Starting /dee2/code/volunteer_pipeline.sh ERR3079476 current disk space = 1542952996864 free memory = 1593856112 ERR3079476 SRAfilesize 7423125f69cc890bcabaa986e8cc362e ERR3079476.sra ERR3079476.sra file validated ERR3079476 is single end ERR3079476 is conventional basespace ERR3079476 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3079476_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.42175 33.0 14.0 33.0 14.0 33.0 2 24.79725 27.0 14.0 33.0 14.0 33.0 3 29.5835 33.0 27.0 33.0 14.0 33.0 4 31.11125 33.0 33.0 33.0 27.0 33.0 5 32.07 33.0 33.0 33.0 33.0 33.0 6 35.02325 37.0 37.0 37.0 27.0 37.0 7 36.16025 37.0 37.0 37.0 33.0 37.0 8 36.45025 37.0 37.0 37.0 37.0 37.0 9 36.57725 37.0 37.0 37.0 37.0 37.0 10 36.554 37.0 37.0 37.0 37.0 37.0 11 36.60125 37.0 37.0 37.0 37.0 37.0 12 36.5635 37.0 37.0 37.0 37.0 37.0 13 36.57825 37.0 37.0 37.0 37.0 37.0 14 36.576 37.0 37.0 37.0 37.0 37.0 15 36.64825 37.0 37.0 37.0 37.0 37.0 16 36.45025 37.0 37.0 37.0 37.0 37.0 17 36.5315 37.0 37.0 37.0 37.0 37.0 18 36.63925 37.0 37.0 37.0 37.0 37.0 19 36.585 37.0 37.0 37.0 37.0 37.0 20 36.59525 37.0 37.0 37.0 37.0 37.0 21 36.5515 37.0 37.0 37.0 37.0 37.0 22 36.5855 37.0 37.0 37.0 37.0 37.0 23 36.58425 37.0 37.0 37.0 37.0 37.0 24 36.55075 37.0 37.0 37.0 37.0 37.0 25 36.5955 37.0 37.0 37.0 37.0 37.0 26 36.51675 37.0 37.0 37.0 37.0 37.0 27 36.56025 37.0 37.0 37.0 37.0 37.0 28 36.54625 37.0 37.0 37.0 37.0 37.0 29 36.586 37.0 37.0 37.0 37.0 37.0 30 36.525 37.0 37.0 37.0 37.0 37.0 31 36.43275 37.0 37.0 37.0 37.0 37.0 32 36.5045 37.0 37.0 37.0 37.0 37.0 33 36.551 37.0 37.0 37.0 37.0 37.0 34 36.525 37.0 37.0 37.0 37.0 37.0 35 36.45825 37.0 37.0 37.0 37.0 37.0 36 36.55275 37.0 37.0 37.0 37.0 37.0 37 36.55775 37.0 37.0 37.0 37.0 37.0 38 36.58925 37.0 37.0 37.0 37.0 37.0 39 36.4975 37.0 37.0 37.0 37.0 37.0 40 36.53525 37.0 37.0 37.0 37.0 37.0 41 36.50275 37.0 37.0 37.0 37.0 37.0 42 36.4955 37.0 37.0 37.0 37.0 37.0 43 36.4145 37.0 37.0 37.0 37.0 37.0 44 36.55375 37.0 37.0 37.0 37.0 37.0 45 36.52 37.0 37.0 37.0 37.0 37.0 46 36.5485 37.0 37.0 37.0 37.0 37.0 47 36.46925 37.0 37.0 37.0 37.0 37.0 48 36.495 37.0 37.0 37.0 37.0 37.0 49 36.465 37.0 37.0 37.0 37.0 37.0 50 36.451 37.0 37.0 37.0 37.0 37.0 51 36.4515 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.0 23 2.0 24 3.0 25 4.0 26 5.0 27 12.0 28 12.0 29 24.0 30 26.0 31 33.0 32 47.0 33 90.0 34 211.0 35 1169.0 36 2357.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.330043859649123 16.091008771929825 5.455043859649123 51.12390350877193 2 27.250000000000004 14.274999999999999 39.15 19.325 3 23.125 20.75 21.325 34.8 4 27.700000000000003 25.224999999999998 19.175 27.900000000000002 5 29.799999999999997 27.125 20.75 22.325 6 24.15 33.475 20.9 21.475 7 21.475 22.225 35.199999999999996 21.099999999999998 8 20.4 21.85 29.599999999999998 28.15 9 21.025 18.9 32.35 27.725 10 23.45 30.425 24.525 21.6 11 26.75 24.0 21.099999999999998 28.15 12 24.474999999999998 22.075 24.45 28.999999999999996 13 24.525 24.625 25.324999999999996 25.525 14 25.5 23.05 25.424999999999997 26.025 15 24.575 24.25 24.975 26.200000000000003 16 26.125 23.0 23.35 27.525 17 25.124999999999996 23.799999999999997 24.875 26.200000000000003 18 25.45 23.575 24.099999999999998 26.875 19 25.924999999999997 23.400000000000002 23.849999999999998 26.825 20 25.95 24.45 25.0 24.6 21 25.15 24.625 23.45 26.775 22 25.825 25.025 23.5 25.650000000000002 23 25.174999999999997 24.675 23.7 26.450000000000003 24 24.987493746873437 24.062031015507753 24.487243621810904 26.463231615807903 25 25.224999999999998 24.775 22.85 27.150000000000002 26 25.224999999999998 24.975 24.5 25.3 27 25.737868934467233 22.736368184092047 24.462231115557778 27.063531765882942 28 25.512756378189096 23.81190595297649 23.311655827913956 27.363681840920464 29 25.974999999999998 24.3 23.575 26.150000000000002 30 25.662831415707853 23.461730865432717 24.23711855927964 26.638319159579787 31 25.924999999999997 23.474999999999998 23.575 27.025 32 26.075 23.925 24.625 25.374999999999996 33 25.85 24.7 23.875 25.575 34 24.925 24.45 23.75 26.875 35 26.43821910955478 24.96248124062031 23.28664332166083 25.312656328164078 36 25.775 23.125 23.95 27.150000000000002 37 25.05 24.65 23.200000000000003 27.1 38 26.331582895723933 24.656164041010253 24.33108277069267 24.681170292573142 39 26.150000000000002 24.099999999999998 23.875 25.874999999999996 40 26.825 23.25 24.2 25.724999999999998 41 25.974999999999998 23.925 23.375 26.724999999999998 42 25.874999999999996 24.0 23.075000000000003 27.05 43 26.424999999999997 23.325000000000003 23.400000000000002 26.85 44 26.650000000000002 24.85 22.775000000000002 25.724999999999998 45 25.324999999999996 24.575 24.05 26.05 46 24.7 24.625 22.5 28.175 47 26.05 24.825 23.674999999999997 25.45 48 25.174999999999997 22.875 24.65 27.3 49 27.025 23.1 23.025000000000002 26.85 50 26.6 23.125 23.45 26.825 51 25.8 23.525 23.9 26.775 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 2.0 22 4.0 23 3.0 24 2.0 25 2.5 26 3.5 27 4.0 28 15.5 29 27.0 30 29.0 31 31.0 32 43.5 33 56.0 34 83.5 35 111.0 36 123.0 37 135.0 38 164.0 39 193.0 40 205.5 41 218.0 42 239.0 43 260.0 44 262.0 45 264.0 46 288.0 47 312.0 48 309.0 49 306.0 50 299.5 51 293.0 52 275.5 53 258.0 54 232.5 55 207.0 56 186.0 57 165.0 58 172.5 59 180.0 60 155.5 61 131.0 62 134.0 63 137.0 64 124.0 65 111.0 66 120.5 67 130.0 68 117.5 69 105.0 70 104.0 71 103.0 72 92.0 73 81.0 74 71.5 75 55.5 76 49.0 77 35.5 78 22.0 79 20.0 80 18.0 81 13.0 82 8.0 83 7.5 84 7.0 85 5.0 86 3.0 87 2.0 88 1.0 89 1.0 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.799999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.05 25 0.0 26 0.0 27 0.05 28 0.05 29 0.0 30 0.05 31 0.0 32 0.0 33 0.0 34 0.0 35 0.05 36 0.0 37 0.0 38 0.025 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 98.91028890015205 97.575 2 0.912316269640142 1.7999999999999998 3 0.12671059300557527 0.375 4 0.025342118601115054 0.1 5 0.0 0.0 6 0.025342118601115054 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAGCTATCTCGTATG 6 0.15 TruSeq Adapter, Index 19 (97% over 38bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 993322 READS because READLEN < 1 Read 993322 spots for ERR3079476.sra Written 993322 spots for ERR3079476.sra Rejected 993322 READS because READLEN < 1 Read 993322 spots for ERR3079476.sra Written 993322 spots for ERR3079476.sra Rejected 993322 READS because READLEN < 1 Read 993322 spots for ERR3079476.sra Written 993322 spots for ERR3079476.sra Rejected 993322 READS because READLEN < 1 Read 993322 spots for ERR3079476.sra Written 993322 spots for ERR3079476.sra Rejected 993322 READS because READLEN < 1 Read 993322 spots for ERR3079476.sra Written 993322 spots for ERR3079476.sra Rejected 993322 READS because READLEN < 1 Read 993322 spots for ERR3079476.sra Written 993322 spots for ERR3079476.sra Rejected 993322 READS because READLEN < 1 Read 993322 spots for ERR3079476.sra Written 993322 spots for ERR3079476.sra Rejected 993322 READS because READLEN < 1 Read 993322 spots for ERR3079476.sra Written 993322 spots for ERR3079476.sra Rejected 993322 READS because READLEN < 1 Read 993322 spots for ERR3079476.sra Written 993322 spots for ERR3079476.sra Rejected 993322 READS because READLEN < 1 Read 993322 spots for ERR3079476.sra Written 993322 spots for ERR3079476.sra Rejected 993322 READS because READLEN < 1 Read 993322 spots for ERR3079476.sra Written 993322 spots for ERR3079476.sra Rejected 993322 READS because READLEN < 1 Read 993322 spots for ERR3079476.sra Written 993322 spots for ERR3079476.sra Rejected 993322 READS because READLEN < 1 Read 993322 spots for ERR3079476.sra Written 993322 spots for ERR3079476.sra Rejected 993322 READS because READLEN < 1 Read 993322 spots for ERR3079476.sra Written 993322 spots for ERR3079476.sra Rejected 993322 READS because READLEN < 1 Read 993322 spots for ERR3079476.sra Written 993322 spots for ERR3079476.sra Rejected 993322 READS because READLEN < 1 Read 993322 spots for ERR3079476.sra Written 993322 spots for ERR3079476.sra Rejected 993322 READS because READLEN < 1 Read 993322 spots for ERR3079476.sra Written 993322 spots for ERR3079476.sra Rejected 993322 READS because READLEN < 1 Read 993322 spots for ERR3079476.sra Written 993322 spots for ERR3079476.sra Rejected 993322 READS because READLEN < 1 Read 993322 spots for ERR3079476.sra Written 993322 spots for ERR3079476.sra Rejected 993334 READS because READLEN < 1 Read 993334 spots for ERR3079476.sra Written 993334 spots for ERR3079476.sra SRR ids: ['ERR3079476.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6xcq2lw5 ERR3079476.sra spots: 19866452 blocks: [[1, 993322], [993323, 1986644], [1986645, 2979966], [2979967, 3973288], [3973289, 4966610], [4966611, 5959932], [5959933, 6953254], [6953255, 7946576], [7946577, 8939898], [8939899, 9933220], [9933221, 10926542], [10926543, 11919864], [11919865, 12913186], [12913187, 13906508], [13906509, 14899830], [14899831, 15893152], [15893153, 16886474], [16886475, 17879796], [17879797, 18873118], [18873119, 19866452]] ERR3079476 file size 2810821 ERR3079476 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3079476 ERR3079476_1.fastq Input file: ERR3079476_1.fastq trimmed: ERR3079476-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 13:21:25 2024 >> started Sat Dec 7 13:21:39 2024 >> done (13.883s) 19866452 reads processed; of these: 2220 ( 0.01%) short reads filtered out after trimming by size control 20449 ( 0.10%) empty reads filtered out after trimming by size control 19843783 (99.89%) reads available; of these: 22712 ( 0.11%) trimmed reads available after processing 19821071 (99.89%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 215 0.00% 19 232 0.00% 20 255 0.00% 21 322 0.00% 22 422 0.00% 23 565 0.00% 24 775 0.00% 25 1004 0.01% 26 994 0.01% 27 961 0.00% 28 891 0.00% 29 732 0.00% 30 665 0.00% 31 660 0.00% 32 694 0.00% 33 694 0.00% 34 656 0.00% 35 678 0.00% 36 706 0.00% 37 731 0.00% 38 661 0.00% 39 678 0.00% 40 716 0.00% 41 715 0.00% 42 731 0.00% 43 739 0.00% 44 707 0.00% 45 773 0.00% 46 779 0.00% 47 845 0.00% 48 795 0.00% 49 820 0.00% 50 901 0.00% 51 19821071 99.89% 19843783 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=119.68 fanout-score-rank=11 prefix-density=0.55 prefix-fanout=18.5 sequence=GCCGCCGCCGCC criterion=fanout-score sequence-density=0.03 sequence-density-rank=21 fanout-score=353.11 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=18.9 sequence=CGCCGCCGCCACC Started job on | Dec 07 13:21:56 Started mapping on | Dec 07 13:21:56 Finished on | Dec 07 13:22:18 Mapping speed, Million of reads per hour | 3247.16 Number of input reads | 19843783 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 16630273 Uniquely mapped reads % | 83.81% Average mapped length | 50.77 Number of splices: Total | 2564050 Number of splices: Annotated (sjdb) | 2448765 Number of splices: GT/AG | 2529413 Number of splices: GC/AG | 30141 Number of splices: AT/AC | 2083 Number of splices: Non-canonical | 2413 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.00% Deletion average length | 1.33 Insertion rate per base | 0.00% Insertion average length | 1.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 735369 % of reads mapped to multiple loci | 3.71% Number of reads mapped to too many loci | 2272429 % of reads mapped to too many loci | 11.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.74% % of reads unmapped: other | 0.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2478141 2478141 2478141 N_multimapping 735369 735369 735369 N_noFeature 801333 8558492 8507627 N_ambiguous 393813 16188 13842 UnstrandedReadsAssigned:15435127 PositiveStrandReadsAssigned:8055593 NegativeStrandReadsAssigned:8108804 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 ERR3079476 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR3079476-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,843,783 reads, 16,023,899 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,194 rounds 52973 ERR3079476.ke.tsv 35125 ERR3079476.se.tsv 88098 total ==> ERR3079476.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 60.6249 7.56974 PNS24247 1044 945 12.4197 1.37352 PNS24249 1928 1829 245.107 14.0055 PNS24246 1044 945 12.4197 1.37352 PNS24248 1044 945 12.4197 1.37352 PNS24244 1471 1372 20.0088 1.52413 PNS24243 293 194 7 3.77096 KQK14069 1603 1504 2750.29 191.111 KQK14071 474 375 724.497 201.911 ==> ERR3079476.se.tsv <== BRADI_1g14170v3 3806 BRADI_1g53295v3 100 BRADI_1g59795v3 304 BRADI_1g07683v3 0 BRADI_1g00485v3 11 BRADI_1g20270v3 953 BRADI_1g74790v3 33 BRADI_1g09890v3 16 BRADI_1g77505v3 326 BRADI_1g48960v3 2 ERR3079476 completed mapping pipeline successfully