Starting /dee2/code/volunteer_pipeline.sh ERR3079473 current disk space = 1543045976064 free memory = 1598434464 ERR3079473 SRAfilesize 807a25b456bf03938ee71c4e61037c1f ERR3079473.sra ERR3079473.sra file validated ERR3079473 is single end ERR3079473 is conventional basespace ERR3079473 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3079473_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.74025 33.0 33.0 33.0 14.0 33.0 2 31.95925 33.0 33.0 33.0 27.0 33.0 3 32.1025 33.0 33.0 33.0 33.0 33.0 4 32.469 33.0 33.0 33.0 33.0 33.0 5 32.43375 33.0 33.0 33.0 33.0 33.0 6 36.256 37.0 37.0 37.0 37.0 37.0 7 36.29225 37.0 37.0 37.0 37.0 37.0 8 36.47075 37.0 37.0 37.0 37.0 37.0 9 36.46075 37.0 37.0 37.0 37.0 37.0 10 36.518 37.0 37.0 37.0 37.0 37.0 11 36.5485 37.0 37.0 37.0 37.0 37.0 12 36.40175 37.0 37.0 37.0 37.0 37.0 13 36.4975 37.0 37.0 37.0 37.0 37.0 14 36.49 37.0 37.0 37.0 37.0 37.0 15 36.45275 37.0 37.0 37.0 37.0 37.0 16 36.43425 37.0 37.0 37.0 37.0 37.0 17 36.393 37.0 37.0 37.0 37.0 37.0 18 36.38825 37.0 37.0 37.0 37.0 37.0 19 36.378 37.0 37.0 37.0 37.0 37.0 20 36.396 37.0 37.0 37.0 37.0 37.0 21 36.40775 37.0 37.0 37.0 37.0 37.0 22 36.413 37.0 37.0 37.0 37.0 37.0 23 36.39775 37.0 37.0 37.0 37.0 37.0 24 36.4495 37.0 37.0 37.0 37.0 37.0 25 36.40575 37.0 37.0 37.0 37.0 37.0 26 36.413 37.0 37.0 37.0 37.0 37.0 27 36.3205 37.0 37.0 37.0 37.0 37.0 28 36.39675 37.0 37.0 37.0 37.0 37.0 29 36.27975 37.0 37.0 37.0 37.0 37.0 30 36.3205 37.0 37.0 37.0 37.0 37.0 31 36.25625 37.0 37.0 37.0 37.0 37.0 32 36.319 37.0 37.0 37.0 37.0 37.0 33 36.38575 37.0 37.0 37.0 37.0 37.0 34 36.34925 37.0 37.0 37.0 37.0 37.0 35 36.32675 37.0 37.0 37.0 37.0 37.0 36 36.222 37.0 37.0 37.0 37.0 37.0 37 36.268 37.0 37.0 37.0 37.0 37.0 38 36.07575 37.0 37.0 37.0 37.0 37.0 39 36.1195 37.0 37.0 37.0 37.0 37.0 40 36.24625 37.0 37.0 37.0 37.0 37.0 41 36.28225 37.0 37.0 37.0 37.0 37.0 42 36.289 37.0 37.0 37.0 37.0 37.0 43 36.2055 37.0 37.0 37.0 37.0 37.0 44 36.214 37.0 37.0 37.0 37.0 37.0 45 35.70325 37.0 37.0 37.0 37.0 37.0 46 36.08325 37.0 37.0 37.0 37.0 37.0 47 35.9845 37.0 37.0 37.0 37.0 37.0 48 35.95025 37.0 37.0 37.0 37.0 37.0 49 35.86675 37.0 37.0 37.0 37.0 37.0 50 35.78425 37.0 37.0 37.0 37.0 37.0 51 35.142 37.0 37.0 37.0 33.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 3.0 19 1.0 20 1.0 21 2.0 22 6.0 23 4.0 24 10.0 25 5.0 26 12.0 27 14.0 28 19.0 29 29.0 30 35.0 31 48.0 32 79.0 33 83.0 34 156.0 35 543.0 36 2949.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.734173746231846 14.68895587832283 7.645930391888188 47.93093998355714 2 27.875 17.224999999999998 32.95 21.95 3 23.825 22.775000000000002 21.975 31.424999999999997 4 28.599999999999998 25.825 18.15 27.425 5 28.499999999999996 30.025000000000002 20.349999999999998 21.125 6 22.8 35.0 20.849999999999998 21.349999999999998 7 21.575 20.025000000000002 34.25 24.15 8 21.5 21.45 27.275 29.775000000000002 9 23.175 19.075 30.525000000000002 27.224999999999998 10 23.65 31.624999999999996 23.65 21.075 11 27.075 24.4 20.200000000000003 28.325 12 26.375 21.3 24.025 28.299999999999997 13 24.4 24.349999999999998 25.0 26.25 14 24.7 24.55 24.575 26.174999999999997 15 25.074999999999996 23.325000000000003 24.325 27.275 16 25.15 23.425 23.799999999999997 27.625 17 26.25 23.625 23.325000000000003 26.8 18 26.125 25.15 24.175 24.55 19 26.424999999999997 23.525 23.025000000000002 27.025 20 27.425 23.375 23.3 25.900000000000002 21 25.55 24.099999999999998 23.674999999999997 26.674999999999997 22 26.025 24.4 22.575 27.0 23 25.35 23.974999999999998 23.65 27.025 24 25.025 22.6 25.324999999999996 27.05 25 24.75 24.125 23.925 27.200000000000003 26 25.474999999999998 23.45 24.4 26.674999999999997 27 25.650000000000002 23.724999999999998 24.55 26.075 28 25.35 23.575 22.825 28.249999999999996 29 25.825 24.85 23.325000000000003 26.0 30 24.55 23.125 25.074999999999996 27.250000000000004 31 24.474999999999998 24.25 23.150000000000002 28.125 32 25.85 25.224999999999998 22.575 26.35 33 24.925 23.625 23.375 28.075 34 25.7 23.674999999999997 23.1 27.525 35 25.85 24.725 23.95 25.474999999999998 36 24.9 24.099999999999998 23.175 27.825 37 24.85 24.6 23.625 26.924999999999997 38 26.1 23.925 23.150000000000002 26.825 39 24.825 23.925 23.325000000000003 27.925 40 24.85 22.75 24.275 28.125 41 25.575 23.825 23.575 27.025 42 26.55 23.325000000000003 23.400000000000002 26.724999999999998 43 26.224999999999998 23.35 23.1 27.325 44 25.974999999999998 21.825 25.05 27.150000000000002 45 24.349999999999998 24.375 23.425 27.85 46 26.05 22.075 24.875 27.0 47 25.7 24.025 23.400000000000002 26.875 48 24.975 22.25 23.9 28.875 49 26.05 23.150000000000002 23.225 27.575 50 26.474999999999998 22.0 23.575 27.950000000000003 51 25.1 22.25 25.5 27.150000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 3.0 2 2.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.0 25 2.5 26 6.5 27 10.0 28 15.5 29 21.0 30 27.0 31 33.0 32 40.0 33 47.0 34 64.5 35 82.0 36 110.5 37 139.0 38 156.5 39 174.0 40 188.5 41 203.0 42 247.5 43 292.0 44 289.0 45 286.0 46 289.0 47 292.0 48 292.0 49 292.0 50 283.5 51 275.0 52 250.0 53 225.0 54 213.0 55 201.0 56 184.5 57 168.0 58 169.5 59 171.0 60 167.0 61 163.0 62 156.0 63 149.0 64 138.5 65 128.0 66 132.5 67 137.0 68 128.5 69 120.0 70 116.5 71 113.0 72 102.0 73 91.0 74 81.5 75 57.5 76 43.0 77 37.0 78 31.0 79 24.5 80 18.0 81 13.0 82 8.0 83 6.0 84 4.0 85 2.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.774999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.55 #Duplication Level Percentage of deduplicated Percentage of total 1 95.63722897937599 90.425 2 3.3315705975674246 6.3 3 0.74034902168165 2.1 4 0.23796932839767318 0.8999999999999999 5 0.026441036488630353 0.125 6 0.026441036488630353 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATGGACTTCAATTTCTGACGCCCGTCGTCACCCAACAACAGCAGAAACAAC 6 0.15 No Hit CTTTATTTCACCCTAATAGTTATCATACTAACTCATTCACTCCTGTGCCTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1923240 READS because READLEN < 1 Read 1923240 spots for ERR3079473.sra Written 1923240 spots for ERR3079473.sra Rejected 1923240 READS because READLEN < 1 Read 1923240 spots for ERR3079473.sra Written 1923240 spots for ERR3079473.sra Rejected 1923240 READS because READLEN < 1 Read 1923240 spots for ERR3079473.sra Written 1923240 spots for ERR3079473.sra Rejected 1923240 READS because READLEN < 1 Read 1923240 spots for ERR3079473.sra Written 1923240 spots for ERR3079473.sra Rejected 1923240 READS because READLEN < 1 Rejected 1923240 READS because READLEN < 1 Read 1923240 spots for ERR3079473.sra Written 1923240 spots for ERR3079473.sra Read 1923240 spots for ERR3079473.sra Written 1923240 spots for ERR3079473.sra Rejected 1923240 READS because READLEN < 1 Read 1923240 spots for ERR3079473.sra Written 1923240 spots for ERR3079473.sra Rejected 1923240 READS because READLEN < 1 Read 1923240 spots for ERR3079473.sra Written 1923240 spots for ERR3079473.sra Rejected 1923240 READS because READLEN < 1 Read 1923240 spots for ERR3079473.sra Written 1923240 spots for ERR3079473.sra Rejected 1923240 READS because READLEN < 1 Read 1923240 spots for ERR3079473.sra Written 1923240 spots for ERR3079473.sra Rejected 1923240 READS because READLEN < 1 Read 1923240 spots for ERR3079473.sra Written 1923240 spots for ERR3079473.sra Rejected 1923240 READS because READLEN < 1 Read 1923240 spots for ERR3079473.sra Written 1923240 spots for ERR3079473.sra Rejected 1923240 READS because READLEN < 1 Read 1923240 spots for ERR3079473.sra Written 1923240 spots for ERR3079473.sra Rejected 1923240 READS because READLEN < 1 Read 1923240 spots for ERR3079473.sra Written 1923240 spots for ERR3079473.sra Rejected 1923240 READS because READLEN < 1 Read 1923240 spots for ERR3079473.sra Written 1923240 spots for ERR3079473.sra Rejected 1923240 READS because READLEN < 1 Read 1923240 spots for ERR3079473.sra Written 1923240 spots for ERR3079473.sra Rejected 1923240 READS because READLEN < 1 Read 1923240 spots for ERR3079473.sra Written 1923240 spots for ERR3079473.sra Rejected 1923249 READS because READLEN < 1 Read 1923249 spots for ERR3079473.sra Written 1923249 spots for ERR3079473.sra Rejected 1923240 READS because READLEN < 1 Read 1923240 spots for ERR3079473.sra Written 1923240 spots for ERR3079473.sra Rejected 1923240 READS because READLEN < 1 Read 1923240 spots for ERR3079473.sra Written 1923240 spots for ERR3079473.sra SRR ids: ['ERR3079473.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2ii_hscp ERR3079473.sra spots: 38464809 blocks: [[1, 1923240], [1923241, 3846480], [3846481, 5769720], [5769721, 7692960], [7692961, 9616200], [9616201, 11539440], [11539441, 13462680], [13462681, 15385920], [15385921, 17309160], [17309161, 19232400], [19232401, 21155640], [21155641, 23078880], [23078881, 25002120], [25002121, 26925360], [26925361, 28848600], [28848601, 30771840], [30771841, 32695080], [32695081, 34618320], [34618321, 36541560], [36541561, 38464809]] ERR3079473 file size 5462539 ERR3079473 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3079473 ERR3079473_1.fastq Input file: ERR3079473_1.fastq trimmed: ERR3079473-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 13:07:35 2024 >> started Sat Dec 7 13:07:53 2024 >> done (18.007s) 38464809 reads processed; of these: 16964 ( 0.04%) short reads filtered out after trimming by size control 56397 ( 0.15%) empty reads filtered out after trimming by size control 38391448 (99.81%) reads available; of these: 1210528 ( 3.15%) trimmed reads available after processing 37180920 (96.85%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2073 0.01% 19 2243 0.01% 20 2705 0.01% 21 3129 0.01% 22 3884 0.01% 23 4904 0.01% 24 6445 0.02% 25 7501 0.02% 26 7266 0.02% 27 7191 0.02% 28 6891 0.02% 29 6606 0.02% 30 6536 0.02% 31 6861 0.02% 32 6796 0.02% 33 7395 0.02% 34 7771 0.02% 35 8352 0.02% 36 9249 0.02% 37 10410 0.03% 38 11831 0.03% 39 13660 0.04% 40 15455 0.04% 41 17583 0.05% 42 20286 0.05% 43 25098 0.07% 44 32156 0.08% 45 42553 0.11% 46 52599 0.14% 47 71594 0.19% 48 113718 0.30% 49 211785 0.55% 50 458002 1.19% 51 37180920 96.85% 38391448 reads passed initial QC criterion=sequence-density sequence-density=0.88 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=15 prefix-density=1.08 prefix-fanout=2.3 sequence=CCTCGCAGCCGCAGGGACC criterion=fanout-score sequence-density=0.17 sequence-density-rank=22 fanout-score=35.84 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=10.6 sequence=CGCCGCCGCGGCCGCCGCGGCGCCTCTCTCCCTCCTCGCCCTGCTGCTCCTGCTGCTGCT Started job on | Dec 07 13:08:02 Started mapping on | Dec 07 13:08:03 Finished on | Dec 07 13:08:42 Mapping speed, Million of reads per hour | 3543.83 Number of input reads | 38391448 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 29281527 Uniquely mapped reads % | 76.27% Average mapped length | 50.69 Number of splices: Total | 3384057 Number of splices: Annotated (sjdb) | 3251412 Number of splices: GT/AG | 3344574 Number of splices: GC/AG | 31504 Number of splices: AT/AC | 1673 Number of splices: Non-canonical | 6306 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.00% Deletion average length | 1.32 Insertion rate per base | 0.00% Insertion average length | 1.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 6693050 % of reads mapped to multiple loci | 17.43% Number of reads mapped to too many loci | 2124997 % of reads mapped to too many loci | 5.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.42% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2416871 2416871 2416871 N_multimapping 6693050 6693050 6693050 N_noFeature 1026788 14972887 15085647 N_ambiguous 270733 11706 11062 UnstrandedReadsAssigned:27984006 PositiveStrandReadsAssigned:14296934 NegativeStrandReadsAssigned:14184818 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 ERR3079473 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR3079473-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,391,448 reads, 32,730,145 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,108 rounds 52973 ERR3079473.ke.tsv 35125 ERR3079473.se.tsv 88098 total ==> ERR3079473.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 69.7246 3.29826 PNS24249 1928 1829 291.046 7.11341 PNS24246 1044 945 69.7246 3.29826 PNS24248 1044 945 69.7246 3.29826 PNS24244 1471 1372 76.7804 2.50165 PNS24243 293 194 7 1.61297 KQK14069 1603 1504 1399.32 41.5911 KQK14071 474 375 441.871 52.6738 ==> ERR3079473.se.tsv <== BRADI_1g14170v3 2142 BRADI_1g53295v3 647 BRADI_1g59795v3 303 BRADI_1g07683v3 0 BRADI_1g00485v3 43 BRADI_1g20270v3 536 BRADI_1g74790v3 49 BRADI_1g09890v3 10 BRADI_1g77505v3 300 BRADI_1g48960v3 7 ERR3079473 completed mapping pipeline successfully