064591 spots for ERR3079471.sra SRR ids: ['ERR3079471.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_njchrt5p ERR3079471.sra spots: 41291725 blocks: [[1, 2064586], [2064587, 4129172], [4129173, 6193758], [6193759, 8258344], [8258345, 10322930], [10322931, 12387516], [12387517, 14452102], [14452103, 16516688], [16516689, 18581274], [18581275, 20645860], [20645861, 22710446], [22710447, 24775032], [24775033, 26839618], [26839619, 28904204], [28904205, 30968790], [30968791, 33033376], [33033377, 35097962], [35097963, 37162548], [37162549, 39227134], [39227135, 41291725]] ERR3079471 file size 5865596 ERR3079471 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3079471 ERR3079471_1.fastq Input file: ERR3079471_1.fastq trimmed: ERR3079471-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:55:32 2024 >> started Sat Dec 7 12:57:07 2024 >> done (95.181s) 41291725 reads processed; of these: 18371 ( 0.04%) short reads filtered out after trimming by size control 60993 ( 0.15%) empty reads filtered out after trimming by size control 41212361 (99.81%) reads available; of these: 1308748 ( 3.18%) trimmed reads available after processing 39903613 (96.82%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2203 0.01% 19 2544 0.01% 20 2950 0.01% 21 3506 0.01% 22 4402 0.01% 23 5243 0.01% 24 6634 0.02% 25 8002 0.02% 26 7719 0.02% 27 7527 0.02% 28 7382 0.02% 29 6921 0.02% 30 7086 0.02% 31 7223 0.02% 32 7371 0.02% 33 7798 0.02% 34 8220 0.02% 35 9174 0.02% 36 9896 0.02% 37 11087 0.03% 38 12961 0.03% 39 14985 0.04% 40 16709 0.04% 41 18987 0.05% 42 22244 0.05% 43 26883 0.07% 44 35043 0.09% 45 46349 0.11% 46 57017 0.14% 47 77614 0.19% 48 123251 0.30% 49 229249 0.56% 50 494568 1.20% 51 39903613 96.82% 41212361 reads passed initial QC criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=2.73 fanout-score-rank=16 prefix-density=1.02 prefix-fanout=2.2 sequence=CCTCGCAGCCGCAGGGACC criterion=fanout-score sequence-density=0.21 sequence-density-rank=15 fanout-score=14.15 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=4.9 sequence=GCAGCAGCAGCAACAGCAGCAGGGAAGGTACGAGAGGATCCGCGCCCGGGTGTCCGTCGGCTCAGCGTTCGTGGTGCCCCCGGGCCACCCGGTGGTGGAGATCGCGTCCTCCTCCCGCGGCGGCGGC Started job on | Dec 07 12:57:17 Started mapping on | Dec 07 12:57:17 Finished on | Dec 07 12:58:04 Mapping speed, Million of reads per hour | 3156.69 Number of input reads | 41212361 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 30622000 Uniquely mapped reads % | 74.30% Average mapped length | 50.68 Number of splices: Total | 3578915 Number of splices: Annotated (sjdb) | 3440410 Number of splices: GT/AG | 3536283 Number of splices: GC/AG | 33345 Number of splices: AT/AC | 1801 Number of splices: Non-canonical | 7486 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.00% Deletion average length | 1.32 Insertion rate per base | 0.00% Insertion average length | 1.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 7433344 % of reads mapped to multiple loci | 18.04% Number of reads mapped to too many loci | 2798697 % of reads mapped to too many loci | 6.79% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.45% % of reads unmapped: other | 0.42% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3157017 3157017 3157017 N_multimapping 7433344 7433344 7433344 N_noFeature 952963 15584198 15671086 N_ambiguous 342932 13019 12165 UnstrandedReadsAssigned:29326105 PositiveStrandReadsAssigned:15024783 NegativeStrandReadsAssigned:14938749 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 ERR3079471 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR3079471-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 41,212,361 reads, 34,669,994 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,146 rounds 52973 ERR3079471.ke.tsv 35125 ERR3079471.se.tsv 88098 total ==> ERR3079471.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0.0358807 0.00178805 PNS24247 1044 945 97.266 4.29313 PNS24249 1928 1829 235.223 5.36427 PNS24246 1044 945 97.266 4.29313 PNS24248 1044 945 97.266 4.29313 PNS24244 1471 1372 81.9434 2.49118 PNS24243 293 194 3 0.645007 KQK14069 1603 1504 2244.05 62.2343 KQK14071 474 375 863.942 96.0945 ==> ERR3079471.se.tsv <== BRADI_1g14170v3 3578 BRADI_1g53295v3 441 BRADI_1g59795v3 309 BRADI_1g07683v3 0 BRADI_1g00485v3 19 BRADI_1g20270v3 712 BRADI_1g74790v3 73 BRADI_1g09890v3 6 BRADI_1g77505v3 378 BRADI_1g48960v3 8 ERR3079471 completed mapping pipeline successfully