Starting /dee2/code/volunteer_pipeline.sh ERR3079477 current disk space = 1543111987200 free memory = 1599243552 ERR3079477 SRAfilesize 60f914d34fd2ab85b5fb644511227b64 ERR3079477.sra ERR3079477.sra file validated ERR3079477 is single end ERR3079477 is conventional basespace ERR3079477 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3079477_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.29325 33.0 14.0 33.0 2.0 33.0 2 25.42525 27.0 14.0 33.0 14.0 33.0 3 28.57675 27.0 27.0 33.0 14.0 33.0 4 32.09 33.0 33.0 33.0 27.0 33.0 5 32.423 33.0 33.0 33.0 33.0 33.0 6 35.452 37.0 37.0 37.0 33.0 37.0 7 35.922 37.0 37.0 37.0 33.0 37.0 8 36.13025 37.0 37.0 37.0 37.0 37.0 9 36.40275 37.0 37.0 37.0 37.0 37.0 10 36.504 37.0 37.0 37.0 37.0 37.0 11 36.515 37.0 37.0 37.0 37.0 37.0 12 36.40175 37.0 37.0 37.0 37.0 37.0 13 36.57225 37.0 37.0 37.0 37.0 37.0 14 36.55775 37.0 37.0 37.0 37.0 37.0 15 36.5435 37.0 37.0 37.0 37.0 37.0 16 36.51925 37.0 37.0 37.0 37.0 37.0 17 36.48375 37.0 37.0 37.0 37.0 37.0 18 36.47125 37.0 37.0 37.0 37.0 37.0 19 36.476 37.0 37.0 37.0 37.0 37.0 20 36.396 37.0 37.0 37.0 37.0 37.0 21 36.447 37.0 37.0 37.0 37.0 37.0 22 36.4995 37.0 37.0 37.0 37.0 37.0 23 36.48475 37.0 37.0 37.0 37.0 37.0 24 36.48325 37.0 37.0 37.0 37.0 37.0 25 36.48825 37.0 37.0 37.0 37.0 37.0 26 36.42425 37.0 37.0 37.0 37.0 37.0 27 36.37125 37.0 37.0 37.0 37.0 37.0 28 36.353 37.0 37.0 37.0 37.0 37.0 29 36.448 37.0 37.0 37.0 37.0 37.0 30 36.3635 37.0 37.0 37.0 37.0 37.0 31 36.28075 37.0 37.0 37.0 37.0 37.0 32 36.4795 37.0 37.0 37.0 37.0 37.0 33 36.385 37.0 37.0 37.0 37.0 37.0 34 36.47125 37.0 37.0 37.0 37.0 37.0 35 36.51575 37.0 37.0 37.0 37.0 37.0 36 36.498 37.0 37.0 37.0 37.0 37.0 37 36.31125 37.0 37.0 37.0 37.0 37.0 38 36.41975 37.0 37.0 37.0 37.0 37.0 39 36.43875 37.0 37.0 37.0 37.0 37.0 40 36.43825 37.0 37.0 37.0 37.0 37.0 41 36.47525 37.0 37.0 37.0 37.0 37.0 42 36.38125 37.0 37.0 37.0 37.0 37.0 43 36.32275 37.0 37.0 37.0 37.0 37.0 44 36.34975 37.0 37.0 37.0 37.0 37.0 45 36.37075 37.0 37.0 37.0 37.0 37.0 46 36.30175 37.0 37.0 37.0 37.0 37.0 47 36.3715 37.0 37.0 37.0 37.0 37.0 48 36.203 37.0 37.0 37.0 37.0 37.0 49 36.409 37.0 37.0 37.0 37.0 37.0 50 36.416 37.0 37.0 37.0 37.0 37.0 51 36.426 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 5.0 24 3.0 25 4.0 26 10.0 27 14.0 28 18.0 29 16.0 30 38.0 31 44.0 32 66.0 33 117.0 34 229.0 35 1235.0 36 2200.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.16367842683632 12.11683053788317 5.436668594563331 59.282822440717176 2 23.3 15.075 38.85 22.775000000000002 3 21.875 21.375 22.625 34.125 4 26.474999999999998 25.3 20.25 27.975 5 29.4 27.675 22.2 20.724999999999998 6 22.6 35.55 21.075 20.775 7 21.3 22.575 34.75 21.375 8 19.7 21.775 30.3 28.225 9 21.2 19.8 31.95 27.05 10 21.125 31.4 26.075 21.4 11 26.525 24.075 21.075 28.325 12 24.55 22.95 25.025 27.474999999999998 13 24.175 24.3 26.325 25.2 14 22.875 24.525 27.0 25.6 15 23.325000000000003 24.625 25.25 26.8 16 24.775 24.45 23.95 26.825 17 24.775 24.975 25.25 25.0 18 24.349999999999998 24.725 25.0 25.924999999999997 19 24.55 24.625 23.65 27.175 20 24.775 24.775 25.0 25.45 21 24.4 24.95 24.3 26.35 22 23.5 25.0 25.074999999999996 26.424999999999997 23 24.474999999999998 25.0 24.474999999999998 26.05 24 23.799999999999997 24.95 25.174999999999997 26.075 25 25.85 23.125 24.4 26.625 26 25.324999999999996 23.474999999999998 24.975 26.224999999999998 27 24.656164041010253 24.956239059764943 23.755938984746187 26.63165791447862 28 25.03125781445361 24.8062015503876 24.85621405351338 25.30632658164541 29 24.474999999999998 24.325 25.324999999999996 25.874999999999996 30 23.93098274568642 24.056014003500874 24.406101525381345 27.60690172543136 31 24.60615153788447 24.031007751937985 24.006001500375092 27.35683920980245 32 25.25 25.4 23.674999999999997 25.674999999999997 33 24.356089022255563 24.356089022255563 24.956239059764943 26.331582895723933 34 24.55 24.45 24.625 26.375 35 25.30632658164541 24.15603900975244 24.88122030507627 25.656414103525883 36 24.9 24.224999999999998 24.075 26.8 37 25.10627656914228 24.356089022255563 23.13078269567392 27.406851712928233 38 24.50612653163291 24.756189047261813 24.981245311327832 25.756439109777446 39 23.974999999999998 24.6 24.474999999999998 26.950000000000003 40 25.424999999999997 24.65 22.625 27.3 41 25.75 23.5 26.0 24.75 42 24.781195298824706 24.93123280820205 23.48087021755439 26.806701675418854 43 25.074999999999996 25.424999999999997 23.474999999999998 26.025 44 25.03125781445361 24.681170292573142 23.48087021755439 26.806701675418854 45 25.70642660665166 24.88122030507627 24.90622655663916 24.50612653163291 46 25.35 25.900000000000002 23.474999999999998 25.275 47 24.5 24.5 25.624999999999996 25.374999999999996 48 24.349999999999998 24.275 25.074999999999996 26.3 49 26.25656414103526 24.006001500375092 23.55588897224306 26.18154538634659 50 24.681170292573142 24.831207801950487 25.131282820705174 25.35633908477119 51 24.681170292573142 25.581395348837212 23.680920230057513 26.056514128532132 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 2.0 23 3.0 24 4.0 25 6.5 26 12.0 27 15.0 28 24.0 29 33.0 30 34.0 31 35.0 32 56.0 33 77.0 34 96.0 35 115.0 36 141.0 37 167.0 38 181.5 39 196.0 40 226.0 41 256.0 42 271.0 43 286.0 44 301.5 45 317.0 46 315.0 47 313.0 48 309.5 49 306.0 50 284.5 51 263.0 52 244.5 53 226.0 54 223.0 55 220.0 56 194.5 57 169.0 58 161.5 59 154.0 60 142.0 61 130.0 62 121.0 63 112.0 64 109.0 65 106.0 66 105.0 67 104.0 68 87.5 69 71.0 70 71.0 71 71.0 72 71.0 73 71.0 74 67.0 75 53.5 76 44.0 77 32.5 78 21.0 79 20.0 80 19.0 81 16.5 82 14.0 83 10.0 84 6.0 85 4.0 86 2.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 1.0 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 13.55 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.025 28 0.025 29 0.0 30 0.025 31 0.025 32 0.0 33 0.025 34 0.0 35 0.025 36 0.0 37 0.025 38 0.025 39 0.0 40 0.0 41 0.0 42 0.025 43 0.0 44 0.025 45 0.025 46 0.0 47 0.0 48 0.0 49 0.025 50 0.025 51 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1894535 READS because READLEN < 1 Read 1894535 spots for ERR3079477.sra Written 1894535 spots for ERR3079477.sra Rejected 1894535 READS because READLEN < 1 Read 1894535 spots for ERR3079477.sra Written 1894535 spots for ERR3079477.sra Rejected 1894535 READS because READLEN < 1 Read 1894535 spots for ERR3079477.sra Written 1894535 spots for ERR3079477.sra Rejected 1894535 READS because READLEN < 1 Read 1894535 spots for ERR3079477.sra Written 1894535 spots for ERR3079477.sra Rejected 1894535 READS because READLEN < 1 Read 1894535 spots for ERR3079477.sra Written 1894535 spots for ERR3079477.sra Rejected 1894554 READS because READLEN < 1 Read 1894554 spots for ERR3079477.sra Written 1894554 spots for ERR3079477.sra Rejected 1894535 READS because READLEN < 1 Read 1894535 spots for ERR3079477.sra Written 1894535 spots for ERR3079477.sra Rejected 1894535 READS because READLEN < 1 Read 1894535 spots for ERR3079477.sra Written 1894535 spots for ERR3079477.sra Rejected 1894535 READS because READLEN < 1 Read 1894535 spots for ERR3079477.sra Written 1894535 spots for ERR3079477.sra Rejected 1894535 READS because READLEN < 1 Read 1894535 spots for ERR3079477.sra Written 1894535 spots for ERR3079477.sra Rejected 1894535 READS because READLEN < 1 Read 1894535 spots for ERR3079477.sra Written 1894535 spots for ERR3079477.sra Rejected 1894535 READS because READLEN < 1 Read 1894535 spots for ERR3079477.sra Written 1894535 spots for ERR3079477.sra Rejected 1894535 READS because READLEN < 1 Read 1894535 spots for ERR3079477.sra Written 1894535 spots for ERR3079477.sra Rejected 1894535 READS because READLEN < 1 Read 1894535 spots for ERR3079477.sra Written 1894535 spots for ERR3079477.sra Rejected 1894535 READS because READLEN < 1 Read 1894535 spots for ERR3079477.sra Written 1894535 spots for ERR3079477.sra Rejected 1894535 READS because READLEN < 1 Read 1894535 spots for ERR3079477.sra Written 1894535 spots for ERR3079477.sra Rejected 1894535 READS because READLEN < 1 Read 1894535 spots for ERR3079477.sra Written 1894535 spots for ERR3079477.sra Rejected 1894535 READS because READLEN < 1 Read 1894535 spots for ERR3079477.sra Written 1894535 spots for ERR3079477.sra Rejected 1894535 READS because READLEN < 1 Read 1894535 spots for ERR3079477.sra Written 1894535 spots for ERR3079477.sra Rejected 1894535 READS because READLEN < 1 Read 1894535 spots for ERR3079477.sra Written 1894535 spots for ERR3079477.sra SRR ids: ['ERR3079477.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kxw4cofo ERR3079477.sra spots: 37890719 blocks: [[1, 1894535], [1894536, 3789070], [3789071, 5683605], [5683606, 7578140], [7578141, 9472675], [9472676, 11367210], [11367211, 13261745], [13261746, 15156280], [15156281, 17050815], [17050816, 18945350], [18945351, 20839885], [20839886, 22734420], [22734421, 24628955], [24628956, 26523490], [26523491, 28418025], [28418026, 30312560], [30312561, 32207095], [32207096, 34101630], [34101631, 35996165], [35996166, 37890719]] ERR3079477 file size 5380687 ERR3079477 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3079477 ERR3079477_1.fastq Input file: ERR3079477_1.fastq trimmed: ERR3079477-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 13:28:55 2024 >> started Sat Dec 7 13:29:12 2024 >> done (17.254s) 37890719 reads processed; of these: 4123 ( 0.01%) short reads filtered out after trimming by size control 20283 ( 0.05%) empty reads filtered out after trimming by size control 37866313 (99.94%) reads available; of these: 59808 ( 0.16%) trimmed reads available after processing 37806505 (99.84%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 558 0.00% 19 676 0.00% 20 784 0.00% 21 871 0.00% 22 1162 0.00% 23 1398 0.00% 24 1948 0.01% 25 2437 0.01% 26 3001 0.01% 27 2314 0.01% 28 2184 0.01% 29 1892 0.00% 30 1840 0.00% 31 1767 0.00% 32 1748 0.00% 33 1801 0.00% 34 1795 0.00% 35 1847 0.00% 36 1856 0.00% 37 1790 0.00% 38 1794 0.00% 39 1839 0.00% 40 1808 0.00% 41 1861 0.00% 42 1908 0.01% 43 1938 0.01% 44 1946 0.01% 45 1880 0.00% 46 2008 0.01% 47 2215 0.01% 48 2258 0.01% 49 2196 0.01% 50 2488 0.01% 51 37806505 99.84% 37866313 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=101.92 fanout-score-rank=15 prefix-density=0.77 prefix-fanout=16.9 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=20 fanout-score=350.10 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=16.9 sequence=CGCCGCCGCCACC Started job on | Dec 07 13:29:24 Started mapping on | Dec 07 13:29:24 Finished on | Dec 07 13:30:00 Mapping speed, Million of reads per hour | 3786.63 Number of input reads | 37866313 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 33991728 Uniquely mapped reads % | 89.77% Average mapped length | 50.77 Number of splices: Total | 5581700 Number of splices: Annotated (sjdb) | 5311088 Number of splices: GT/AG | 5503296 Number of splices: GC/AG | 69298 Number of splices: AT/AC | 4720 Number of splices: Non-canonical | 4386 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.00% Deletion average length | 1.30 Insertion rate per base | 0.00% Insertion average length | 1.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1136853 % of reads mapped to multiple loci | 3.00% Number of reads mapped to too many loci | 2473031 % of reads mapped to too many loci | 6.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.52% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2737732 2737732 2737732 N_multimapping 1136853 1136853 1136853 N_noFeature 1806773 17693210 17485539 N_ambiguous 666399 25970 23650 UnstrandedReadsAssigned:31518556 PositiveStrandReadsAssigned:16272548 NegativeStrandReadsAssigned:16482539 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 ERR3079477 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR3079477-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,866,313 reads, 32,500,918 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,308 rounds 52973 ERR3079477.ke.tsv 35125 ERR3079477.se.tsv 88098 total ==> ERR3079477.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 123.092 7.85576 PNS24247 1044 945 113.162 6.39664 PNS24249 1928 1829 677.831 19.7966 PNS24246 1044 945 113.162 6.39664 PNS24248 1044 945 113.162 6.39664 PNS24244 1471 1372 106.591 4.15002 PNS24243 293 194 25 6.8837 KQK14069 1603 1504 1122.58 39.8705 KQK14071 474 375 357.224 50.8854 ==> ERR3079477.se.tsv <== BRADI_1g14170v3 1702 BRADI_1g53295v3 129 BRADI_1g59795v3 1046 BRADI_1g07683v3 0 BRADI_1g00485v3 40 BRADI_1g20270v3 785 BRADI_1g74790v3 78 BRADI_1g09890v3 0 BRADI_1g77505v3 945 BRADI_1g48960v3 0 ERR3079477 completed mapping pipeline successfully