Starting /dee2/code/volunteer_pipeline.sh ERR3079472 current disk space = 1542995197952 free memory = 1601923608 ERR3079472 SRAfilesize be351fae4cfbaae7074e96888ee84e13 ERR3079472.sra ERR3079472.sra file validated ERR3079472 is single end ERR3079472 is conventional basespace ERR3079472 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3079472_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.7105 33.0 33.0 33.0 14.0 33.0 2 31.83525 33.0 33.0 33.0 27.0 33.0 3 32.046 33.0 33.0 33.0 27.0 33.0 4 32.2265 33.0 33.0 33.0 33.0 33.0 5 32.30525 33.0 33.0 33.0 33.0 33.0 6 35.96275 37.0 37.0 37.0 33.0 37.0 7 36.058 37.0 37.0 37.0 37.0 37.0 8 36.24275 37.0 37.0 37.0 37.0 37.0 9 36.267 37.0 37.0 37.0 37.0 37.0 10 36.31 37.0 37.0 37.0 37.0 37.0 11 36.2035 37.0 37.0 37.0 37.0 37.0 12 36.1605 37.0 37.0 37.0 37.0 37.0 13 36.2135 37.0 37.0 37.0 37.0 37.0 14 36.2125 37.0 37.0 37.0 37.0 37.0 15 36.28975 37.0 37.0 37.0 37.0 37.0 16 36.2855 37.0 37.0 37.0 37.0 37.0 17 36.26 37.0 37.0 37.0 37.0 37.0 18 36.19125 37.0 37.0 37.0 37.0 37.0 19 36.28175 37.0 37.0 37.0 37.0 37.0 20 36.275 37.0 37.0 37.0 37.0 37.0 21 36.232 37.0 37.0 37.0 37.0 37.0 22 36.17475 37.0 37.0 37.0 37.0 37.0 23 36.1535 37.0 37.0 37.0 37.0 37.0 24 36.1735 37.0 37.0 37.0 37.0 37.0 25 36.21 37.0 37.0 37.0 37.0 37.0 26 36.20675 37.0 37.0 37.0 37.0 37.0 27 36.1105 37.0 37.0 37.0 37.0 37.0 28 36.09425 37.0 37.0 37.0 37.0 37.0 29 36.1585 37.0 37.0 37.0 37.0 37.0 30 36.10875 37.0 37.0 37.0 37.0 37.0 31 35.99325 37.0 37.0 37.0 37.0 37.0 32 36.08075 37.0 37.0 37.0 37.0 37.0 33 36.117 37.0 37.0 37.0 37.0 37.0 34 36.09425 37.0 37.0 37.0 37.0 37.0 35 36.0955 37.0 37.0 37.0 37.0 37.0 36 36.07225 37.0 37.0 37.0 37.0 37.0 37 35.996 37.0 37.0 37.0 37.0 37.0 38 35.73025 37.0 37.0 37.0 33.0 37.0 39 35.9445 37.0 37.0 37.0 37.0 37.0 40 35.80375 37.0 37.0 37.0 37.0 37.0 41 35.9055 37.0 37.0 37.0 37.0 37.0 42 35.93475 37.0 37.0 37.0 37.0 37.0 43 35.925 37.0 37.0 37.0 37.0 37.0 44 35.821 37.0 37.0 37.0 37.0 37.0 45 35.4605 37.0 37.0 37.0 33.0 37.0 46 35.72025 37.0 37.0 37.0 37.0 37.0 47 35.8825 37.0 37.0 37.0 37.0 37.0 48 35.7925 37.0 37.0 37.0 37.0 37.0 49 35.56275 37.0 37.0 37.0 37.0 37.0 50 35.53675 37.0 37.0 37.0 37.0 37.0 51 35.064 37.0 37.0 37.0 33.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 1.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 1.0 12 1.0 13 0.0 14 1.0 15 1.0 16 2.0 17 2.0 18 2.0 19 4.0 20 3.0 21 0.0 22 2.0 23 8.0 24 6.0 25 5.0 26 9.0 27 20.0 28 18.0 29 34.0 30 47.0 31 52.0 32 77.0 33 109.0 34 163.0 35 552.0 36 2864.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.754510661563693 14.10606889010388 7.79114270092947 47.34827774740295 2 27.85 17.625 33.550000000000004 20.974999999999998 3 24.175 22.35 21.325 32.15 4 28.249999999999996 25.974999999999998 18.525 27.250000000000004 5 28.599999999999998 28.349999999999998 20.849999999999998 22.2 6 21.9 34.875 20.275000000000002 22.95 7 21.7 19.55 36.199999999999996 22.55 8 20.925 20.625 28.775000000000002 29.675 9 22.75 18.3 30.099999999999998 28.849999999999998 10 24.85 30.099999999999998 24.125 20.925 11 26.775 25.124999999999996 20.349999999999998 27.750000000000004 12 24.95 21.375 25.474999999999998 28.199999999999996 13 24.375 24.175 25.2 26.25 14 24.2 24.224999999999998 24.975 26.6 15 23.5 24.75 24.05 27.700000000000003 16 24.6 23.05 25.324999999999996 27.025 17 24.625 23.875 25.275 26.224999999999998 18 24.975 23.9 24.224999999999998 26.900000000000002 19 26.875 23.549999999999997 22.975 26.6 20 26.174999999999997 23.175 24.075 26.575 21 25.4 23.125 23.375 28.1 22 25.35 24.125 23.65 26.875 23 25.75 23.1 24.55 26.6 24 25.650000000000002 23.599999999999998 23.7 27.05 25 25.5 25.025 23.724999999999998 25.75 26 24.7 23.525 24.7 27.075 27 26.200000000000003 23.674999999999997 23.45 26.674999999999997 28 26.1 22.675 24.45 26.775 29 24.9 23.674999999999997 24.95 26.474999999999998 30 23.599999999999998 23.775 26.400000000000002 26.224999999999998 31 25.374999999999996 23.625 23.400000000000002 27.6 32 25.374999999999996 23.150000000000002 26.174999999999997 25.3 33 26.025 22.175 24.775 27.025 34 26.474999999999998 22.525000000000002 23.7 27.3 35 25.35 23.150000000000002 24.55 26.950000000000003 36 24.9 23.1 25.35 26.650000000000002 37 24.825 23.9 25.0 26.275 38 26.474999999999998 23.775 24.175 25.575 39 24.625 22.625 23.9 28.849999999999998 40 25.05 23.325000000000003 23.625 28.000000000000004 41 26.05 23.45 23.724999999999998 26.775 42 25.525 23.275000000000002 23.974999999999998 27.224999999999998 43 26.125 23.400000000000002 22.225 28.249999999999996 44 25.624999999999996 24.45 23.7 26.224999999999998 45 26.924999999999997 23.45 23.3 26.325 46 25.174999999999997 22.75 23.825 28.249999999999996 47 26.450000000000003 23.625 23.825 26.1 48 25.275 23.875 24.05 26.8 49 27.525 22.825 23.025000000000002 26.625 50 26.174999999999997 23.05 22.725 28.050000000000004 51 23.549999999999997 25.55 24.5 26.400000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 2.5 2 0.0 3 0.0 4 0.0 5 1.0 6 2.0 7 2.0 8 2.0 9 1.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 1.5 22 3.0 23 2.0 24 1.0 25 4.5 26 9.5 27 11.0 28 11.0 29 11.0 30 19.0 31 27.0 32 36.0 33 45.0 34 66.0 35 87.0 36 111.5 37 136.0 38 160.0 39 184.0 40 210.5 41 237.0 42 267.5 43 298.0 44 304.0 45 310.0 46 292.5 47 275.0 48 279.0 49 283.0 50 262.5 51 242.0 52 231.5 53 221.0 54 212.0 55 203.0 56 186.0 57 169.0 58 165.5 59 162.0 60 166.5 61 171.0 62 163.5 63 156.0 64 146.5 65 137.0 66 130.0 67 123.0 68 121.5 69 120.0 70 124.0 71 128.0 72 100.5 73 73.0 74 70.0 75 55.5 76 44.0 77 35.0 78 26.0 79 18.0 80 10.0 81 10.0 82 10.0 83 9.0 84 8.0 85 5.0 86 2.0 87 1.0 88 0.0 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.55 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.0 #Duplication Level Percentage of deduplicated Percentage of total 1 95.50531914893618 89.775 2 3.1914893617021276 6.0 3 0.9042553191489361 2.55 4 0.26595744680851063 1.0 5 0.07978723404255318 0.375 6 0.05319148936170213 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGAAATTCTGACCGTTGAGGCGTGCGATACTGCCAGCACGTGGGTTGTAT 6 0.15 No Hit CGGAGAGTGAAGGATACCAGTATATCGCTTTCAAGACCAACGCAAACTCCA 6 0.15 No Hit CACAAACACAAACACAAACACAAACACCAAAAGCAGTAGCCAACACCAGTC 5 0.125 No Hit CAAAACACAAAACACAACATCAAATTTAGTCCCAAGCAGCAGCCAAACACC 5 0.125 No Hit CTGGTATCCTTCACTCTCCGCCTTCTTTAAAACGACATAGTTTTGTGGTAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1999440 READS because READLEN < 1 Read 1999440 spots for ERR3079472.sra Written 1999440 spots for ERR3079472.sra Rejected 1999440 READS because READLEN < 1 Read 1999440 spots for ERR3079472.sra Written 1999440 spots for ERR3079472.sra Rejected 1999440 READS because READLEN < 1 Read 1999440 spots for ERR3079472.sra Written 1999440 spots for ERR3079472.sra Rejected 1999440 READS because READLEN < 1 Read 1999440 spots for ERR3079472.sra Written 1999440 spots for ERR3079472.sra Rejected 1999440 READS because READLEN < 1 Read 1999440 spots for ERR3079472.sra Written 1999440 spots for ERR3079472.sra Rejected 1999440 READS because READLEN < 1 Read 1999440 spots for ERR3079472.sra Written 1999440 spots for ERR3079472.sra Rejected 1999440 READS because READLEN < 1 Read 1999440 spots for ERR3079472.sra Written 1999440 spots for ERR3079472.sra Rejected 1999450 READS because READLEN < 1 Read 1999450 spots for ERR3079472.sra Written 1999450 spots for ERR3079472.sra Rejected 1999440 READS because READLEN < 1 Read 1999440 spots for ERR3079472.sra Written 1999440 spots for ERR3079472.sra Rejected 1999440 READS because READLEN < 1 Read 1999440 spots for ERR3079472.sra Written 1999440 spots for ERR3079472.sra Rejected 1999440 READS because READLEN < 1 Read 1999440 spots for ERR3079472.sra Written 1999440 spots for ERR3079472.sra Rejected 1999440 READS because READLEN < 1 Read 1999440 spots for ERR3079472.sra Written 1999440 spots for ERR3079472.sra Rejected 1999440 READS because READLEN < 1 Read 1999440 spots for ERR3079472.sra Written 1999440 spots for ERR3079472.sra Rejected 1999440 READS because READLEN < 1 Read 1999440 spots for ERR3079472.sra Written 1999440 spots for ERR3079472.sra Rejected 1999440 READS because READLEN < 1 Read 1999440 spots for ERR3079472.sra Written 1999440 spots for ERR3079472.sra Rejected 1999440 READS because READLEN < 1 Read 1999440 spots for ERR3079472.sra Written 1999440 spots for ERR3079472.sra Rejected 1999440 READS because READLEN < 1 Read 1999440 spots for ERR3079472.sra Written 1999440 spots for ERR3079472.sra Rejected 1999440 READS because READLEN < 1 Read 1999440 spots for ERR3079472.sra Written 1999440 spots for ERR3079472.sra Rejected 1999440 READS because READLEN < 1 Read 1999440 spots for ERR3079472.sra Written 1999440 spots for ERR3079472.sra Rejected 1999440 READS because READLEN < 1 Read 1999440 spots for ERR3079472.sra Written 1999440 spots for ERR3079472.sra SRR ids: ['ERR3079472.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gd4mmgh0 ERR3079472.sra spots: 39988810 blocks: [[1, 1999440], [1999441, 3998880], [3998881, 5998320], [5998321, 7997760], [7997761, 9997200], [9997201, 11996640], [11996641, 13996080], [13996081, 15995520], [15995521, 17994960], [17994961, 19994400], [19994401, 21993840], [21993841, 23993280], [23993281, 25992720], [25992721, 27992160], [27992161, 29991600], [29991601, 31991040], [31991041, 33990480], [33990481, 35989920], [35989921, 37989360], [37989361, 39988810]] ERR3079472 file size 5679829 ERR3079472 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3079472 ERR3079472_1.fastq Input file: ERR3079472_1.fastq trimmed: ERR3079472-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:59:00 2024 >> started Sat Dec 7 12:59:20 2024 >> done (20.194s) 39988810 reads processed; of these: 30805 ( 0.08%) short reads filtered out after trimming by size control 97310 ( 0.24%) empty reads filtered out after trimming by size control 39860695 (99.68%) reads available; of these: 1389788 ( 3.49%) trimmed reads available after processing 38470907 (96.51%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2761 0.01% 19 3001 0.01% 20 3439 0.01% 21 3947 0.01% 22 4697 0.01% 23 5594 0.01% 24 7209 0.02% 25 8499 0.02% 26 8181 0.02% 27 7982 0.02% 28 7967 0.02% 29 7613 0.02% 30 7778 0.02% 31 7866 0.02% 32 8062 0.02% 33 8571 0.02% 34 9098 0.02% 35 9967 0.03% 36 11183 0.03% 37 12213 0.03% 38 13965 0.04% 39 16093 0.04% 40 18121 0.05% 41 20594 0.05% 42 23955 0.06% 43 29614 0.07% 44 37549 0.09% 45 49047 0.12% 46 60515 0.15% 47 81885 0.21% 48 131330 0.33% 49 242713 0.61% 50 518779 1.30% 51 38470907 96.51% 39860695 reads passed initial QC criterion=sequence-density sequence-density=1.04 sequence-density-rank=1 fanout-score=2.66 fanout-score-rank=14 prefix-density=1.25 prefix-fanout=2.2 sequence=CCTCGCAGCCGCAGGGACC criterion=fanout-score sequence-density=0.29 sequence-density-rank=16 fanout-score=12.51 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=4.3 sequence=GCTGCTGCTGCTCGGGCCCGGGGAGGAAGCCTTTTTTCTTCTGGTTGCCCCTGACCATCTCGTCCACGGCCCTGGCGTCGCCGAAGGCCAGGTCCTTGGAGATCCTGTCGAGCTGGCTGAACACGTTGTTGGCTCCGGCGAGGTACACCCTGTCGTTCTTCTCGGCGCGGATCTCGAAGCAGGCGATCTGGAGGTTGTTGTTGTCGTCGCCGCCGCCG Started job on | Dec 07 12:59:31 Started mapping on | Dec 07 12:59:31 Finished on | Dec 07 13:00:14 Mapping speed, Million of reads per hour | 3337.17 Number of input reads | 39860695 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 30853007 Uniquely mapped reads % | 77.40% Average mapped length | 50.67 Number of splices: Total | 3566916 Number of splices: Annotated (sjdb) | 3427815 Number of splices: GT/AG | 3526078 Number of splices: GC/AG | 31836 Number of splices: AT/AC | 1734 Number of splices: Non-canonical | 7268 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.00% Deletion average length | 1.33 Insertion rate per base | 0.00% Insertion average length | 1.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 7012762 % of reads mapped to multiple loci | 17.59% Number of reads mapped to too many loci | 1744100 % of reads mapped to too many loci | 4.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.35% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1994926 1994926 1994926 N_multimapping 7012762 7012762 7012762 N_noFeature 1037702 15786848 15839974 N_ambiguous 285031 11685 11299 UnstrandedReadsAssigned:29530274 PositiveStrandReadsAssigned:15054474 NegativeStrandReadsAssigned:15001734 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 ERR3079472 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR3079472-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 39,860,695 reads, 34,454,578 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,224 rounds 52973 ERR3079472.ke.tsv 35125 ERR3079472.se.tsv 88098 total ==> ERR3079472.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 68.3716 3.08796 PNS24249 1928 1829 353.792 8.25586 PNS24246 1044 945 68.3716 3.08796 PNS24248 1044 945 68.3716 3.08796 PNS24244 1471 1372 19.0929 0.593944 PNS24243 293 194 10 2.20002 KQK14069 1603 1504 1481.47 42.0408 KQK14071 474 375 577.964 65.7805 ==> ERR3079472.se.tsv <== BRADI_1g14170v3 2451 BRADI_1g53295v3 664 BRADI_1g59795v3 276 BRADI_1g07683v3 2 BRADI_1g00485v3 35 BRADI_1g20270v3 514 BRADI_1g74790v3 51 BRADI_1g09890v3 8 BRADI_1g77505v3 281 BRADI_1g48960v3 1 ERR3079472 completed mapping pipeline successfully