Starting /dee2/code/volunteer_pipeline.sh ERR3079475 current disk space = 1543174094848 free memory = 1596451908 ERR3079475 SRAfilesize 5f191224dea411ac7852cd8bb1ebadab ERR3079475.sra ERR3079475.sra file validated ERR3079475 is single end ERR3079475 is conventional basespace ERR3079475 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3079475_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.06925 33.0 14.0 33.0 2.0 33.0 2 28.8615 33.0 27.0 33.0 14.0 33.0 3 30.8105 33.0 27.0 33.0 27.0 33.0 4 31.227 33.0 33.0 33.0 27.0 33.0 5 32.49925 33.0 33.0 33.0 33.0 33.0 6 35.838 37.0 37.0 37.0 33.0 37.0 7 36.35375 37.0 37.0 37.0 37.0 37.0 8 36.3975 37.0 37.0 37.0 37.0 37.0 9 36.58125 37.0 37.0 37.0 37.0 37.0 10 36.61575 37.0 37.0 37.0 37.0 37.0 11 36.618 37.0 37.0 37.0 37.0 37.0 12 36.6335 37.0 37.0 37.0 37.0 37.0 13 36.625 37.0 37.0 37.0 37.0 37.0 14 36.643 37.0 37.0 37.0 37.0 37.0 15 36.64225 37.0 37.0 37.0 37.0 37.0 16 36.43425 37.0 37.0 37.0 37.0 37.0 17 36.58175 37.0 37.0 37.0 37.0 37.0 18 36.56475 37.0 37.0 37.0 37.0 37.0 19 36.61375 37.0 37.0 37.0 37.0 37.0 20 36.58425 37.0 37.0 37.0 37.0 37.0 21 36.586 37.0 37.0 37.0 37.0 37.0 22 36.54175 37.0 37.0 37.0 37.0 37.0 23 36.5385 37.0 37.0 37.0 37.0 37.0 24 36.522 37.0 37.0 37.0 37.0 37.0 25 36.56825 37.0 37.0 37.0 37.0 37.0 26 36.572 37.0 37.0 37.0 37.0 37.0 27 36.46225 37.0 37.0 37.0 37.0 37.0 28 36.52675 37.0 37.0 37.0 37.0 37.0 29 36.52125 37.0 37.0 37.0 37.0 37.0 30 36.5435 37.0 37.0 37.0 37.0 37.0 31 36.511 37.0 37.0 37.0 37.0 37.0 32 36.58275 37.0 37.0 37.0 37.0 37.0 33 36.5305 37.0 37.0 37.0 37.0 37.0 34 36.575 37.0 37.0 37.0 37.0 37.0 35 36.429 37.0 37.0 37.0 37.0 37.0 36 36.536 37.0 37.0 37.0 37.0 37.0 37 36.52675 37.0 37.0 37.0 37.0 37.0 38 36.51575 37.0 37.0 37.0 37.0 37.0 39 36.51175 37.0 37.0 37.0 37.0 37.0 40 36.53725 37.0 37.0 37.0 37.0 37.0 41 36.561 37.0 37.0 37.0 37.0 37.0 42 36.466 37.0 37.0 37.0 37.0 37.0 43 36.47075 37.0 37.0 37.0 37.0 37.0 44 36.526 37.0 37.0 37.0 37.0 37.0 45 36.52675 37.0 37.0 37.0 37.0 37.0 46 36.512 37.0 37.0 37.0 37.0 37.0 47 36.43775 37.0 37.0 37.0 37.0 37.0 48 36.42625 37.0 37.0 37.0 37.0 37.0 49 36.483 37.0 37.0 37.0 37.0 37.0 50 36.41375 37.0 37.0 37.0 37.0 37.0 51 36.412 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 2.0 25 5.0 26 5.0 27 10.0 28 20.0 29 23.0 30 32.0 31 34.0 32 39.0 33 76.0 34 183.0 35 995.0 36 2574.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.820685613829475 14.942865514210371 5.596249633753296 55.640199238206854 2 25.224999999999998 16.0 35.925000000000004 22.85 3 24.4 20.974999999999998 20.549999999999997 34.075 4 27.85 24.775 18.475 28.9 5 29.725 27.575 20.8 21.9 6 25.025 32.775 20.349999999999998 21.85 7 23.75 20.599999999999998 33.75 21.9 8 21.275 22.375 29.425 26.924999999999997 9 22.725 19.725 31.775 25.775 10 23.925 31.35 22.15 22.575 11 26.8 23.525 20.9 28.775000000000002 12 24.4 22.275 24.7 28.625 13 24.349999999999998 24.925 25.324999999999996 25.4 14 25.05 23.95 24.275 26.724999999999998 15 25.05 25.124999999999996 22.925 26.900000000000002 16 25.900000000000002 23.474999999999998 23.775 26.85 17 25.0 24.224999999999998 24.2 26.575 18 24.7 23.825 24.8 26.674999999999997 19 26.35 24.175 23.200000000000003 26.275 20 26.05 23.525 23.799999999999997 26.625 21 25.224999999999998 23.95 24.8 26.025 22 25.8 25.424999999999997 23.275000000000002 25.5 23 25.3 24.8 23.9 26.0 24 25.331332833208304 25.6064016004001 23.43085771442861 25.63140785196299 25 26.424999999999997 24.025 22.45 27.1 26 24.8 23.925 25.275 26.0 27 26.169627220415308 23.91793845384038 24.49337002752064 25.41906429822367 28 25.78144536134033 23.20580145036259 24.58114528632158 26.431607901975497 29 25.924999999999997 23.625 23.3 27.150000000000002 30 25.544158118588946 24.44333249937453 24.568426319739807 25.444083062296723 31 26.974999999999998 23.3 22.85 26.875 32 26.625 24.575 23.175 25.624999999999996 33 25.531382845711427 24.006001500375092 22.980745186296573 27.481870467616904 34 25.05 23.5 23.825 27.625 35 25.31898924193145 24.26820115086315 23.91793845384038 26.494871153365025 36 25.724999999999998 23.775 24.45 26.05 37 25.874999999999996 25.1 22.55 26.474999999999998 38 25.95648912228057 25.35633908477119 23.13078269567392 25.55638909727432 39 26.18154538634659 23.53088272068017 22.705676419104776 27.581895473868467 40 26.05 23.9 24.2 25.85 41 26.331582895723933 23.95598899724931 23.63090772693173 26.081520380095025 42 25.35 23.925 24.375 26.35 43 26.450000000000003 23.825 23.0 26.724999999999998 44 27.275 23.200000000000003 23.075000000000003 26.450000000000003 45 25.55 24.45 23.025000000000002 26.974999999999998 46 26.55 23.724999999999998 23.775 25.95 47 26.275 24.85 23.325000000000003 25.55 48 25.55 24.05 23.724999999999998 26.674999999999997 49 25.874999999999996 23.45 23.400000000000002 27.275 50 25.674999999999997 24.7 23.425 26.200000000000003 51 25.775 23.375 23.75 27.1 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.0 24 0.0 25 4.0 26 7.0 27 6.0 28 19.5 29 33.0 30 41.0 31 49.0 32 50.5 33 52.0 34 71.0 35 90.0 36 113.5 37 137.0 38 165.0 39 193.0 40 213.5 41 234.0 42 240.5 43 247.0 44 271.5 45 296.0 46 290.5 47 285.0 48 292.0 49 299.0 50 273.5 51 248.0 52 241.5 53 235.0 54 223.0 55 211.0 56 197.5 57 184.0 58 192.5 59 201.0 60 176.0 61 151.0 62 138.0 63 125.0 64 115.5 65 106.0 66 113.0 67 120.0 68 124.0 69 128.0 70 101.0 71 74.0 72 78.5 73 83.0 74 74.0 75 58.0 76 51.0 77 45.5 78 40.0 79 31.5 80 23.0 81 16.0 82 9.0 83 9.5 84 10.0 85 6.5 86 3.0 87 2.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 14.674999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.025 25 0.0 26 0.0 27 0.075 28 0.025 29 0.0 30 0.075 31 0.0 32 0.0 33 0.025 34 0.0 35 0.075 36 0.0 37 0.0 38 0.025 39 0.025 40 0.0 41 0.025 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11526794742164 98.02499999999999 2 0.7330637007077857 1.4500000000000002 3 0.10111223458038424 0.3 4 0.02527805864509606 0.1 5 0.02527805864509606 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1815649 READS because READLEN < 1 Read 1815649 spots for ERR3079475.sra Written 1815649 spots for ERR3079475.sra Rejected 1815649 READS because READLEN < 1 Read 1815649 spots for ERR3079475.sra Written 1815649 spots for ERR3079475.sra Rejected 1815649 READS because READLEN < 1 Read 1815649 spots for ERR3079475.sra Written 1815649 spots for ERR3079475.sra Rejected 1815649 READS because READLEN < 1 Read 1815649 spots for ERR3079475.sra Written 1815649 spots for ERR3079475.sra Rejected 1815649 READS because READLEN < 1 Read 1815649 spots for ERR3079475.sra Written 1815649 spots for ERR3079475.sra Rejected 1815649 READS because READLEN < 1 Read 1815649 spots for ERR3079475.sra Written 1815649 spots for ERR3079475.sra Rejected 1815649 READS because READLEN < 1 Read 1815649 spots for ERR3079475.sra Written 1815649 spots for ERR3079475.sra Rejected 1815649 READS because READLEN < 1 Read 1815649 spots for ERR3079475.sra Written 1815649 spots for ERR3079475.sra Rejected 1815649 READS because READLEN < 1 Read 1815649 spots for ERR3079475.sra Written 1815649 spots for ERR3079475.sra Rejected 1815649 READS because READLEN < 1 Read 1815649 spots for ERR3079475.sra Written 1815649 spots for ERR3079475.sra Rejected 1815649 READS because READLEN < 1 Read 1815649 spots for ERR3079475.sra Written 1815649 spots for ERR3079475.sra Rejected 1815649 READS because READLEN < 1 Read 1815649 spots for ERR3079475.sra Written 1815649 spots for ERR3079475.sra Rejected 1815649 READS because READLEN < 1 Read 1815649 spots for ERR3079475.sra Written 1815649 spots for ERR3079475.sra Rejected 1815649 READS because READLEN < 1 Read 1815649 spots for ERR3079475.sra Written 1815649 spots for ERR3079475.sra Rejected 1815649 READS because READLEN < 1 Read 1815649 spots for ERR3079475.sra Written 1815649 spots for ERR3079475.sra Rejected 1815649 READS because READLEN < 1 Read 1815649 spots for ERR3079475.sra Written 1815649 spots for ERR3079475.sra Rejected 1815649 READS because READLEN < 1 Read 1815649 spots for ERR3079475.sra Written 1815649 spots for ERR3079475.sra Rejected 1815649 READS because READLEN < 1 Read 1815649 spots for ERR3079475.sra Written 1815649 spots for ERR3079475.sra Rejected 1815660 READS because READLEN < 1 Read 1815660 spots for ERR3079475.sra Written 1815660 spots for ERR3079475.sra Rejected 1815649 READS because READLEN < 1 Read 1815649 spots for ERR3079475.sra Written 1815649 spots for ERR3079475.sra SRR ids: ['ERR3079475.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z6044ykb ERR3079475.sra spots: 36312991 blocks: [[1, 1815649], [1815650, 3631298], [3631299, 5446947], [5446948, 7262596], [7262597, 9078245], [9078246, 10893894], [10893895, 12709543], [12709544, 14525192], [14525193, 16340841], [16340842, 18156490], [18156491, 19972139], [19972140, 21787788], [21787789, 23603437], [23603438, 25419086], [25419087, 27234735], [27234736, 29050384], [29050385, 30866033], [30866034, 32681682], [32681683, 34497331], [34497332, 36312991]] ERR3079475 file size 5155737 ERR3079475 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3079475 ERR3079475_1.fastq Input file: ERR3079475_1.fastq trimmed: ERR3079475-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 13:18:52 2024 >> started Sat Dec 7 13:19:09 2024 >> done (16.967s) 36312991 reads processed; of these: 3007 ( 0.01%) short reads filtered out after trimming by size control 20656 ( 0.06%) empty reads filtered out after trimming by size control 36289328 (99.93%) reads available; of these: 44635 ( 0.12%) trimmed reads available after processing 36244693 (99.88%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 411 0.00% 19 462 0.00% 20 546 0.00% 21 660 0.00% 22 855 0.00% 23 1120 0.00% 24 1443 0.00% 25 1846 0.01% 26 1808 0.00% 27 1795 0.00% 28 1660 0.00% 29 1537 0.00% 30 1450 0.00% 31 1346 0.00% 32 1363 0.00% 33 1294 0.00% 34 1356 0.00% 35 1341 0.00% 36 1346 0.00% 37 1362 0.00% 38 1319 0.00% 39 1402 0.00% 40 1419 0.00% 41 1410 0.00% 42 1438 0.00% 43 1521 0.00% 44 1456 0.00% 45 1502 0.00% 46 1565 0.00% 47 1552 0.00% 48 1593 0.00% 49 1733 0.00% 50 1724 0.00% 51 36244693 99.88% 36289328 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=120.58 fanout-score-rank=11 prefix-density=0.58 prefix-fanout=18.7 sequence=GCCGCCGCCGCC criterion=fanout-score sequence-density=0.03 sequence-density-rank=20 fanout-score=338.05 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=19.3 sequence=CGCCGCCGCCACC Started job on | Dec 07 13:19:20 Started mapping on | Dec 07 13:19:20 Finished on | Dec 07 13:20:16 Mapping speed, Million of reads per hour | 2332.89 Number of input reads | 36289328 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 29993130 Uniquely mapped reads % | 82.65% Average mapped length | 50.77 Number of splices: Total | 4528971 Number of splices: Annotated (sjdb) | 4327511 Number of splices: GT/AG | 4468340 Number of splices: GC/AG | 52824 Number of splices: AT/AC | 3304 Number of splices: Non-canonical | 4503 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.00% Deletion average length | 1.33 Insertion rate per base | 0.00% Insertion average length | 1.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1390820 % of reads mapped to multiple loci | 3.83% Number of reads mapped to too many loci | 4541854 % of reads mapped to too many loci | 12.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.69% % of reads unmapped: other | 0.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4905378 4905378 4905378 N_multimapping 1390820 1390820 1390820 N_noFeature 1411815 15361308 15370894 N_ambiguous 724454 29260 25542 UnstrandedReadsAssigned:27856861 PositiveStrandReadsAssigned:14602562 NegativeStrandReadsAssigned:14596694 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 ERR3079475 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR3079475-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,289,328 reads, 28,915,374 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,184 rounds 52973 ERR3079475.ke.tsv 35125 ERR3079475.se.tsv 88098 total ==> ERR3079475.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 87.4063 5.96334 PNS24247 1044 945 34.0134 2.05537 PNS24249 1928 1829 407.324 12.7174 PNS24246 1044 945 34.0134 2.05537 PNS24248 1044 945 34.0134 2.05537 PNS24244 1471 1372 47.2297 1.96577 PNS24243 293 194 10 2.94354 KQK14069 1603 1504 6986.12 265.253 KQK14071 474 375 2103.21 320.275 ==> ERR3079475.se.tsv <== BRADI_1g14170v3 9772 BRADI_1g53295v3 180 BRADI_1g59795v3 594 BRADI_1g07683v3 0 BRADI_1g00485v3 20 BRADI_1g20270v3 1755 BRADI_1g74790v3 77 BRADI_1g09890v3 31 BRADI_1g77505v3 770 BRADI_1g48960v3 1 ERR3079475 completed mapping pipeline successfully