Starting /dee2/code/volunteer_pipeline.sh ERR3079474 current disk space = 1543242280960 free memory = 1599799284 ERR3079474 SRAfilesize acdf35ff843d27010268a09351c595d3 ERR3079474.sra ERR3079474.sra file validated ERR3079474 is single end ERR3079474 is conventional basespace ERR3079474 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3079474_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.66775 33.0 14.0 33.0 2.0 33.0 2 30.29 33.0 27.0 33.0 27.0 33.0 3 31.445 33.0 33.0 33.0 27.0 33.0 4 32.0925 33.0 33.0 33.0 27.0 33.0 5 32.46025 33.0 33.0 33.0 33.0 33.0 6 36.12075 37.0 37.0 37.0 33.0 37.0 7 36.46425 37.0 37.0 37.0 37.0 37.0 8 36.51225 37.0 37.0 37.0 37.0 37.0 9 36.60725 37.0 37.0 37.0 37.0 37.0 10 36.6015 37.0 37.0 37.0 37.0 37.0 11 36.56075 37.0 37.0 37.0 37.0 37.0 12 36.59475 37.0 37.0 37.0 37.0 37.0 13 36.5975 37.0 37.0 37.0 37.0 37.0 14 36.53725 37.0 37.0 37.0 37.0 37.0 15 36.668 37.0 37.0 37.0 37.0 37.0 16 36.418 37.0 37.0 37.0 37.0 37.0 17 36.521 37.0 37.0 37.0 37.0 37.0 18 36.54875 37.0 37.0 37.0 37.0 37.0 19 36.608 37.0 37.0 37.0 37.0 37.0 20 36.5375 37.0 37.0 37.0 37.0 37.0 21 36.49825 37.0 37.0 37.0 37.0 37.0 22 36.5185 37.0 37.0 37.0 37.0 37.0 23 36.527 37.0 37.0 37.0 37.0 37.0 24 36.54725 37.0 37.0 37.0 37.0 37.0 25 36.521 37.0 37.0 37.0 37.0 37.0 26 36.54925 37.0 37.0 37.0 37.0 37.0 27 36.50625 37.0 37.0 37.0 37.0 37.0 28 36.555 37.0 37.0 37.0 37.0 37.0 29 36.527 37.0 37.0 37.0 37.0 37.0 30 36.52625 37.0 37.0 37.0 37.0 37.0 31 36.51775 37.0 37.0 37.0 37.0 37.0 32 36.603 37.0 37.0 37.0 37.0 37.0 33 36.498 37.0 37.0 37.0 37.0 37.0 34 36.491 37.0 37.0 37.0 37.0 37.0 35 36.4575 37.0 37.0 37.0 37.0 37.0 36 36.50375 37.0 37.0 37.0 37.0 37.0 37 36.509 37.0 37.0 37.0 37.0 37.0 38 36.561 37.0 37.0 37.0 37.0 37.0 39 36.46575 37.0 37.0 37.0 37.0 37.0 40 36.47125 37.0 37.0 37.0 37.0 37.0 41 36.52475 37.0 37.0 37.0 37.0 37.0 42 36.45175 37.0 37.0 37.0 37.0 37.0 43 36.468 37.0 37.0 37.0 37.0 37.0 44 36.5155 37.0 37.0 37.0 37.0 37.0 45 36.53425 37.0 37.0 37.0 37.0 37.0 46 36.4625 37.0 37.0 37.0 37.0 37.0 47 36.43875 37.0 37.0 37.0 37.0 37.0 48 36.44775 37.0 37.0 37.0 37.0 37.0 49 36.39 37.0 37.0 37.0 37.0 37.0 50 36.3975 37.0 37.0 37.0 37.0 37.0 51 36.4275 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 0.0 23 1.0 24 1.0 25 7.0 26 5.0 27 15.0 28 11.0 29 16.0 30 29.0 31 34.0 32 67.0 33 77.0 34 167.0 35 951.0 36 2617.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.499999999999996 15.09375 5.9375 50.46874999999999 2 26.174999999999997 15.525 35.75 22.55 3 23.625 20.65 21.725 34.0 4 28.1 24.2 18.05 29.65 5 31.075000000000003 26.35 20.875 21.7 6 23.849999999999998 33.0 20.575 22.575 7 21.25 21.75 34.475 22.525000000000002 8 22.525000000000002 22.425 28.199999999999996 26.85 9 21.725 20.225 30.875000000000004 27.175 10 23.9 31.275 23.825 21.0 11 26.825 26.55 19.5 27.125 12 24.675 21.6 25.674999999999997 28.050000000000004 13 24.15 24.05 26.1 25.7 14 23.9 24.275 25.424999999999997 26.400000000000002 15 24.525 24.625 24.825 26.025 16 24.65 24.375 23.65 27.325 17 25.525 24.75 22.975 26.75 18 24.075 25.324999999999996 24.075 26.525 19 27.55 23.625 23.425 25.4 20 26.474999999999998 23.275000000000002 23.724999999999998 26.525 21 25.0 24.7 23.95 26.35 22 25.674999999999997 24.025 23.225 27.075 23 26.575 24.224999999999998 24.224999999999998 24.975 24 24.480600750938674 24.63078848560701 23.92991239048811 26.958698372966204 25 25.724999999999998 23.95 23.35 26.974999999999998 26 25.650000000000002 24.95 22.725 26.674999999999997 27 24.217380415727526 26.321061858251944 23.716503881793138 25.7450538442274 28 25.444083062296723 23.417563172379285 24.44333249937453 26.695021265949464 29 26.650000000000002 23.9 23.1 26.35 30 25.66992236413724 23.56624092161282 23.741547708489858 27.02228900576008 31 26.674999999999997 22.475 23.799999999999997 27.05 32 25.924999999999997 24.65 24.275 25.15 33 25.55 24.625 23.05 26.775 34 25.0 23.95 24.099999999999998 26.950000000000003 35 25.720010017530683 24.3175557225144 24.06711745554721 25.895316804407713 36 25.3 23.375 23.95 27.375 37 25.224999999999998 23.474999999999998 23.325000000000003 27.975 38 26.106526631657918 24.18104526131533 24.15603900975244 25.55638909727432 39 25.45 24.275 23.5 26.775 40 26.700000000000003 24.55 22.650000000000002 26.1 41 27.400000000000002 23.200000000000003 23.474999999999998 25.924999999999997 42 25.15 23.325000000000003 24.925 26.6 43 27.025 23.9 22.875 26.200000000000003 44 26.55 24.099999999999998 23.625 25.724999999999998 45 25.05 23.95 24.525 26.474999999999998 46 25.525 24.75 24.375 25.35 47 26.525 23.549999999999997 23.525 26.400000000000002 48 25.525 25.074999999999996 23.474999999999998 25.924999999999997 49 25.624999999999996 23.875 23.549999999999997 26.950000000000003 50 26.450000000000003 24.2 22.85 26.5 51 26.1 23.724999999999998 24.15 26.025 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 1.0 24 1.0 25 5.0 26 12.5 27 16.0 28 18.5 29 21.0 30 33.0 31 45.0 32 53.5 33 62.0 34 78.5 35 95.0 36 121.5 37 148.0 38 173.5 39 199.0 40 214.0 41 229.0 42 250.5 43 272.0 44 273.0 45 274.0 46 280.5 47 287.0 48 278.0 49 269.0 50 276.0 51 283.0 52 259.5 53 236.0 54 223.0 55 210.0 56 202.5 57 195.0 58 187.0 59 179.0 60 164.5 61 150.0 62 139.0 63 128.0 64 123.0 65 118.0 66 110.5 67 103.0 68 104.5 69 106.0 70 95.0 71 84.0 72 85.0 73 86.0 74 77.0 75 59.5 76 51.0 77 44.0 78 37.0 79 27.0 80 17.0 81 13.0 82 9.0 83 7.5 84 6.0 85 4.0 86 2.0 87 2.5 88 3.0 89 1.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 20.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.125 25 0.0 26 0.0 27 0.17500000000000002 28 0.075 29 0.0 30 0.17500000000000002 31 0.0 32 0.0 33 0.0 34 0.0 35 0.17500000000000002 36 0.0 37 0.0 38 0.025 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19232710752145 98.25 2 0.6814740030287734 1.35 3 0.10095911155981827 0.3 4 0.025239777889954566 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 2122892 READS because READLEN < 1 Read 2122892 spots for ERR3079474.sra Written 2122892 spots for ERR3079474.sra Rejected 2122892 READS because READLEN < 1 Read 2122892 spots for ERR3079474.sra Written 2122892 spots for ERR3079474.sra Rejected 2122892 READS because READLEN < 1 Read 2122892 spots for ERR3079474.sra Written 2122892 spots for ERR3079474.sra Rejected 2122892 READS because READLEN < 1 Read 2122892 spots for ERR3079474.sra Written 2122892 spots for ERR3079474.sra Rejected 2122892 READS because READLEN < 1 Read 2122892 spots for ERR3079474.sra Written 2122892 spots for ERR3079474.sra Rejected 2122892 READS because READLEN < 1 Read 2122892 spots for ERR3079474.sra Written 2122892 spots for ERR3079474.sra Rejected 2122892 READS because READLEN < 1 Read 2122892 spots for ERR3079474.sra Written 2122892 spots for ERR3079474.sra Rejected 2122892 READS because READLEN < 1 Read 2122892 spots for ERR3079474.sra Written 2122892 spots for ERR3079474.sra Rejected 2122892 READS because READLEN < 1 Read 2122892 spots for ERR3079474.sra Written 2122892 spots for ERR3079474.sra Rejected 2122896 READS because READLEN < 1 Read 2122896 spots for ERR3079474.sra Written 2122896 spots for ERR3079474.sra Rejected 2122892 READS because READLEN < 1 Read 2122892 spots for ERR3079474.sra Written 2122892 spots for ERR3079474.sra Rejected 2122892 READS because READLEN < 1 Read 2122892 spots for ERR3079474.sra Written 2122892 spots for ERR3079474.sra Rejected 2122892 READS because READLEN < 1 Read 2122892 spots for ERR3079474.sra Written 2122892 spots for ERR3079474.sra Rejected 2122892 READS because READLEN < 1 Read 2122892 spots for ERR3079474.sra Written 2122892 spots for ERR3079474.sra Rejected 2122892 READS because READLEN < 1 Read 2122892 spots for ERR3079474.sra Written 2122892 spots for ERR3079474.sra Rejected 2122892 READS because READLEN < 1 Read 2122892 spots for ERR3079474.sra Written 2122892 spots for ERR3079474.sra Rejected 2122892 READS because READLEN < 1 Read 2122892 spots for ERR3079474.sra Written 2122892 spots for ERR3079474.sra Rejected 2122892 READS because READLEN < 1 Read 2122892 spots for ERR3079474.sra Written 2122892 spots for ERR3079474.sra Rejected 2122892 READS because READLEN < 1 Read 2122892 spots for ERR3079474.sra Written 2122892 spots for ERR3079474.sra Rejected 2122892 READS because READLEN < 1 Read 2122892 spots for ERR3079474.sra Written 2122892 spots for ERR3079474.sra SRR ids: ['ERR3079474.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bu7sak43 ERR3079474.sra spots: 42457844 blocks: [[1, 2122892], [2122893, 4245784], [4245785, 6368676], [6368677, 8491568], [8491569, 10614460], [10614461, 12737352], [12737353, 14860244], [14860245, 16983136], [16983137, 19106028], [19106029, 21228920], [21228921, 23351812], [23351813, 25474704], [25474705, 27597596], [27597597, 29720488], [29720489, 31843380], [31843381, 33966272], [33966273, 36089164], [36089165, 38212056], [38212057, 40334948], [40334949, 42457844]] ERR3079474 file size 6031859 ERR3079474 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3079474 ERR3079474_1.fastq Input file: ERR3079474_1.fastq trimmed: ERR3079474-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 13:10:50 2024 >> started Sat Dec 7 13:11:09 2024 >> done (18.872s) 42457844 reads processed; of these: 4825 ( 0.01%) short reads filtered out after trimming by size control 23603 ( 0.06%) empty reads filtered out after trimming by size control 42429416 (99.93%) reads available; of these: 54184 ( 0.13%) trimmed reads available after processing 42375232 (99.87%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 614 0.00% 19 561 0.00% 20 664 0.00% 21 770 0.00% 22 1027 0.00% 23 1343 0.00% 24 1768 0.00% 25 2166 0.01% 26 2141 0.01% 27 2142 0.01% 28 2071 0.00% 29 1776 0.00% 30 1620 0.00% 31 1671 0.00% 32 1609 0.00% 33 1559 0.00% 34 1674 0.00% 35 1606 0.00% 36 1727 0.00% 37 1503 0.00% 38 1681 0.00% 39 1671 0.00% 40 1713 0.00% 41 1786 0.00% 42 1699 0.00% 43 1822 0.00% 44 1822 0.00% 45 1781 0.00% 46 1895 0.00% 47 1996 0.00% 48 2036 0.00% 49 2087 0.00% 50 2183 0.01% 51 42375232 99.87% 42429416 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=114.53 fanout-score-rank=14 prefix-density=0.65 prefix-fanout=17.8 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=322.79 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=17.8 sequence=CGCCGCCGCCACC Started job on | Dec 07 13:11:20 Started mapping on | Dec 07 13:11:20 Finished on | Dec 07 13:12:14 Mapping speed, Million of reads per hour | 2828.63 Number of input reads | 42429416 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 35259858 Uniquely mapped reads % | 83.10% Average mapped length | 50.77 Number of splices: Total | 5459455 Number of splices: Annotated (sjdb) | 5223268 Number of splices: GT/AG | 5386610 Number of splices: GC/AG | 63758 Number of splices: AT/AC | 4194 Number of splices: Non-canonical | 4893 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.00% Deletion average length | 1.34 Insertion rate per base | 0.00% Insertion average length | 1.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1647188 % of reads mapped to multiple loci | 3.88% Number of reads mapped to too many loci | 5104043 % of reads mapped to too many loci | 12.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.68% % of reads unmapped: other | 0.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5522370 5522370 5522370 N_multimapping 1647188 1647188 1647188 N_noFeature 1554363 17969578 17934142 N_ambiguous 963091 30280 25920 UnstrandedReadsAssigned:32742404 PositiveStrandReadsAssigned:17260000 NegativeStrandReadsAssigned:17299796 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 ERR3079474 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR3079474-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 42,429,416 reads, 34,112,674 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,188 rounds 52973 ERR3079474.ke.tsv 35125 ERR3079474.se.tsv 88098 total ==> ERR3079474.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 177.566 10.3085 PNS24247 1044 945 46.6586 2.39917 PNS24249 1928 1829 446.709 11.8678 PNS24246 1044 945 46.6586 2.39917 PNS24248 1044 945 46.6586 2.39917 PNS24244 1471 1372 37.7494 1.33695 PNS24243 293 194 20 5.00943 KQK14069 1603 1504 1018.85 32.9171 KQK14071 474 375 415.496 53.8389 ==> ERR3079474.se.tsv <== BRADI_1g14170v3 1665 BRADI_1g53295v3 139 BRADI_1g59795v3 578 BRADI_1g07683v3 0 BRADI_1g00485v3 24 BRADI_1g20270v3 1895 BRADI_1g74790v3 52 BRADI_1g09890v3 26 BRADI_1g77505v3 669 BRADI_1g48960v3 0 ERR3079474 completed mapping pipeline successfully