Starting /dee2/code/volunteer_pipeline.sh ERR3079478 current disk space = 1543111790592 free memory = 1590214156 ERR3079478 SRAfilesize b9106c2e81eefbb459ede590c86df727 ERR3079478.sra ERR3079478.sra file validated ERR3079478 is single end ERR3079478 is conventional basespace ERR3079478 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR3079478_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.533 14.0 14.0 33.0 2.0 33.0 2 29.90525 33.0 27.0 33.0 27.0 33.0 3 30.9405 33.0 27.0 33.0 27.0 33.0 4 32.2985 33.0 33.0 33.0 33.0 33.0 5 32.58075 33.0 33.0 33.0 33.0 33.0 6 35.93625 37.0 37.0 37.0 33.0 37.0 7 36.41575 37.0 37.0 37.0 37.0 37.0 8 36.43375 37.0 37.0 37.0 37.0 37.0 9 36.51125 37.0 37.0 37.0 37.0 37.0 10 36.587 37.0 37.0 37.0 37.0 37.0 11 36.54425 37.0 37.0 37.0 37.0 37.0 12 36.43425 37.0 37.0 37.0 37.0 37.0 13 36.50375 37.0 37.0 37.0 37.0 37.0 14 36.555 37.0 37.0 37.0 37.0 37.0 15 36.603 37.0 37.0 37.0 37.0 37.0 16 36.50075 37.0 37.0 37.0 37.0 37.0 17 36.42975 37.0 37.0 37.0 37.0 37.0 18 36.5595 37.0 37.0 37.0 37.0 37.0 19 36.523 37.0 37.0 37.0 37.0 37.0 20 36.43525 37.0 37.0 37.0 37.0 37.0 21 36.39525 37.0 37.0 37.0 37.0 37.0 22 36.472 37.0 37.0 37.0 37.0 37.0 23 36.46475 37.0 37.0 37.0 37.0 37.0 24 36.48 37.0 37.0 37.0 37.0 37.0 25 36.46575 37.0 37.0 37.0 37.0 37.0 26 36.46125 37.0 37.0 37.0 37.0 37.0 27 36.471 37.0 37.0 37.0 37.0 37.0 28 36.43675 37.0 37.0 37.0 37.0 37.0 29 36.431 37.0 37.0 37.0 37.0 37.0 30 36.417 37.0 37.0 37.0 37.0 37.0 31 36.27525 37.0 37.0 37.0 37.0 37.0 32 36.42425 37.0 37.0 37.0 37.0 37.0 33 36.31875 37.0 37.0 37.0 37.0 37.0 34 36.418 37.0 37.0 37.0 37.0 37.0 35 36.4435 37.0 37.0 37.0 37.0 37.0 36 36.47775 37.0 37.0 37.0 37.0 37.0 37 36.276 37.0 37.0 37.0 37.0 37.0 38 36.40425 37.0 37.0 37.0 37.0 37.0 39 36.41725 37.0 37.0 37.0 37.0 37.0 40 36.4305 37.0 37.0 37.0 37.0 37.0 41 36.4485 37.0 37.0 37.0 37.0 37.0 42 36.29 37.0 37.0 37.0 37.0 37.0 43 36.353 37.0 37.0 37.0 37.0 37.0 44 36.37525 37.0 37.0 37.0 37.0 37.0 45 36.2525 37.0 37.0 37.0 37.0 37.0 46 36.34025 37.0 37.0 37.0 37.0 37.0 47 36.2955 37.0 37.0 37.0 37.0 37.0 48 36.292 37.0 37.0 37.0 37.0 37.0 49 36.3995 37.0 37.0 37.0 37.0 37.0 50 36.32875 37.0 37.0 37.0 37.0 37.0 51 36.2605 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 0.0 23 1.0 24 4.0 25 5.0 26 5.0 27 18.0 28 19.0 29 21.0 30 37.0 31 57.0 32 57.0 33 78.0 34 165.0 35 942.0 36 2586.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.57037037037037 13.955555555555554 6.577777777777778 49.89629629629629 2 23.849999999999998 14.249999999999998 38.875 23.025000000000002 3 23.7 20.025000000000002 20.575 35.699999999999996 4 26.450000000000003 23.225 20.0 30.325000000000003 5 27.200000000000003 26.674999999999997 22.625 23.5 6 24.0 32.925 20.875 22.2 7 18.875 24.6 36.125 20.4 8 19.075 22.85 31.125000000000004 26.950000000000003 9 19.375 21.475 31.75 27.400000000000002 10 22.325 32.574999999999996 26.474999999999998 18.625 11 24.875 27.175 21.525 26.424999999999997 12 23.325000000000003 24.175 25.224999999999998 27.275 13 22.5 27.175 26.1 24.224999999999998 14 21.325 25.825 26.775 26.075 15 23.45 25.1 25.650000000000002 25.8 16 24.099999999999998 25.25 25.624999999999996 25.025 17 24.675 25.8 24.45 25.074999999999996 18 22.95 26.35 24.725 25.974999999999998 19 22.45 26.424999999999997 25.575 25.55 20 23.325000000000003 24.775 26.400000000000002 25.5 21 24.349999999999998 24.3 24.725 26.625 22 22.3 26.25 25.324999999999996 26.125 23 24.575 25.8 24.525 25.1 24 24.25 24.575 25.45 25.724999999999998 25 24.925 26.05 23.400000000000002 25.624999999999996 26 23.75 25.650000000000002 24.55 26.05 27 23.386693346673336 25.887943971985994 24.23711855927964 26.488244122061033 28 22.85 26.625 24.275 26.25 29 23.525 26.200000000000003 24.375 25.900000000000002 30 23.986993496748372 24.862431215607803 25.237618809404704 25.912956478239117 31 22.98649324662331 25.83791895947974 24.287143571785894 26.88844422211106 32 25.05 24.9 25.174999999999997 24.875 33 23.311655827913956 26.76338169084542 23.861930965482742 26.063031515757878 34 22.45 25.674999999999997 25.35 26.525 35 24.462231115557778 25.237618809404704 24.96248124062031 25.337668834417208 36 23.3 25.974999999999998 24.275 26.450000000000003 37 23.48087021755439 25.331332833208304 24.981245311327832 26.206551637909474 38 23.66183091545773 24.937468734367183 26.538269134567283 24.862431215607803 39 23.724999999999998 26.200000000000003 24.275 25.8 40 24.825 25.05 24.025 26.1 41 23.65 24.6 25.874999999999996 25.874999999999996 42 23.674999999999997 25.724999999999998 24.7 25.900000000000002 43 24.55 25.7 24.675 25.074999999999996 44 23.080770192548137 24.48112028007002 25.756439109777446 26.6816704176044 45 23.85596399099775 25.23130782695674 25.35633908477119 25.55638909727432 46 24.425 24.375 24.625 26.575 47 24.675 25.35 23.825 26.150000000000002 48 23.799999999999997 25.2 24.875 26.125 49 23.45 25.025 25.75 25.775 50 23.455863965991497 25.731432858214554 25.731432858214554 25.081270317579396 51 23.50587646911728 24.731182795698924 26.25656414103526 25.506376594148538 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 3.0 23 6.0 24 9.0 25 10.5 26 14.5 27 17.0 28 29.5 29 42.0 30 49.0 31 56.0 32 73.5 33 91.0 34 112.5 35 134.0 36 172.5 37 211.0 38 213.0 39 215.0 40 252.0 41 289.0 42 299.0 43 309.0 44 322.5 45 336.0 46 318.0 47 300.0 48 290.0 49 280.0 50 266.5 51 253.0 52 245.5 53 238.0 54 214.0 55 190.0 56 166.5 57 143.0 58 141.0 59 139.0 60 132.5 61 126.0 62 109.0 63 92.0 64 87.5 65 83.0 66 82.0 67 81.0 68 77.5 69 74.0 70 69.5 71 65.0 72 64.0 73 63.0 74 61.0 75 52.5 76 46.0 77 34.5 78 23.0 79 14.5 80 6.0 81 7.5 82 9.0 83 7.0 84 5.0 85 3.0 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 15.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.05 28 0.0 29 0.0 30 0.05 31 0.05 32 0.0 33 0.05 34 0.0 35 0.05 36 0.0 37 0.025 38 0.05 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.025 45 0.025 46 0.0 47 0.0 48 0.0 49 0.0 50 0.025 51 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.25 #Duplication Level Percentage of deduplicated Percentage of total 1 98.60050890585241 96.875 2 1.2468193384223918 2.45 3 0.02544529262086514 0.075 4 0.07633587786259542 0.3 5 0.02544529262086514 0.125 6 0.0 0.0 7 0.02544529262086514 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCTTATACAATAAGACTAACGTCTTATCCATTTACAGATGGAGCATCTAT 7 0.17500000000000002 No Hit GCTCCTTTATTTTTCAATAACTCTTATACAATAAGACTAACGTCTTATCCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1978313 READS because READLEN < 1 Read 1978313 spots for ERR3079478.sra Written 1978313 spots for ERR3079478.sra Rejected 1978313 READS because READLEN < 1 Read 1978313 spots for ERR3079478.sra Written 1978313 spots for ERR3079478.sra Rejected 1978313 READS because READLEN < 1 Read 1978313 spots for ERR3079478.sra Written 1978313 spots for ERR3079478.sra Rejected 1978313 READS because READLEN < 1 Read 1978313 spots for ERR3079478.sra Written 1978313 spots for ERR3079478.sra Rejected 1978313 READS because READLEN < 1 Read 1978313 spots for ERR3079478.sra Written 1978313 spots for ERR3079478.sra Rejected 1978313 READS because READLEN < 1 Read 1978313 spots for ERR3079478.sra Written 1978313 spots for ERR3079478.sra Rejected 1978313 READS because READLEN < 1 Read 1978313 spots for ERR3079478.sra Written 1978313 spots for ERR3079478.sra Rejected 1978313 READS because READLEN < 1 Read 1978313 spots for ERR3079478.sra Written 1978313 spots for ERR3079478.sra Rejected 1978313 READS because READLEN < 1 Read 1978313 spots for ERR3079478.sra Written 1978313 spots for ERR3079478.sra Rejected 1978313 READS because READLEN < 1 Read 1978313 spots for ERR3079478.sra Written 1978313 spots for ERR3079478.sra Rejected 1978327 READS because READLEN < 1 Read 1978327 spots for ERR3079478.sra Written 1978327 spots for ERR3079478.sra Rejected 1978313 READS because READLEN < 1 Read 1978313 spots for ERR3079478.sra Written 1978313 spots for ERR3079478.sra Rejected 1978313 READS because READLEN < 1 Read 1978313 spots for ERR3079478.sra Written 1978313 spots for ERR3079478.sra Rejected 1978313 READS because READLEN < 1 Read 1978313 spots for ERR3079478.sra Written 1978313 spots for ERR3079478.sra Rejected 1978313 READS because READLEN < 1 Read 1978313 spots for ERR3079478.sra Written 1978313 spots for ERR3079478.sra Rejected 1978313 READS because READLEN < 1 Read 1978313 spots for ERR3079478.sra Written 1978313 spots for ERR3079478.sra Rejected 1978313 READS because READLEN < 1 Read 1978313 spots for ERR3079478.sra Written 1978313 spots for ERR3079478.sra Rejected 1978313 READS because READLEN < 1 Read 1978313 spots for ERR3079478.sra Written 1978313 spots for ERR3079478.sra Rejected 1978313 READS because READLEN < 1 Read 1978313 spots for ERR3079478.sra Written 1978313 spots for ERR3079478.sra Rejected 1978313 READS because READLEN < 1 Read 1978313 spots for ERR3079478.sra Written 1978313 spots for ERR3079478.sra SRR ids: ['ERR3079478.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kys85ze3 ERR3079478.sra spots: 39566274 blocks: [[1, 1978313], [1978314, 3956626], [3956627, 5934939], [5934940, 7913252], [7913253, 9891565], [9891566, 11869878], [11869879, 13848191], [13848192, 15826504], [15826505, 17804817], [17804818, 19783130], [19783131, 21761443], [21761444, 23739756], [23739757, 25718069], [25718070, 27696382], [27696383, 29674695], [29674696, 31653008], [31653009, 33631321], [33631322, 35609634], [35609635, 37587947], [37587948, 39566274]] ERR3079478 file size 5619584 ERR3079478 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR3079478 ERR3079478_1.fastq Input file: ERR3079478_1.fastq trimmed: ERR3079478-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 13:31:11 2024 >> started Sat Dec 7 13:31:35 2024 >> done (23.123s) 39566274 reads processed; of these: 6379 ( 0.02%) short reads filtered out after trimming by size control 22532 ( 0.06%) empty reads filtered out after trimming by size control 39537363 (99.93%) reads available; of these: 80753 ( 0.20%) trimmed reads available after processing 39456610 (99.80%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 694 0.00% 19 767 0.00% 20 863 0.00% 21 1118 0.00% 22 1491 0.00% 23 2118 0.01% 24 3079 0.01% 25 4084 0.01% 26 4660 0.01% 27 3974 0.01% 28 3539 0.01% 29 2927 0.01% 30 2772 0.01% 31 2511 0.01% 32 2425 0.01% 33 2441 0.01% 34 2373 0.01% 35 2505 0.01% 36 2336 0.01% 37 2335 0.01% 38 2259 0.01% 39 2282 0.01% 40 2217 0.01% 41 2364 0.01% 42 2286 0.01% 43 2326 0.01% 44 2394 0.01% 45 2241 0.01% 46 2384 0.01% 47 2623 0.01% 48 2675 0.01% 49 2696 0.01% 50 2994 0.01% 51 39456610 99.80% 39537363 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=19 prefix-density=0.22 prefix-fanout=2.1 sequence=GTTATCCTTCCACTGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=9 fanout-score=137.00 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=18.8 sequence=CCGCCGCCGCCA Started job on | Dec 07 13:32:01 Started mapping on | Dec 07 13:32:01 Finished on | Dec 07 13:34:04 Mapping speed, Million of reads per hour | 1157.19 Number of input reads | 39537363 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 26408094 Uniquely mapped reads % | 66.79% Average mapped length | 50.72 Number of splices: Total | 4125492 Number of splices: Annotated (sjdb) | 3912882 Number of splices: GT/AG | 4066641 Number of splices: GC/AG | 50842 Number of splices: AT/AC | 3563 Number of splices: Non-canonical | 4446 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.00% Deletion average length | 1.34 Insertion rate per base | 0.00% Insertion average length | 1.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2760469 % of reads mapped to multiple loci | 6.98% Number of reads mapped to too many loci | 3377481 % of reads mapped to too many loci | 8.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 17.44% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 10368800 10368800 10368800 N_multimapping 2760469 2760469 2760469 N_noFeature 1756608 13973318 13753023 N_ambiguous 477293 21148 19808 UnstrandedReadsAssigned:24174193 PositiveStrandReadsAssigned:12413628 NegativeStrandReadsAssigned:12635263 Dataset is classified unstranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 ERR3079478 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR3079478-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 39,537,363 reads, 24,960,738 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,237 rounds 52973 ERR3079478.ke.tsv 35125 ERR3079478.se.tsv 88098 total ==> ERR3079478.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 7.51555 0.610325 PNS24247 1044 945 105.293 7.57346 PNS24249 1928 1829 589.411 21.9044 PNS24246 1044 945 105.293 7.57346 PNS24248 1044 945 105.293 7.57346 PNS24244 1471 1372 36.1935 1.79309 PNS24243 293 194 19 6.65699 KQK14069 1603 1504 2429.29 109.789 KQK14071 474 375 865.029 156.793 ==> ERR3079478.se.tsv <== BRADI_1g14170v3 3588 BRADI_1g53295v3 121 BRADI_1g59795v3 764 BRADI_1g07683v3 0 BRADI_1g00485v3 33 BRADI_1g20270v3 569 BRADI_1g74790v3 14 BRADI_1g09890v3 0 BRADI_1g77505v3 724 BRADI_1g48960v3 0 ERR3079478 completed mapping pipeline successfully